Spontaneous abortion among Toxoplasma gondii IgG seropositive women: Molecular detection, genotype identification, and serological assessment with conventional ELISA and avidity ELISA

Abstract

Objectives

It has been generally believed that women who exposed to Toxoplasma gondii before pregnancy and have anti‐T. gondii IgG antibody are immunized and their newborns will be protected from congenital infection. This study is aimed to investigate the role of T. gondii infection in spontaneous abortion through serological and molecular methods in southern Iran.

Study design

Blood samples were taken from 50 spontaneously aborted mothers and anti‐T. gondii antibodies were assessed using conventional enzyme‐linked immunosorbent assay (ELISA) and avidity ELISA methods. The placenta and blood samples of aborted women were used for detection of the parasite's DNA by polymerase chain reaction (PCR) method targeting the RE gene. The parasite genotypes were determined by PCR‐restriction fragment length polymorphism (RFLP) method using SAG3 and GRA6 genes.

Results

IgG antibody was detected in 28% (14/50) of mothers, but all samples were negative for IgM antibody. In the avidity ELISA test, 26% (13/50) of the samples had a high avidity index, suggesting chronic infection, while a low avidity index was detected in one case (2%), which suggests acute infection. The parasite's DNA was detected in 18% (9/50) and 14% (7/50) of blood and placenta samples, respectively. All DNA positive samples were IgG positive. All isolates were belonged to the T. gondii type III genotype.

Conclusion

The results suggest that T. gondii seropositive women are not protected from congenital transmission. However, the results should be interpreted cautiously until further studies will be confirmed these results.

Introduction

Abortion is one of the most important threats to the health of mothers and their fetuses. Toxoplasma gondii infection is one of the most important infectious causes of spontaneous abortion and congenital anomalies. ¹ , ² T. gondii is an intracellular protozoan parasite with a global prevalence and estimates that more than one‐third of the world's population has a history of infection with this parasite. ² Generally, humans get infected through drinking or eating contaminated water or food with oocysts that are excreted through cat feces, consumption of raw or half‐cooked meat containing parasite tissue cysts, or through transplacental transmission. ¹ , ² Although the infection is usually asymptomatic in immunocompetent individuals, ³ the parasite causes acute infection in immunocompromised patients, including organ transplant recipients, HIV/AIDS and cancer patients. ⁴ , ⁵ Latent maternal toxoplasmosis has also several neuropsychiatric sequels for mothers and their offspring. ⁶

The severity of infection depends on several factors, such as the parasite genotype, the number of transferred parasites from the mother to the fetus, and the period of pregnancy. ¹ , ² The risk of mother‐to‐fetus transmission and the severity of clinical symptoms are associated with the time of pregnancy. Accordingly, the risk of transmission in the first, second, and third trimester of pregnancy is about 5%, 13%, and 32%, respectively. ⁷ Nearly 85% of infants with congenital infection at birth have no symptoms, ⁸ but it is possible to observe symptoms of the disease during childhood or adulthood. ⁹ The main symptoms of congenital toxoplasmosis are low body temperature, hydrocephalus, chorioretinitis, strabismus, blindness, epilepsy, mental retardation, congenital anemia, cutaneous rash and thrombocytopenia‐related subcutaneous bleeding, encephalitis, microcephaly, hepatosplenomegaly, and lymphadenopathy. ¹ , ² Several studies have shown the association between T. gondii infection and spontaneous abortion. ¹⁰ On average, the annual incidence of toxoplasmosis in the world is 190 100. ¹⁰ According to a meta‐analysis study in Iran, the prevalence of toxoplasmosis is 39% (95% confidence interval [CI] = 33–46) among the general population and 41% (95% CI = 36–45) among pregnant women. ¹¹ Significant changes in the progression and severity of the disease have been observed among cases of toxoplasmosis, and these changes are probably due to several variables, including the host genetic background and parasite genotypes. ⁶ , ¹² , ¹³ T. gondii has three main genotypes with different pathogenesis. Most known types of Toxoplasma are classified into three clonal lineages, including types I, II, and III. ¹⁴

It has been generally believed that congenital toxoplasmosis is caused by primary T. gondii infection during pregnancy. It means that women who have anti‐T. gondii IgG antibody before pregnancy are immunized and their newborns will be protected from congenital infection. ² The purpose of this study was to investigate the role of T. gondii infection in spontaneous abortion based on serological and molecular methods in Bandar Abbas, southern Iran.

Materials and Methods

Ethical statement

The ethical authorization was obtained from the ethic Committee of Hormozgan University of Medical Sciences, with the code of ethics 3020‐94‐HEC‐5.

