Cigarette Smoke Extract Promotes Epithelial–Mesenchymal Transition in Non‐Small Cell Lung Cancer by Upregulating PRMT6

ABSTRACT

Background and Objective

Non‐small cell lung cancer (NSCLC) is a leading cause of cancer‐related mortality worldwide. Cigarette smoke extract (CSE) is a major environmental factor driving NSCLC progression, yet the underlying molecular mechanisms remain incompletely understood. Protein arginine methyltransferase 6 (PRMT6) is implicated in various malignancies, including NSCLC, and epithelial–mesenchymal transition (EMT) contributes to metastasis and poor prognosis in this disease. However, the role of PRMT6 in CSE‐induced NSCLC progression has not been elucidated.

Methods

NSCLC progression under CSE exposure was assessed using a subcutaneous xenograft model in nude mice and in vitro assays in H1299 cells. Tumor growth and molecular alterations were evaluated by immunohistochemistry, CCK‐8, wound healing, Transwell, immunofluorescence, qRT‐PCR, and western blotting.

Results

CSE exposure enhanced H1299 cell proliferation, migration, and invasion in vitro and promoted xenograft tumor growth in vivo. This was accompanied by upregulated expression of PRMT6 and its effector H3R2me2a, elevated mesenchymal markers (N‐cadherin, MMP2, MMP9, vimentin), and transcription factors (Snail, TWIST1), and increased phosphorylation of PI3K p85, Akt, and mTOR. Notably, all CSE‐induced effects were abrogated by the PRMT6 inhibitor EPZ020411.

Conclusion

CSE promotes NSCLC progression by upregulating PRMT6, leading to PI3K/Akt/mTOR activation and EMT induction. These findings highlight PRMT6 as a potential therapeutic target in NSCLC.

This study reveals that cigarette smoke extract (CSE) upregulates PRMT6, activating the PI3K/Akt/mTOR pathway and inducing EMT, thereby promoting NSCLC progression. Inhibition of PRMT6 effectively reverses these oncogenic effects.

1. Introduction

Lung cancer remains the leading cause of cancer‐related morbidity and mortality worldwide [1]. Cigarette smoking is unequivocally established as a primary risk factor for lung cancer, accounting for an estimated 80.6%–81.9% of lung cancer‐attributable fatalities [2]. The risk of lung cancer development exhibits a positive dose–response relationship with both smoking duration and intensity. Epidemiological estimates indicate that the lifetime risk of developing lung cancer among current smokers is as high as 10%–20%, whereas it is only 1%–2% among never‐smokers [3]. Moreover, current smokers demonstrate a 2.94‐fold higher all‐cause mortality from non‐small cell lung cancer (NSCLC) than never‐smokers [4]. NSCLC constitutes approximately 85% of all lung cancer cases. Retrospective analyses reveal that, compared to never‐smoking NSCLC patients, those with smoking histories have poorer OS, elevated mortality rates, and increased pain severity [5]. Notably, continued smoking post‐diagnosis further worsens clinical outcomes. Although the association between smoking and lung cancer is well‐characterized, the precise molecular mechanisms driving smoking‐induced NSCLC progression remain incompletely elucidated. Further research to identify key regulatory pathways is essential for developing targeted therapies against smoking‐associated NSCLC progression.

NSCLC pathogenesis is critically regulated by posttranslational modifications (PTMs), which serve as pivotal modulators of both epigenetic landscapes and signaling cascades. Among these PTMs, arginine methylation plays a fundamental role in transcriptional regulation, mRNA processing, and cellular signal transduction [6]. This modification is catalyzed by protein arginine methyltransferases (PRMTs) [7]. As a histone methyltransferase, PRMT6 modifies all four core histones, with histone H3 arginine 2 asymmetric dimethylation (H3R2me2a) representing its predominant physiological modification [8]. PRMT6 overexpression has been clinically associated with multiple malignancies, including breast, cervical, bladder, prostate, and lung cancers. Elevated PRMT6 expression levels demonstrate significant correlation with enhanced tumorigenesis and disease progression. Molecular analyses reveal PRMT6's oncogenic potential through multiple mechanisms: (i) transcriptional repression of the cell cycle inhibitor p18 [9], (ii) disruption of p16‐CDK4 complex formation via p16 methylation [10], and (iii) mediation of cigarette smoke extract (CSE)‐induced apoptosis and inflammatory responses through H3R2me2a‐dependent pathways [11]. Nevertheless, the comprehensive molecular mechanisms underlying PRMT6's role in CSE‐mediated NSCLC progression remain to be fully characterized.

