Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2026 Aug 18.
Published in final edited form as: J Nutr Biochem. 2026 Jul 25;158:110476. doi: 10.1016/j.jnutbio.2026.110476

Alternate-Day Fasting Enhances Leptin Sensitivity via JMJD3-Dependent Epigenetic Regulation of the Leptin Receptor in the Hypothalamus

Busayo Oladun 1,†, Smita Mall 1,†, Baochan Fan 1,2, Jisu Lee 1,3, Jung-Heun Ha 3, Joseph L Roberts 1, Min-Hyun Kim 1,*
PMCID: PMC13480440  NIHMSID: NIHMS2198960  PMID: 42501875

Abstract

Leptin resistance is a hallmark of obesity. It is characterized by diminished responsiveness to leptin and disrupts energy homeostasis. While multiple pathways contribute to leptin resistance, the transcriptional repression of the leptin receptor (LepRb) is a critical defect that impairs downstream signal transduction. Despite the established metabolic benefits of intermittent fasting, whether fasting directly influences leptin signaling and the underlying mechanisms remains unclear. Here, we investigated whether alternate-day fasting (ADF), a form of intermittent fasting, restores central leptin signaling by upregulating hypothalamic LepRb expression. In male C57BL/6J mice with diet-induced obesity, ADF significantly enhanced leptin-induced reductions in food intake and body weight, while increasing hypothalamic STAT3 phosphorylation, a key downstream mediator of leptin signaling. These metabolic improvements occurred independent of changes in body weight and adiposity, indicating a direct effect of fasting on leptin signaling. Mechanistically, ADF selectively reduced repressive H3K27 methylation at the LepRb promoter, leading to increased LepRb expression in hypothalamic nuclei critical for energy homeostasis. This epigenetic shift was associated with induction of the histone demethylase Jumonji Domain-Containing Protein 3 (JMJD3). To establish causality, we utilized stereotaxic injection of AAV-shRNA targeting Jmjd3 into the mediobasal hypothalamus. Knockdown of Jmjd3 abolished ADF-induced H3K27 demethylation, prevented LepRb upregulation, and attenuated the metabolic effects of ADF. Collectively, these findings identify JMJD3-dependent epigenetic regulation as a link between ADF and improved leptin signaling. Our study establishes histone modification and chromatin remodeling as a fundamental mechanism by which intermittent fasting reverses leptin resistance, providing a novel framework for leptin-based obesity therapies.

Keywords: Intermittent fasting, alternate-day fasting, leptin resistance, leptin receptor, JMJD3, epigenetic regulation

Graphical Abstract

graphic file with name nihms-2198960-f0001.webp

1. Introduction

Obesity is a major global health challenge characterized by disruptions in energy balance and hormonal signaling pathways that regulate metabolism [1]. A key feature of obesity is leptin resistance, defined as reduced responsiveness to circulating leptin despite elevated plasma levels [2]. Leptin acts primarily in the hypothalamus to suppress appetite and regulate energy expenditure through activation of leptin receptor (LepRb)-mediated signaling pathways, particularly within key hypothalamic nuclei involved in energy homeostasis, such as the arcuate nucleus (ARC) and ventromedial hypothalamus (VMH) [3]. While several mechanisms have been established to explain leptin resistance, reduced LepRb expression can directly impair leptin signal transduction and contribute to diminished hypothalamic responsiveness [4,5]. Accumulating evidence indicates that hypothalamic LepRb expression is downregulated in diet-induced obesity [6–9] and age-associated obesity [10], suggesting that enhancing LepRb expression may represent a potential strategy to restore leptin signaling and responsiveness.

Diet-induced obesity has been increasingly linked to epigenetic alterations, including DNA methylation, histone modifications, and microRNA-mediated regulation, which collectively influence metabolic gene expression. Among these, histone modifications are highly dynamic and responsive to nutritional status, regulating chromatin accessibility and transcriptional activity [11]. Prolonged consumption of obesogenic diets has been shown to alter chemical modifications on histone at metabolic and hormonal signaling genes, resulting in transcriptional repression [12]. These findings suggest that histone-based mechanisms may contribute to impaired leptin signaling through downregulation of LepRb expression.