Study setting and population

This study was conducted on 50 blood samples of spontaneously aborted mothers and their embryos in two hospitals in Bandar Abbas (Shariati and Persian Gulf hospitals), south of Iran. Blood and placenta samples of pregnant women were taken for serological and molecular evaluation. A questionnaire consisting of demographic criteria and risk factors for toxoplasmosis was registered for all samples by interview. Pregnant women who had been aborted due to genetic factors, strike, or accident were excluded and only subjects with the confirmed spontaneous abortion were included in the study.

Serological detection

Conventional ELISA

The presence of anti‐Toxoplasma IgM and IgG antibodies were assessed using an enzyme‐linked immunosorbent assay (ELISA) assay with a commercial ELISA kit (PishtazTeb, Tehran, Iran) according to the manufacturer's protocol. The positive cutoff value of IgG and IgM antibodies was defined as the upper limit of 10 and 1.1 U/mL, respectively.

Avidity ELISA

All serum samples were assessed by Avidity ELISA using Toxo IgG avidity kit (EUROIMMUN, Germany), according to the manufacturer's protocol and our previous study. The relative avidity index (RAI) was defined as the diagnostic value according to the following criteria:

RAI <40%: indication of low‐avidity antibodies.

RAI 40%–60%: equivocal range.

RAI >60%: indication of high‐avidity antibodies.

Molecular detection

DNA extraction was performed in all blood and placenta samples by DNA extraction kit (Sinaclon, Iran) according to the manufacturer's protocol. Early detection of T. gondii was conducted by polymerase chain reaction (PCR) method targeting the RE gene as described in previous studies. ¹⁵ , ¹⁶ This gene is a sensitive and specific target for early diagnosis of T. gondii, which repeated 200 to 300 times in the parasite's genome (Table 1). ¹⁷ Amplifications were conducted in a final volume of a 25 μL reaction mixture that contained 12.5 μL of 2× Taq DNA polymerase master mix with 2 mM MgCl (Cat. no. A170301, Ampliqon, Denmark), 1.5 μL of each primer (10 pmol), 7.5 μL of distilled water, and 2 μL of template DNA. Amplification was performed with initial denaturation for 7 min at 94°C, followed by 35 cycles for 30 s of 94°C, annealing at 56°C for 30 s, extension at 72°C for 30 s and final extension at 72°C for 10 min. A positive (DNA of the RH strain and T. gondii) and a negative control (distilled water) were included in each set of PCRs. PCR products were run alongside with a 100 bp marker on the agarose gel that stained with safe stain (Sinaclon) in (TAE) in Tris‐acetate‐EDTA buffer.

TABLE 1.

Primer sequences of the RE, GRA6, and SAG3 genes

Marker	External primers (5′–3′)	Internal primers (5′–3′)	Ref.
RE	F: CGCTGCAGGGAGGAAGACGAAAGTTG	R: GCTGCAGACACAGTGCATCTGGATT	17
GRA6	F: ATTTGTGTTTCCGAGCAGGT	F: TTTCCGAGCAGGTGACCT	18
	R: GCACCTTCGCTTGTGGTT	R: CGCCGAAGAGTTGACATAG
SAG3	F: CAACTCTCACCATTCCACCC	R: GCGCGTTGTTAGACAAGACA	18
	F: TCTTGTCGGGTGTTCACTCA	R: CACAAGGAGACCGAGAAGGA

Genotyping of positive isolates by restriction fragment length polymorphism

Genotyping was performed on positive isolates using the GRA6 and SAG3 genes (Table 1) by nested‐PCR method as previously described. ¹⁸ , ¹⁹ The nested PCR products of the GRA6 and SAG3 genes were digested by Tru1I (Cat. No. ER 0982; Thermo Fisher Scientific, USA) and BcnI (Cat. No. ER0061, Thermo Fisher Scientific) restriction enzymes, respectively. ¹⁶ , ¹⁹ Then, 10 μL of the digested products was electrophoresed on the 3% agarose gel and visualized under UV transilluminator.

Sequencing

The nested PCR products of the SAG3 positive samples (five isolates) were sequenced with the forward and reverse primers. The sequences were edited by the Sequencher software (http://www.genecodes.com/) and aligned with BioEdit Multiple Alignment software. ²⁰ The obtained sequences were deposited in the GenBank and compared with other recorded sequences.

Results

Ages of the women at abortion were between 20 and 41 years, and the aborted fetuses were between 2 and 5 months (Table 2). Results of the conventional ELISA test showed that 14 out of 50 women (28%) were IgG positive and all subjects were IgM negative (Table 3). Among the IgG positive cases, 18%, 8%, and 2% had a high (91–200 IU/mL), moderate (51–90 IU/mL), and low (11–50 IU/mL) IgG titers, respectively (Table 3). A low avidity index was detected in 1 out of 50 samples (2%). In this case, PCR was positive in the blood samples but was negative in the placenta samples. Furthermore, 13 out of 50 women (26%) had a high avidity index (Table 2).