Emerging evidence highlights the pivotal role of protein arginine methyltransferase 6 (PRMT6) in modulating the epithelial–mesenchymal transition (EMT) through its dual substrate specificity. As a key epigenetic modifier, PRMT6 catalyzes methylation of both histone and non‐histone proteins, thereby orchestrating gene expression programs critical for EMT [12]. EMT plays a pivotal role in NSCLC pathogenesis. Furthermore, cigarette smoke exposure has been demonstrated to induce EMT in both primary alveolar epithelial cells and lung cancer cell lines. Clinical evidence further reveals elevated EMT marker expression in the airway epithelium of active smokers compared to non‐smokers [13]. Previous studies have demonstrated that PI3K/Akt/mTOR pathway activation occurs in 50%–70% of NSCLC cases [14], which serves as a central regulator in EMT regulation through multiple mechanisms [15, 16]. Notably, PRMT6 has been implicated in PI3K/Akt/mTOR pathway activation across various malignancies. PRMT6 exhibits oncogenic properties by activating the Akt/mTOR pathway in endometrial cancer [17], while PRMT6 knockdown significantly reduces Akt phosphorylation and mTOR expression in prostate cancer [18]. Therefore, we hypothesize that PRMT6 upregulation may be a significant mechanism that activates the PI3K/Akt/mTOR signaling pathway and promotes EMT progression in NSCLC.

Previous studies have implicated PRMT6 in lung cancer. However, the precise role of PRMT6 in CSE‐driven NSCLC progression remains completely unknown. Here, we provide the first evidence that CSE exposure upregulates PRMT6 expression, leading to activation of the PI3K/Akt/mTOR signaling pathway and induction of EMT, thereby impacting NSCLC progression. Moreover, we demonstrate that pharmacological inhibition of PRMT6 effectively reverses these CSE‐induced oncogenic phenotypes. Our findings may establish PRMT6 as a novel molecular nexus between tobacco exposure and NSCLC progression, potentially revealing new therapeutic vulnerabilities for smoking‐associated lung malignancies.

2. Materials and Methods

2.1. Reagents and Antibodies

The EPZ020411 2HCl inhibitor was purchased from Selleck and dissolved in dimethyl sulfoxide (DMSO) at a stock concentration of 50 mM. Rabbit monoclonal antibodies against PRMT6, mTOR, p‐mTOR, Pan‐Akt, PI3K p85, ZO‐1, Snail, MMP2, MMP9, and β‐actin were obtained from ABclonal. Rabbit monoclonal antibodies against H3, H3R2me2a, p‐Akt (Ser473), TWIST1, Vimentin, and N‐Cadherin were purchased from Cell Signaling Technology.

2.2. Cell Culture

The human large‐cell lung carcinoma cell line H1299 was provided by the Lung Cancer Institute of Tianjin Medical University General Hospital. H1299 cells were cultured in RPMI‐1640 medium supplemented with 10% fetal bovine serum (FBS) at 37°C in a 5% CO₂ incubator. The medium was replaced every other day, and cells in the logarithmic growth phase were used for experiments.

2.3. Preparation of CSE Solution

A 10 mL volume of serum‐free and sterile DMEM medium, pre‐exposed to ultraviolet irradiation for 30 min, was drawn into a 60 mL plastic syringe. Then, 40 mL of cigarette smoke was slowly drawn into the syringe and vigorously shaken for 30 s to ensure thorough mixing. Each cigarette was drawn 11 times, with 10 mL of medium used per cigarette. The solution was filtered through a 0.22 μm sterile filter to obtain a 100% CSE solution. Before use, the CSE solution was diluted in culture medium, prepared by the same operator using the same protocol, and used within 30 min of preparation. For animal experiments, cigarette smoke was mixed with sterile PBS using a vacuum pump (2 mL per cigarette) to prepare the CSE solution. The mixture was then filtered through a 0.22 μm sterile filter in a biosafety cabinet to remove bacteria and particulate matter before use.

2.4. Nude Mouse Xenograft Tumor Model

Female BALB/c‐nu nude mice aged 4–6 weeks were used for the experiments. All animal procedures were conducted in strict accordance with the guidelines of the Tianjin Medical University Animal Care and Use Committee. After weighing, the mice were randomly divided into four groups (n = 4 per group): NC (negative control), CSE, EPZ (EPZ020411 treatment), and CSE + EPZ. H1299 cells were expanded in vitro and adjusted to a density of 2 × 10⁷ cells/mL. Each mouse was subcutaneously injected with 100 μL of cell suspension in the inguinal region. Food, water, and bedding were replaced every 3 days, and tumor volume and mouse body weight were measured periodically. Tumor volume was calculated using the formula: Volume (mm³) = d ² × D/2 (where d is the short diameter and D is the long diameter).