Intermittent fasting (IF) has emerged as a promising dietary intervention for improving metabolic health and promoting weight loss in obesity [13]. Beyond its effects on body weight and adiposity, IF has been shown to modulate hormonal signaling and metabolic pathways [14]. Given that nutritional status can influence epigenetic modification through changes in metabolite availability and the activity of epigenome-modifying enzymes [15,16], it has been proposed that histone modifiers may play a critical role in mediating fasting-induced transcriptional responses. The histone demethylase Jumonji domain-containing protein 3 (JMJD3), which catalyzes the removal of repressive H3K27 methylation, has been implicated in gene regulation in response to nutritional availability [17]. Previous studies have shown that JMJD3 is induced by fasting in the liver and promotes transcriptional programs involved in lipid metabolism and autophagy [18,19].

Despite these advances, it remains unclear whether IF can directly enhance central leptin sensitivity and regulates hypothalamic metabolic gene expression through epigenetic mechanisms. In the present study, we tested whether alternate-day fasting (ADF), a form of intermittent fasting, enhances leptin sensitivity through epigenetic remodeling of the LepRb promoter in the hypothalamus. Using a high-fat diet (HFD)-induced obese mouse model, we identify histone demethylase JMJD3 as a nutrient-responsive epigenetic mediator linking fasting to improved leptin signaling through upregulation of LepRb expression in key hypothalamic regions controlling energy balance.

2. Materials and methods

2.1. Mice.

Wild-type male C57BL/6J mice (7 weeks old; The Jackson Laboratory, strain #000664) were used for all primary experiments. Upon arrival at the vivarium, mice were acclimated for 10 days under standard housing conditions (12 h light/ 12 h dark cycle) with free access to normal chow diet (Teklad Global Rodent Diet, #2018) and water before initiation of dietary interventions. To induce obesity, mice were fed a high-fat diet (HFD; 60% kcal from fat; Research Diets, D12492, New Brunswick, NJ) for 10 weeks. The composition of the HFD used in this study has been described previously [20]. Following HFD feeding, mice were randomly assigned to either an ad libitum (AL; free access to food) or an ADF group (24 h fasting followed by 24 h feeding) for up to 20 days (10 cycles). To prevent access to residual food and minimize potential stress-related confounding associated with cage transfer, both AL and ADF mice were transferred to clean cages at the same frequency throughout the intervention period. In a separate time-restricted feeding (TRF) experiment (Fig. 2C), female C57BL/6J mice (The Jackson Laboratory) were fed a high-fat/high-sucrose diet and assigned to either an AL or TRF groups starting at 10 weeks of age. Mice were maintained on the dietary intervention for 9 weeks. TRF mice had access to food for 8 hours per day during their active phase (8 AM – 4 PM) under a reversed light cycle, whereas AL mice had continuous access to food. Mice were group-housed (3 – 4 per cage) except during the exogenous leptin administration test (Fig 1D–E) and food intake measurements (Fig. 5D), when mice were single-housed. All mice were sacrificed during the morning (9 – 11 AM) as the fed state. All animal procedures were conducted in accordance with institutional and national ethical guidelines and were approved by the Institutional Animal Care and Use Committee (IACUC) at Arizona State University (Protocol # 25–2125R).

Figure 2. Alternate-day fasting increases hypothalamic leptin receptor expression.

Figure 2.