TABLE 2.

Information of 14 IgG positive cases

Cases	Age	Month of abortion	Number of gestations	Number of abortions	Contact to cat	Raw/half‐meat	Raw eggs consumption	Raw vegetables	IgM	IgG avidity	IgG titer (IU/mL)	PCR‐blood	PCR‐placenta
1	28	5	3	0	No	Yes	No	Yes	−	Low	55	+	−
2	31	3	3	0	No	Yes	No	Yes	−	High	90	+	+
3	28	2	3	0	No	Yes	Yes	Yes	−	High	100	+	+
4	25	2	2	0	No	Yes	No	Yes	−	High	142	+	+
5	21	2	1	0	No	Yes	No	Yes	−	High	140	+	+
6	27	3	2	0	No	Yes	Yes	Yes	−	High	200	+	+
7	28	2	3	0	Yes	Yes	No	Yes	−	High	140	+	+
8	22	3	3	1	No	Yes	No	Yes	−	High	180	+	+
9	27	2	2	0	No	Yes	No	Yes	−	High	40	+	−
10	25	3	2	0	No	Yes	No	Yes	−	High	100	−	−
11	22	2	1	0	No	Yes	Yes	Yes	−	High	200	−	−
12	24	2	1	0	Yes	Yes	No	No	−	High	55	−	−
13	41	3	5	1	No	Yes	No	Yes	−	High	100	−	−
14	40	2	5	1	No	No	No	Yes	−	High	52	−	−

TABLE 3.

IgG titers in women with spontaneous abortion in southern Iran

IgG concentrations		No (%)
IgG negative (0–10 IU/mL)		36 (72%)
IgG positive	11–50 IU/mL	1 (2%)
	51–90 IU/mL	4 (8%)
	91–200 IU/mL	9 (18%)
	Total IgG positive	14 (28%)
Total		50

The parasite's DNA was detected in 9 (18%) and 7 (14%) of the blood and placenta samples, respectively (Table 2). All PCR positive cases were IgG positive as well (Table 2 and Figure 1). PCR‐restriction fragment length polymorphism (RFLP) results have shown that all isolates were belonged to the T. gondii type III genotype (Figures 2 and 3).

FIGURE 1.

Gel electrophoresis for positive and negative blood and placenta samples by the RE gene. Lines 1 and 2 positive blood samples and lines 5, 7, and 9 placenta samples with 529 bp bands. Ladder: 100 bp marker

FIGURE 2.

Gel electrophoresis of Toxoplasma gondii isolates by the GRA6 gene that digested by the Tru1I enzyme showing the type III genotype. Lane 1 is undigested positive samples. Lanes 2 to 4 are blood samples, lanes 5 and 6 are the digested placenta samples

FIGURE 3.

Electrophoresis gel of Toxoplasma gondii isolates of the SAG3 gene cut by the NciI enzyme showing the type III genotype. Lane 1 is undigested positive samples. Lanes 1 and 2 are digested blood samples and lane 3 is a digested sample from placenta

Five isolates were sequenced by the SAG3 gene and deposited in the GenBank database with the following accession numbers (MF939101‐104 and MF939107). The nucleotide blast of these sequences at the NCBI (http://blast.ncbi.nlm.nih.gov/blast/Blast.cgi) revealed >99% similarity with T. gondii isolated that was deposited in the GenBank (Table 4).

TABLE 4.

NCBI‐BLAST homology sequence identity between our isolates and GenBank isolates

Genbank submission accession number	Sample	NCBI BLAST identity isolate	Identity (%) with some sequences from the GenBank
MF939101	Blood	Toxoplasma gondii	99.12% identity with MT361130, MH744787, and LC414534
MF939102	Blood	T. gondii	100% identity with MT361130, MH744787, and LC414534
MF939103	Blood	T. gondii	100% identity with MT361130, MH744787, and LC414534
MF939104	Blood	T. gondii	100% identity with MT361130, MH744787, and LC414534
MF939107	Placenta	T. gondii	99.56% identity with MF939099, 99.12% with MT361130, and 99.12% with MH744787

Discussion

It has been generally believed that women who have anti‐T. gondii IgG antibody before pregnancy are immunized and their newborns will be protected from congenital infection, in other word, congenital toxoplasmosis is occurred due to primary T. gondii infection during pregnancy. ² In the current study, although 28% (14/50) of mothers with spontaneous abortion were IgG seropositive, the parasite's DNA was detected in 9 (18%) and 7 (14%) of their blood and placenta samples, respectively. In the IgG avidity test, a low avidity IgG was detected in one case (2%) which was PCR positive in their blood sample, suggesting acute infection. In this case, the abortion occurred in the month of 5 of their pregnancy (Table 2). Furthermore, 26% of women (13/50) had a high avidity IgG index, suggesting chronic infection, including eight and seven women who were PCR positive in their blood and placenta samples, respectively. In these cases, the abortion was occurred in month 2 or 3 of pregnancy (Table 2). In the IgG avidity test, a high avidity index means that the infection was acquired before 3 months ago; while a low avidity index means that the infection was acquired within the last 3 months. Interestingly, all cases were IgM seronegative. Hence, our results do not support that seropositive pregnant women are protected from congenital transmission. It should be noted that toxoplasmosis could be transmitted even if the mother gets the infection some month before pregnancy and this fact could explain the absence of IgM. ²¹