The CSE solution was prepared as described above. The CSE and CSE + EPZ groups received intraperitoneal injections of CSE solution (0.3 mL/mouse, every 10 days), while the NC and EPZ groups received an equivalent volume of PBS as a control. When the average tumor diameter reached 5 mm, the EPZ and CSE + EPZ groups were treated with EPZ020411 (10 mg/kg, intraperitoneal injection, every 3 days), whereas the NC and CSE groups received DMSO as a control. Tumor growth was monitored regularly. At the endpoint, all mice were euthanized, and lung tissues were harvested. Tumors were excised, weighed, and subjected to hematoxylin–eosin (HE) staining to assess the effects of CSE exposure on lung histology.

2.5. HE Staining

Mouse lung tissues were dehydrated in an ethanol gradient, cleared in xylene, and embedded in paraffin. Sections were deparaffinized in xylene, followed by rehydration in a descending ethanol series (100%, 95%, and 85%). After staining with HE, the sections were rinsed under running water, dehydrated in an ascending ethanol series, cleared in xylene, and mounted with neutral resin.

2.6. Immunohistochemistry (IHC)

For IHC staining, formalin‐fixed, paraffin‐embedded tumor sections were deparaffinized in xylene and rehydrated in an ethanol gradient. After washing in PBS, endogenous peroxidase activity was blocked with 3% hydrogen peroxide in methanol for 20 min. A biotin‐blocking kit was used to suppress nonspecific binding. Slides were incubated with primary antibodies overnight at 4°C in a humidified chamber, washed with PBS, and then incubated with secondary antibodies at room temperature for 1 h. Detection was performed using DAB, followed by counterstaining with hematoxylin. Sections were dehydrated, cleared, and mounted with neutral resin for microscopic examination.

2.7. PCR

Total RNA was extracted using Trizol reagent, and cDNA was synthesized from 1 μg of total RNA using a PrimeScript RT kit. Quantitative real‐time PCR (qRT‐PCR) was performed on a Bio‐Rad CFX96 system under the following cycling conditions: 50°C for 2 min, 95°C for 2 min, followed by 39 cycles of 95°C for 15 s, 55°C for 15 s, and 72°C for 1 min. Primer sequences were as follows: PRMT6‐F: 5′‐ACTGTAGAGTTGCCGGAACA‐3′; PRMT6‐R: 5′‐TCCTTCTCAGCCACTTGGTTCG‐3′; N‐GAPDH‐F: 5′‐ACCACAGTCCATGCCATCAC‐3′; O‐GAPDH‐R: 5′‐CCACCACCCTGTTGCTGTAG‐3′. The relative mRNA levels of target genes were normalized to GAPDH.

2.8. Western Blotting

Proteins were extracted from lysed cells, separated by SDS‐PAGE, and transferred to nitrocellulose membranes. After blocking with 5% nonfat milk for 1 h at room temperature, membranes were incubated with primary antibodies overnight at 4°C. Following three washes with TBST, membranes were incubated with HRP‐conjugated secondary antibodies for 2 h at room temperature. Protein bands were visualized using ECL substrate in a gel imaging system.

2.9. CCK‐8 Assay

Cell viability after CSE exposure was assessed using a CCK‐8 kit. H1299 cells were seeded in 96‐well plates (4000 cells/well) and cultured for 48 h. Then, 10 μL of CCK‐8 solution was added to each well, and cells were incubated for 30 min at 37°C under 5% CO₂. Absorbance (OD) was measured at 450 nm using a microplate reader. Each experiment was performed in triplicate.

2.10. Scratch Assays

H1299 cells were seeded at a density of 1 × 10⁵ cells per well in six‐well plates and serum‐starved overnight to synchronize cell growth. A sterile pipette tip was used to create a uniform scratch across each well. Images of the scratch were captured at 0 and 48 h post‐scratching using an inverted microscope. The wound closure was quantified by measuring the distance between the edges of the scratch at the specified time points.

2.11. Transwell Assay

Cell migration and invasion were evaluated using Transwell chambers with 8‐μm pore size inserts. H1299 cells were serum‐starved overnight and then pretreated with EPZ020411 as needed. Cells were exposed to CSE where indicated. After 48 h, cells were trypsinized, counted, and 5 × 10⁴ cells were seeded into the upper chamber containing serum‐free medium. The lower chamber contained 10% FBS medium as a chemoattractant. After 24 h, cells that migrated to the lower surface of the insert were fixed with methanol, stained with crystal violet, and counted under a microscope.