Open in a new tab

(A) Plasma leptin levels after 5 cycles of ad libitum (AL) or alternate-day fasting (ADF) (n=8 per group). (B) Hypothalamic LepRb mRNA expression following 5 cycles of AL or ADF (n=8 per group). (C) Hypothalamic LepRb mRNA expression in mice subjected to ad libitum (AL) or time-restricted feeding (TRF; 16 h fasting/8 h feeding) for 9 weeks (AL, n=7; TRF, n=8). (D) Representative immunofluorescence images of LepRb (red) in the ARC and VMH at rostral (bregma −1.50 mm) and caudal (bregma −1.70 mm) levels. Scale bar = 200 μm. (E) Quantification of LepRb-positive cells in panel D (Rostral: AL, n=6; ADF, n=3; Caudal: AL, n=6, ADF, n=7). Data are presented as mean ± SEM. * p<0.05, ** p<0.01 vs. AL.

Figure 1. Alternate-day fasting enhances leptin sensitivity in diet-induced obese mice.

Figure 1.

Open in a new tab

(A) Experimental design. Male C57BL/6J mice were fed a HFD for 10 weeks and then assigned to ad libitum (AL) or alternate-day fasting (ADF; 24 h fasting/24h feeding) (n=8 per group). (B) Body weight during AL or ADF intervention. (C) Fat mass (% body weight) measured at baseline and after 5 and 10 cycles. (D-E) After 5 cycles of ADF or AL (indicated by the dashed line in Panel B), mice were administered recombinant leptin (0.25 mg/kg BW, i.p., twice daily for 3 days) (n=5 per group). (D) Change in body weight during leptin administration. (E) Daily food intake. (F) Representative immunofluorescence images of leptin-induced STAT3 phosphorylation (pSTAT3, Tyr705; red) in the ARC and VMH (n=4 per group). Scale bar = 200 μm. Quantification of pSTAT3-positive cells per field is shown below each image. Data are presented as mean ± SEM. * p<0.05, ** p<0.01 vs. AL.

Figure 5. JMJD3 is required for alternate-day fasting-induced LepRb upregulation and metabolic responses.

Figure 5.

Open in a new tab

(A) Schematic of bilateral stereotaxic injection of AAV expressing Jmjd3-targeting shRNA (shJmjd3) or scrambled control (shCont) into the mediobasal hypothalamus, encompassing the ARC and VMH. After recovery, mice underwent 5 cycles of ad libitum (AL) or alternate-day fasting (ADF) (n=5 per group). (B) Hypothalamic Jmjd3 mRNA expression. (C) Change in body weight after 5 cycles of intervention. (D) Cumulative food intake during the intervention period. (E) Hypothalamic LepRb mRNA expression. (F) ChIP-qPCR analysis of H3K27me2 and H3K27me3 enrichment at the LepRb promoter (#1 region; − 500 bp to TSS). Data are presented as mean ± SEM. * p<0.05, ** p<0.01, *** p<0.001 vs. AL, shCont or as indicated.

2.2. Body composition.

Body composition was assessed using quantitative magnetic resonance (EchoMRI-100H, Houston, TX). Measurements were performed in conscious mice without anesthesia. Mice were briefly restrained in a cylindrical plastic holder according to the manufacturer’s instructions and placed into the instrument for analysis. Fat mass was normalized to body weight.

2.3. Exogenous leptin administration test.

To assess leptin responsiveness, mice were subjected to either ADF fasting regimen or AL for 5 cycles (10 days). Following this period, mice received intraperitoneal injections of recombinant leptin (0.25 mg/kg body weight; Cayman Chemical, Cat# 31849) twice daily at 6:00 PM and 12:00 AM for 3 consecutive days. After leptin treatment, mice underwent a 3-day washout period without leptin administration. Body weight and food intake were measured daily throughout the test period.

2.4. Plasma leptin measurement.

Plasma leptin levels were measured in overnight-fasted mice. Leptin concentrations were quantified using a commercial ELISA kit (R&D systems, Cat# KA0026) according to the manufacturer’s instructions.