Different studies reveal that the seroprevalence of toxoplasmosis is relatively high among the Iranian pregnant women. ¹¹ This rate in Zahedan Province, southeastern Iran, was 27% ²² and in Northern Iran was 43.8%. ²³ Our previous study among pregnant women in the same region of this study (Hormozgan Province, South of Iran) revealed that T. gondii IgG and IgM seropositivities were detected among 27% and 0.83% of pregnant women, respectively, while 3.6% of the cases had low avidity IgG. ²⁴ The IgG and IgM seroprevalence of toxoplasmosis in pregnant women in Fars province, Southern Iran, was reported 8.6% and 0.2%, respectively. ²⁵ T. gondii IgG antibody was detected in 27.2% of pregnant women with a history of spontaneous abortion in Tehran, Iran. ²⁶

Abdoli et al. ¹⁹ tested 200 human samples from paraffin blocks of the placenta of women with multiple abortions in Tehran and identified the Toxoplasma DNA in 3.8% of subjects. ¹⁹ Asgari et al. identified DNA T. gondii in 14.4% of paraffin tissue samples of women with spontaneous abortion in Shiraz, south of Iran. ²⁷ Ghasemi et al. detected Toxoplasma DNA in 7.3% of aborted and 3.4% of dead birth babies in Tehran, Iran. ²⁸

Our study revealed that all positive samples belong to the T. gondii genotype III. T. gondii has three main genotypes (types I, II, and III). ²⁹ Type III is one of the most common Toxoplasma parasite genotypes in the world and Iran. ¹⁵ , ¹⁶ , ¹⁹ , ³⁰ , ³¹ In North America and Europe, type II is more common in human toxoplasmosis. ³² T. gondii type I has the highest levels of severity and causes serious infection in humans. ¹⁴ Type II is more common in humans and animals and often causes chronic illness, although in individuals with a compromised immune system may cause severe illnesses. ¹⁸ T. gondii type III is more prevalent in birds and has lower severity than types I and II. ¹⁸ , ³⁰ Asgari et al. detected T. gondii types II and III among 83.1% and 16.9% of women with spontaneous abortion in Shiraz, South of Iran ²⁷ ; while all samples isolated from aborted placenta using in Tehran belong to the Toxoplasma type III. ¹⁹ However, Zia‐ali et al. detected T. gondii II and III in animals in Tehran and Mazandaran provinces of Iran. ³¹ In our previous study in the same region (Hormozgan province), we detected T. gondii type III in chicken eggs ¹⁵ and slathered sheep. ¹⁶

A genotyping study of 86 isolates of T. gondii in France showed that 85% of infected mothers were of genotype II. ³² The Genotypic study of 20 isolates of T. gondii from pregnant women with abortion in Cyprus showed that 15 isolates belonged to type III and 5 Isolates to type II. ³³ The same study in Tunisia with 14 isolates of T. gondii showed that 13 isolates were infected with a combination of genotypes of type I‐III and I‐II, and just in one case type I was observed. ³⁴ Genotyping of the Toxoplasma isolated from infants' congenital toxoplasmosis in Poland indicated type II as the dominant type. ³⁵ The genotype of Toxoplasma in 38 women with abortion and intrauterine fetal deaths in Egypt showed that 33 cases (87%) belong to type II and 5 cases (13%) to type I. ³⁶ In Denmark ³⁷ and in Spain, ³⁸ the main reported genotype was type II.

Taken together, our results do not support that seropositive pregnant women are immunized and protected from congenital transmission. However, the results should be interpreted cautiously until further studies will be confirmed these results because we could not perform real time PCR assays at the time of sampling to confirm that parasites were alive.

Author contributions

Seyedeh Zahra Khademi, Abdolhossein Dalimi, and Fatemeh Ghaffarifar designed and coordinated the study. Seyedeh Zahra Khademi and Parivash Davoodian collected the samples. Seyedeh Zahra Khademi and Amir Abdoli analyzed the samples. Seyedeh Zahra Khademi, Fatemeh Ghaffarifar, and Amir Abdoli drafted the manuscript. All authors read and approved the final manuscript.

Funding information

This study is financially supported by Tarbiat Modares University.

Conflict of interest

None.

Data availability statement

The data will be made available by the corresponding author on request.