2.12. Immunofluorescence

H1299 cells were seeded at a density of 3 × 10⁴ cells per well on coverslips in 24‐well plates. Cells were fixed with 4% paraformaldehyde for 15 min and permeabilized with 0.25% Triton X‐100 for 10 min. Nonspecific binding was blocked with 5% bovine serum albumin (BSA) for 2 h at room temperature. Primary antibodies were applied and incubated overnight at 4°C. Cells were then incubated with fluorescent secondary antibodies (diluted 1:500 in 5% BSA) for 30 min at 37°C. Nuclei were counterstained with DAPI, and coverslips were mounted with an antifade medium for fluorescence microscopy. Images were captured using a fluorescence microscope.

2.13. Statistical Analysis

All in vitro experiments were performed as three independent replicates, with each replicate using a freshly thawed and independently cultured batch of H1299 cells. Data are presented as the mean ± standard deviation (SD) of these three independent experiments. Statistical analyses were performed using GraphPad Prism software. Differences between two groups were analyzed using unpaired t‐tests, while multiple comparisons were performed using one‐way ANOVA followed by Tukey's post hoc test.

For two group comparisons, additional FDR or Bonferroni correction was not applied, as the ANOVA with Tukey's test provides appropriate control for multiple comparisons. A p value of less than 0.05 was considered statistically significant (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001). Sample size justification and statistical power analysis: Post hoc statistical power analysis was performed using G*Power software (version 3.1; Heinrich Heine University Düsseldorf, Germany) to evaluate whether the sample size (n = 4 per group) was adequate to detect the observed effects. For the primary endpoints (tumor volume and tumor weight), Cohen's d effect sizes and achieved power were calculated based on the actual group means and pooled SDs from the experimental data. All statistical comparisons achieved power substantially above the conventional threshold of 0.80, confirming that the sample size of n = 4 per group was sufficient to detect the statistically significant differences reported in this study.

3. Results

3.1. A 2.5% CSE Treatment Promotes H1299 Cell Proliferation and Upregulates PRMT6 Expression

To investigate the oncogenic effects of CSE, we first evaluated its impact on the proliferation of H1299 NSCLC cells. After 48‐h CSE exposure (0%, 1.0%, 2.5%, 5.0%, 10.0%, and 15.0%), CCK‐8 assays demonstrated a concentration‐dependent biphasic response in H1299 cell viability, with 2.5% CSE inducing maximal proliferative stimulation and higher concentrations showing dose‐dependent cytotoxicity (Figure 1a). Time‐course experiments identified 48 h as the optimal exposure duration (Figure 1b). These parameters were selected for subsequent mechanistic studies. Then H1299 cells were treated with 2.5% CSE (CSE group) or PBS (NC group) for 48 h. Immunofluorescence analysis demonstrated significant upregulation of PRMT6 (Figure 1c,d) and H3R2me2a (Figure 1e,f) in CSE‐treated cells compared to NC controls. qRT‐PCR further revealed that CSE exposure increased PRMT6 mRNA (Figure 1g), and Western blot analysis confirmed the upregulation of both PRMT6 and H3R2me2a in the CSE group (Figure 1h,i). These findings suggest that CSE exposure upregulates PRMT6 expression through transcriptional activation and posttranslational stabilization.

FIGURE 1.

CSE promotes H1299 cell proliferation and upregulates PRMT6 expression. (a) H1299 cell viability assessed by CCK‐8 assay after 48‐h exposure to CSE (0%, 1.0%, 2.5%, 5.0%, 10.0%, and 15.0%). (b) Time‐course of H1299 cell viability under 2.5% CSE treatment (0, 24, 48, 72, and 96 h) measured by CCK‐8 assay. (c) Representative immunofluorescence images of PRMT6 expression in H1299 cells treated with NC and CSE groups. (d) Statistical analysis of PRMT6 immunofluorescence intensity in (c); n = 3, p < 0.05. (e) Representative immunofluorescence images of H3R2me2a expression in H1299 cells treated with NC and CSE groups. (f) Statistical analysis of H3R2me2a immunofluorescence intensity in (e); n = 3, p < 0.05. (g) PRMT6 mRNA expression in H1299 cells determined by qRT‐PCR. (h) Representative Western blot images of PRMT6 and H3R2me2a protein levels in H1299. (i) Statistical analysis of PRMT6 and H3R2me2a protein expression in (h); n = 3, p < 0.05. (*p < 0.05, **p < 0.01, ***p < 0.001)