2.5. Immunofluorescence.

Mice were transcardially perfused with phosphate-buffered saline (PBS), followed by 4% paraformaldehyde (PFA) in PBS to fix brain tissue. Collected brains were cryoprotected in 30% sucrose solution, embedded in optimal cutting temperature (OCT) compound, and sectioned using a cryostat. Coronal sections (25 μm thickness) corresponding to bregma −1.50 mm to −1.70 mm were collected to target hypothalamic regions. Brain sections were blocked for 2 hours with 5% goat serum in PBS supplemented with 0.4% Triton X-100, then incubated overnight at 4°C with the following primary antibodies: anti-Leptin receptor (Santa Cruz Biotechnology, Cat# SC-8391; 1:500 dilution), anti-phospho-STAT3 (Tyr705) (Cell Signaling Technology, Cat# 9131S; 1:1000 dilution), and anti-JMJD3 (Proteintech, Cat# 55354–1-AP; 1:200 dilution). After washing, sections were incubated with appropriate Alexa Flour™ 594-conjugated secondary antibodies (anti-rabbit IgG, Thermo Fisher Scientific, Cat# A-11011; or anti-mouse IgG, Cat# A-11001) at room temperature for 2 hours. Sections were mounted and imaged using a Cytation 5 Cell Imaging Multimode Reader (Biotek).

2.6. Chromatin immunoprecipitation (ChIP)-PCR:

Hypothalamic tissues were cross-linked with 1% formaldehyde for 10 minutes at room temperature. Tissues were lysed using cell and nuclear lysis buffers, and chromatin was sheared using an ultrasonicator (QSONICA Q800R) to generate DNA fragments ranging from 200 – 500 bp. Sheared chromatin was incubated overnight at 4°C with the following antibodies: anti-H3K27me3 (Cell Signaling Technology, Cat# 9733S), anti-H3K27me2 (Cell Signaling Technology, Cat# 9728S), anti-H3K4me3 (H3K4me3; Cell Signaling Technology, Cat# 9751S) and anti-H3K9me3 (Cell Signaling Technology, Cat# 13969S). Immune complexes were captured using protein A/G agarose beads (Thermo Fisher, Cat #20421)) and subsequently precipitated by centrifugation. Cross-links were reversed by incubation with an elution buffer supplemented with proteinase K at 65°C for 4 hours. DNA was purified using a Chromatin IP DNA Purification Kit (Active Motif, Cat# 58002) according to the manufacturer’s instructions. Eluted DNA was analyzed by quantitative PCR using primers targeting 4 regions of the LepR promoter: +1 to −500 (forward: 5’ CCCTCCACCAAAGCTTAGCA 3’; reverse: 5’ AGAAATGCCACTACTACCGCA 3’), −501 to −1000 (forward: 5’ TCACCAACGTAGCGATCAGG 3’; reverse: 5’ TTACACAGATGCAAGCCCCA 3’), −1001 to −1500 (forward: 5’ ACAACCGGCAACTCATTCCT 3’; reverse: 5’ GGTGACTTACGGGCATCACA 3’), −1501 to −2000 (forward: 5’ TGCTACCATTTTCTTGGGCCT 3’; reverse: 5’ TTGTACTGGGCTGCATTTGCT 3’). ChIP enrichment was quantified using the percent input method, in which Ct values from immunoprecipitated samples were normalized to dilution-adjusted input DNA.

2.7. Quantitative real-time PCR (qPCR):

Total RNA was extracted from hypothalamic tissues using TRIzol reagent (Invitrogen Cat# 15596026). First-strand cDNA was synthesized from total RNA using M-MLV reverse transcriptase (Promega Cat# PAM1705), random primers (Invitrogen Cat# 48190011), dNTPs (Promega Cat# PR-U1515), and RNase inhibitor (Applied Biosystems Cat# N8080119) according to the manufacturer’s instructions. qPCR was performed using Power SYBR Green qPCR Master Mix (Applied Biosystems Cat# 43–685-77) on a QuantStudio 3 Real-Time PCR System (Thermo Fisher). Gene expression levels were normalized to β-actin (Actb) and calculated using the ΔΔCt method. Primer sequences were as follows: LepRb (forward: 5’ CGTGGTGAAGCATCGTACTG 3’; reverse: 5’ GGGCCATGAGAAGGTAAGGT 3’), Jmjd3 (forward: 5’ CCTATTATGCTCCTGGGACA 3’; reverse: 5’ TACGGCTTCCTCACTGTCGT 3’), Ezh2 (forward: 5’ AGTATGACTGCTTCCTACATCCCTTCCAT 3’; reverse: 5’ AGATGCTGGTAACACTGTGGTCCACA 3’), Utx (forward: 5’ AGCACAGAGGAGCCGTGGAAAA 3’: reverse: 5’ GTCGTTCACCATTAGGACCTGC 3’), and Actb (forward: 5’ TATTGGCAACGAGCGGTTCC 3’; reverse: 5’ GGCATAGAGGTCTTTACGGATGT 3’).