3.2. CSE‐Induced PRMT6 Upregulation Promotes Subcutaneous Tumorigenesis In Vivo

To evaluate the effects of CSE exposure and PRMT6 expression on NSCLC in vivo, we established a subcutaneous xenograft model using H1299 cells in nude mices. Animals were randomly allocated into four groups: the NC group, the CSE group, the EPZ020411 (EPZ) group, and the CSE + EPZ group. Following a 6‐week treatment period, lung tissues and subcutaneous tumors were collected for pathological and molecular analyses. Histopathological analysis of lung tissues revealed significant alveolar enlargement, parenchymal destruction, bulla formation and inflammatory infiltration in nude mice exposed to CSE (Figure 2a). These findings indicate that intraperitoneal administration of CSE induces emphysema‐like changesin murine lungs, thereby confirming its biological impact. IHC analysis demonstrated high expression of PRMT6 and H3R2me2a in H1299 cell‐derived xenografts, and treatment with EPZ020411 effectively suppressed PRMT6 and H3R2me2a expression (Figure 2b,c, NC vs. EPZ). This demonstrate the inhibitory effect of EPZ020411 on PRMT6 activity in vivo. Furthermore, compared with NC group, CSE exposure significantly elevated PRMT6 and H3R2me2a levels (Figure 2b,c, NC vs. CSE). Notably, EPZ020411 reversed this CSE‐induced upregulation (Figure 2b,c, CSE vs. CSE + EPZ).

FIGURE 2.

CSE‐induced PRMT6 upregulation promotes subcutaneous tumorigenesis in vivo. (a) Representative H&E‐stained lung tissue sections from nude mice in NC and CSE groups showing alveolar structure. (b) Representative immunohistochemical images of PRMT6, H3R2me2a, N‐cadherin, and MMP2 expression in tumor xenografts. (c) Statistical analysis of IHC staining intensity for PRMT6 and H3R2me2a in (b); n = 4, p < 0.05. (d) Statistical analysis of IHC staining intensity for N‐cadherin and MMP2 in (b); n = 4, p < 0.05. (e) Representative photographs and (f) final tumor weights of excised subcutaneous tumors from each treatment group; n = 4, p < 0.05. (g) Tumor growth rate in nude mice across different treatment groups.(*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001)

Tumor progression was systematically evaluated through serial photographic documentation, gravimetric analysis, and volumetric measurements, revealing distinct growth patterns across experimental groups (Figure 2e–g). The mean tumor weights were as follows: NC group, 1.305 ± 0.044 g (mean ± SEM; SD = 0.088 g); CSE group, 1.840 ± 0.057 g (mean ± SEM; SD = 0.114 g); EPZ group, 0.532 ± 0.024 g (mean ± SEM; SD = 0.047 g); and CSE + EPZ group, 0.805 ± 0.038 g (mean ± SEM; SD = 0.075 g). The mean tumor volumes were: NC group, 1322 ± 65 mm³ (mean ± SEM; SD = 130 mm³); CSE group, 1830 ± 60 mm³ (mean ± SEM; SD = 120 mm³); EPZ group, 536 ± 22 mm³ (mean ± SEM; SD = 43 mm³); and CSE + EPZ group, 803 ± 44 mm³ (mean ± SEM; SD = 87 mm³). Compared to the NC group, the CSE group demonstrated significantly increased tumor weight (p < 0.001, Cohen's d = 5.25, power > 0.99), larger tumor volume (p < 0.001, Cohen's d = 4.06, power > 0.99), and accelerated growth rate, demonstrating accelerated tumor progression following CSE exposure. In contrast, PRMT6 inhibition with EPZ020411 markedly reduced tumor growth compared to the NC group (tumor weight: p < 0.001, Cohen's d = 10.96, power > 0.99; tumor volume: p < 0.001, Cohen's d = 8.12, power > 0.99), while the CSE + EPZ group demonstrated significant suppression of CSE‐driven tumor growth compared to the CSE group alone (tumor weight: p < 0.001, Cohen's d = 10.73, power > 0.99; tumor volume: p < 0.001, Cohen's d = 9.80, power > 0.99). These growth parameters correlated strongly with tumor PRMT6 expression levels, establishing a direct relationship between CSE‐induced PRMT6 upregulation and enhanced tumor growth potential. Importantly, PRMT6 inhibition effectively counteracted CSE‐driven tumor progression, supporting the therapeutic potential of targeting PRMT6 in smoking‐associated NSCLC.

3.3. CSE‐Induced PRMT6 Upregulation Promotes EMT Progression in NSCLC

Immunohistochemical analysis of subcutaneous xenograft tissues demonstrated that CSE exposure significantly upregulated the expression of mesenchymal markers N‐cadherin and MMP2 compared to the NC group (Figure 2b,d, NC vs. CSE), indicating enhanced EMT progression in vivo induced by CSE. However, this effect was markedly attenuated in the CSE + EPZ group (Figure 2b,d, CSE vs. CSE + EPZ), where PRMT6 inhibition EPZ020411 substantially reduced N‐cadherin and MMP2 expression, suggesting that PRMT6 plays a critical role in mediating CSE‐induced EMT in NSCLC tumors.

Immunofluorescence (Figure 3a–d) and Western blot analyses (Figure 3e,f) confirmed that EPZ020411 effectively suppressed PRMT6 and H3R2me2a expression. These findings demonstrate the inhibitory effect of EPZ020411 on PRMT6 activity in vitro. Moreover, co‐treatment with CSE and EPZ020411 partially reversed the CSE‐induced upregulation of PRMT6 and H3R2me2a.

FIGURE 3.

EPZ020411 effectively suppressed PRMT6 and H3R2me2a expression. (a) Representative immunofluorescence images of PRMT6 expression in H1299 cells from each treatment group. (b) Representative immunofluorescence images of H3R2me2a expression in H1299 cells from each treatment group. (c) Statistical analysis of PRMT6 immunofluorescence intensity in (a); n = 3, p < 0.05. (d) Statistical analysis of H3R2me2a immunofluorescence intensity in (a); n = 3, p < 0.05. (e) Representative Western blot images of PRMT6 and H3R2me2a protein levels in H1299 cells from NC, CSE, EPZ, and CSE + EPZ groups. (f) Statistical analysis of PRMT6 and H3R2me2a protein expression in (a); n = 3, p < 0.05. (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001)

Functional assays revealed that CSE exposure enhanced the migratory and invasive capacities of H1299 cells, as evidenced by accelerated wound closure in scratch assays (Figure 4a,b) and increased cell penetration in Transwell assays (Figure 4c–e). These tumor‐promoting effects were significantly diminished in the presence of EPZ020411. Western blot analysis of EMT‐related molecules showed that CSE treatment upregulated mesenchymal markers (N‐cadherin, vimentin, MMP2, MMP9) and transcription factors (Snail, TWIST1). E‐cadherin expression was undetectable in H1299 cells, which aligns with their reported mesenchymal characteristics. In contrast to the typical EMT model, we observed an upregulation in the expression of the tight junction protein ZO‐1 following CSE stimulation. These changes were reversed upon PRMT6 inhibition, with the CSE + EPZ group exhibiting reduced expression of these factors (Figure 4f–n). The consistent correlation between PRMT6/H3R2me2a expression and mesenchymal markers modulation further supports the role of PRMT6 in regulating CSE‐induced EMT.

FIGURE 4.

CSE enhances migration, invasion and EMT marker expression in H1299 cells in a PRMT6‐dependent manner. (a) Representative image of wound healing assay of H1299 cells. (b) Statistical analysis for wound healing assays in (a); n = 3, p < 0.05. (c) Representative image of transwell assays of H1299 cells. (d, e) Statistical analysis for transwell assays in (c); n = 3, p < 0.05. (f) Representative Western blot images of PRMT6 and EMT‐related proteins in H1299 cells from NC, CSE, EPZ and CSE + EPZ groups. (g–n) Statistical analysis of PRMT6 and EMT‐related proteins expression from (f); n = 3, p < 0.05. (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001)

3.4. PRMT6 May Mediates CSE‐Induced PI3K/Akt/mTOR Signaling Pathway Activation

Previous research has demonstrated that the PI3K/AKT pathway is a pivotal regulator of EMT in lung tumor cells [19]. In our study, immunohistochemical analysis of subcutaneous xenograft tissues revealed that CSE exposure led to concurrent upregulation of PRMT6 and increased phosphorylation of key signaling molecules, including PI3K p85, phosphorylated Akt (p‐Akt), and phosphorylated mTOR (p‐mTOR). This activation was significantly attenuated when PRMT6 expression was pharmacologically inhibited by EPZ020411 (Figure 5a,b). Western blot analysis of H1299 cells yielded consistent results (Figure 5c–f), showing that the protein expression levels of PI3K p85, p‐Akt, and p‐mTOR across treatment groups closely paralleled PRMT6 expression patterns. The PRMT6 inhibitor EPZ020411 effectively suppressed CSE‐mediated activation of the PI3K/Akt/mTOR pathway. The strong correlation between PRMT6 expression levels and PI3K/Akt/mTOR pathway activation in both in vivo and in vitro models supports the conclusion that PRMT6 serves as an essential mediator of this signaling cascade. These findings provide mechanistic insight into how CSE may promote oncogenic signaling through PRMT6‐dependent regulation of the PI3K/Akt/mTOR pathway.

FIGURE 5.