2.8. DNA vector design and AAV packaging.

DNA vectors carrying either pAAV-CAG-Jmjd3 shRNA or pAAV-CAG-scrambled shRNA were designed and constructed by VectorBuilder (Chicago, IL). The shRNA sequence targeting Jmjd3 (5’ AGTCCCACTCACCTCTATTTA 3’) was cloned under the control of the CAG promoter. Recombinant AAVs were packaged in AAV serotype 8 and purified by the manufacturer. Viral titers were approximately 2 × 1012 genome copies/mL.

2.9. Stereotaxic microinjection and AAV transduction.

Mice were anesthetized with isoflurane (induction 3–4%, maintenance 1–2%) and secured in an Ultra-Precise Small Animal Digital Stereotaxic Instrument (RWD Science). After exposing the skull, small holes (0.5 mm diameter) were drilled using a microdrill at predetermined coordinates targeting the mediobasal hypothalamus (MBH; AP: –1.5 mm; ML: ±0.4 mm; DV: –5.8 mm). AAV-CAG-Jmjd3 shRNA or AAV-CAG-scrambled shRNA (0.3 μL per side) was bilaterally microinjected over 5 minutes using a Nanoliter Microinjection pump (RWD Science R-480) fitted with pre-pulled long-taper glass micropipettes (World Precision Instrument Cat# TIP10FLT). Following injection, the micropipette was left in place for an additional 10 minutes to allow diffusion. The incision was closed, and mice were allowed to fully recover for 10 days prior to subsequent experimental procedures.

2.10. Statistical analysis.

All data are expressed as mean ± SEM. Statistical comparisons between two groups were performed using a two-tailed Student’s t test. For comparisons involving multiple groups or variables, one-way or two-way ANOVA followed by Tukey’s post hoc test was used. For longitudinal measurements, two-way repeated-measures ANOVA (time × group) was performed, followed by post hoc testing. Analyses were conducted using GraphPad Prism 8, and a P value < 0.05 was considered statistically significant.

3. Results

3.1. Alternate-day fasting enhances leptin sensitivity in diet-induced obese mice.

To determine whether ADF improves leptin responsiveness in obesity, male C57BL/6J mice were fed a HFD for 10 weeks to establish diet-induced obesity. These mice were subsequently assigned to either AL feeding or ADF (24 h fasting followed by 24 h feeding) (Fig. 1A). During the initial 5 cycles of intervention, body weight (Fig. 1B) and fat mass (Fig. 1C) were comparable between AL and ADF groups. Over time, body weight was significantly affected by a time x diet interaction (Fig. 1B), with ADF mice exhibiting progressive weight reductions compared with AL controls. Consistent with this, ADF mice showed reduced adiposity after 5 cycles (Fig. 1C).

Changes in body weight and fat mass can influence leptin signaling and sensitivity. Thus, leptin responsiveness was assessed after 5 cycles of intervention, when body weight and adiposity remained comparable between groups, to minimize confounding effects of weight and fat loss. After 5 cycles of intervention, mice received recombinant leptin (0.25 mg/kg, i.p.) twice daily for 3 days. Mice with ADF exhibited significantly greater reductions in body weight and food intake in response to leptin compared with AL controls (Fig. 1D and 1E), indicating enhanced leptin responsiveness.