PRMT6 may mediate CSE‐induced activation of the PI3K/Akt/mTOR signaling pathway. (a) Representative immunohistochemical images of PI3K p85, p‐Akt, and p‐mTOR expression in tumor xenografts from NC, CSE, EPZ, and CSE + EPZ groups. (b) Statistical analysis of PI3K p85, p‐Akt, and p‐mTOR IHC staining intensity from (a); n = 4, p < 0.05. (c) Representative Western blot images of PRMT6, PI3K p85, p‐Akt, and p‐mTOR in H1299 cells from NC, CSE, EPZ, and CSE + EPZ groups. (d) Statistical analysis of PRMT6 and PI3K p85 protein expression from (a); n = 3, p < 0.05. (e, f) Statistical analysis of mTOR/p‐mTOR and Akt/p‐Akt protein expression from (a); n = 3, p < 0.05. (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001)

4. Discussion

Tobacco smoking remains a predominant global risk factor for non‐NSCLC mortality, responsible for approximately 75% of lung cancer deaths in males and 37% in females [20]. The carcinogenic effects of tobacco smoke constituents have been further well‐documented with multiple pathogenic mechanisms identified, including chronic inflammation, genomic instability, epigenetic modifications, and enhanced cellular proliferation and motility. Our experimental data corroborate these clinical findings, demonstrating that CSE significantly enhances the proliferative capacity of H1299 cells in vitro and promotes tumor growth in xenograft models. Despite extensive epidemiological evidence linking smoking to NSCLC progression, the underlying molecular mechanisms remain incompletely understood. Our study provides mechanistic insights into how CSE drives NSCLC progression through specific molecular pathways. These findings contribute to the growing understanding of smoking‐related lung carcinogenesis and highlight potential therapeutic targets for this clinically important NSCLC subset.

Arginine methylation has emerged as a critical PTM regulating diverse cellular processes including transcriptional regulation, RNA processing, and DNA damage response. Increasing evidence implicates its role in cancer progression and metastasis. The PRMT family, comprising nine members in mammals, catalyzes arginine methylation. PRMT6, a 41.9 kDa Type I enzyme encoded on chromosome 1, primarily localizes to the nucleus where it regulates critical nuclear processes [21]. PRMT6 mediates epigenetic regulation by asymmetrically dimethylating histone H3 at arginine 2 (H3R2me2a) [21]. While PRMT6 overexpression has been documented in NSCLC, its specific role in CSE‐exposed NSCLC remains poorly characterized. To elucidate the role of PRMT6 in CSE‐mediated NSCLC progression, we systematically investigated its expression and functional consequences under CSE exposure. Our experimental approach demonstrated that treatment of H1299 cells with CSE resulted in concentration‐dependent effects on cell viability and proliferation, with maximal stimulation observed at 2.5% CSE concentration. Comprehensive molecular characterization through Western blot analysis, immunofluorescence staining, and IHC consistently revealed elevated expression levels of both PRMT6 and H3R2me2a in CSE‐exposed H1299 cells and xenograft tumor tissues. Moreover, the PRMT6 inhibitor EPZ020411 downregulated H3R2me2a expression in vitro and in vivo, and reversed CSE‐induced enhancement of subcutaneous tumor formation in nude mice. These findings establish PRMT6 upregulation as the critical role in CSE‐driven NSCLC progression. The functional significance of PRMT6 in this context may be underscored by its ability to modulate multiple oncogenic processes through both epigenetic and non‐epigenetic mechanisms.

EMT plays a central role in NSCLC migration, invasion, and progression through mechanisms involving phenotypic remodeling, microenvironment interactions, and signaling pathway activation [22]. In the present study, we hypothesized that PRMT6 upregulation induced by CSE promotes NSCLC progression by facilitating EMT. Immunohistochemical analysis of xenograft tissues supported this hypothesis, demonstrating elevated expression of the mesenchymal marker N‐cadherin and matrix metalloproteinase MMP2 in CSE‐exposed tumors which was attenuated by PRMT6 inhibitor EPZ020411. Complementary in vitro studies revealed enhanced migratory and invasive capacities in CSE‐treated H1299 cells, accompanied by upregulation of key mesenchymal markers (N‐cadherin, MMP9, MMP2, vimentin, Snail, and TWIST1). E‐cadherin expression was undetectable in H1299 cells. This finding is consistent with previous reports characterizing H1299 as a mesenchymal‐like NSCLC cell line that inherently lacks E‐cadherin expression [23]. Notably, these changes were reversible upon EPZ020411 administration. However, E‐cadherin expression was undetectable in H1299 cells, consistent with the reported characteristics of this highly malignant and invasive NSCLC cell line, which inherently possesses compromised epithelial features. Interestingly, in contrast to conventional EMT‐associated downregulation, the epithelial marker ZO‐1 exhibited increased expression following CSE treatment. This seemingly paradoxical phenomenon suggests that the EMT induced by CSE may represent a non‐classical or hybrid phenotype. We speculate that this atypical response may be attributed to the complex biological effects of CSE, which contains numerous bioactive constituents capable of simultaneously activating multiple signaling pathways. The observed upregulation of ZO‐1 in our study may occur through non‐canonical signaling mechanisms. Beyond inducing EMT, CSE also provokes substantial cellular stress and injury. The increase in ZO‐1 expression may be attributed to its involvement in the stress response, representing a compensatory cellular reaction to stress. However, we acknowledge that this interpretation remains speculative in the absence of direct mechanistic evidence. Future studies will be required to fully elucidate the mechanism underlying ZO‐1 upregulation in this context. Although an increase in ZO‐1 was observed, the collective upregulation of mesenchymal markers, along with enhanced cellular migratory and invasive capacities, strongly supports the conclusion that CSE induces an EMT‐like phenotypic transition in H1299 cells. These findings establish that CSE exposure promotes EMT in NSCLC and that PRMT6 inhibition effectively counteracts this phenomenon, underscoring the pivotal role of PRMT6 in CSE‐induced EMT.

The PI3K/Akt/mTOR signaling cascade represents a central regulatory axis in oncogenesis, influencing diverse processes including tumor proliferation, survival, angiogenesis, EMT, immune modulation, and therapeutic resistance [24]. Its frequent dysregulation in cancer—through both genetic and epigenetic mechanisms—has established this pathway as a validated therapeutic target [25]. Previous studies have demonstrated that PI3K/Akt/mTOR activation enhances tumor cell invasiveness by upregulating matrix metalloproteinases and synergizing with TGF‐β signaling to promote EMT. Building on this knowledge, we propose that CSE‐induced activation of the PI3K/Akt/mTOR pathway is functionally linked to EMT induction in NSCLC. Consistent with the conjecture, our data show that CSE exposure upregulates phosphorylated levels of PI3K p85, Akt, and mTOR in both xenograft tissues and H1299 cells, while effects are suppressed by EPZ020411. This regulatory pattern aligns closely with observed increases in PRMT6 and H3R2me2a under CSE exposure, suggesting that PRMT6 upregulation may contribute to PI3K/Akt/mTOR pathway activation and subsequent EMT induction, thereby driving NSCLC progression.

In summary, our findings demonstrate that CSE upregulates PRMT6 and its catalytic mark H3R2me2a, leading to activation of the PI3K/Akt/mTOR signaling pathway, which in turn drives tumor growth, invasion, migration, and EMT in NSCLC. The consistent reversal of these oncogenic phenotypes by pharmacological inhibition of PRMT6 underscores its pivotal role in mediating the tumor‐promoting effects of cigarette smoke. Collectively, these results establish PRMT6 as a critical molecular nexus linking smoking exposure to NSCLC progression. Several limitations of this study should be acknowledged. Firstly, the use of a single NSCLC cell line (H1299) limits the generalizability of our findings; future validation in a broader panel of cell lines is warranted. Secondly, the intraperitoneal injection of CSE, while enabling precise dose control, does not fully recapitulate human inhalation exposure, and the use of CSE rather than whole cigarette smoke may not capture the full complexity of smoke components. Despite these limitations, our findings position PRMT6 as a promising therapeutic target for smoking‐associated NSCLC. However, the precise upstream mechanism through which CSE upregulates PRMT6 remains to be fully elucidated. Future investigations should focus on delineating this regulatory pathway and further evaluating the efficacy of PRMT6‐targeted therapies, which may offer novel strategies for managing this clinically aggressive form of lung cancer.

Author Contributions

Yanwen Zhang: conceptualization, methodology, data curation, investigation, validation, formal analysis, writing – original draft, software. Jie Cao: funding acquisition, writing – review and editing, project administration, resources, conceptualization. Jing Zhang: writing – review and editing, resources, supervision, data curation, conceptualization. Xiaojing Chang: software, validation, formal analysis, writing – original draft. Haiyan Zhao: conceptualization, writing – review and editing, funding acquisition, supervision, resources, project administration.

Funding

This work was supported by the National Natural Science Foundation of China, 81970084 and Tianjin Key Medical Discipline Construction Project, TJYXZDXK‐3‐004C.

Ethics Statement

The animal experiments involved in this study were approved by the Animal Ethics Committee of Tianjin Medical University.

Consent

All listed authors have actively participated in the study and have read and approved the submitted manuscript.

Conflicts of Interest

The authors declare no conflicts of interest.

Data Availability Statement

The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.