To evaluate central leptin signaling, we measured leptin-induced STAT3 phosphorylation (pSTAT3, Tyr705) in the hypothalamus, a well-established downstream mediator of LepRb activation. Immunofluorescence analysis focused on the arcuate nucleus (ARC) and ventromedial hypothalamus (VMH), two key hypothalamic regions enriched in LepRb-expressing neurons that play critical roles in energy homeostasis [21,22]. After 5 cycles of ADF, mice showed increased pSTAT3 levels in both the ARC and VMH following acute leptin administration (Fig. 1F), confirming enhanced leptin signal transduction at the molecular level. Collectively, these findings suggest that ADF enhances leptin responsiveness in diet-induced obese mice, independent of differences in body weight and adiposity.

3.2. Alternate-Day fasting increases hypothalamic leptin receptor expression.

To investigate the molecular basis by which ADF enhances leptin sensitivity, we first assessed whether circulating leptin levels were altered. After 5 cycles of ADF, plasma leptin concentrations were comparable between AL and ADF groups (Fig. 2A), indicating that improved leptin responsiveness was not attributable to differences in systemic leptin availability.

Next, we examined whether ADF regulates hypothalamic LepRb expression. ADF significantly increased hypothalamic LepRb mRNA expression in the hypothalamus compared with AL controls (Fig. 2B). To test whether this effect was specific to ADF or generalizable to other fasting paradigms, female C57BL/6J mice were fed a high-fat/high-sucrose diet and subjected to time-restricted feeding (TRF; 16 h fasting followed by 8 h feeding) for 9 weeks starting at 10 weeks of age. At the endpoint, AL-fed mice reached approximately 35% body fat, consistent with an obese phenotype. TRF similarly increased hypothalamic LepRb mRNA levels (Fig. 2C), suggesting that fasting-based nutritional interventions may broadly enhance hypothalamic LepRb expression. Consistent with transcriptional upregulation, immunofluorescence analysis revealed increased numbers of LepRb-positive cells in both the ARC and VMH in ADF mice (Fig. 2D and 2E). Together these findings indicate that intermittent fasting interventions increase hypothalamic LepRb expression.

3.3. Alternate-day fasting reduces repressive H3K27 methylation at the LepRb promoter.

Given that fasting is an well-recognized regulator of epigenetic reprogramming, and obesity-associated histone modifications at the LepRb gene have been reported [23], we tested whether ADF remodels histone modifications at the LepRb promoter. ChIP-qPCR was performed using primers spanning 4 regions of the LepRb promoter (#1: −500 bp to the predicted transcription starting site (TSS); #2: −1000 bp to −501 bp; #3: −1500 bp to −1001 bp; #4: −2000 bp to −1501 bp) (Fig. 3A). We specifically examined major histone methylation marks implicated in transcriptional regulation of metabolic genes, including H3K4, H3K9 and H3K27 methylations.

Figure 3. Alternate-day fasting reduces repressive H3K27 methylation at the LepRb promoter.

Figure 3.

Open in a new tab

(A) Schematic representation of the LepRb promoter showing 4 analyzed regions (#1 to #4) relative to the transcription start site (TSS). (B-D) ChIP-qPCR analysis of H3 histone modification enrichment at the LepRb promoter in hypothalamic tissue from ad libitum (AL) and alternate-day fasting (ADF) mice after 5 cycles (n=5 per group). ChIP enrichment is expressed as % input. (B) H3K27me3. (C) H3K27me2, (D) H3K4me3 and H3K9me3 at the #1 region. Data are presented as mean ± SEM. * p<0.05, vs. AL.

ADF significantly reduced enrichment of the repressive mark H3K27 tri-methylation (H3K27me3) at proximal promoter regions (#1 and #2) compared with AL controls (Fig. 3B). A similar trend toward reduced H3K27 di-methylation (H3K27me2) was observed (Fig. 3C). In contrast, ADF did not alter enrichment of the activating histone mark H3K4me3 or the repressive mark H3K9me3 (Fig. 3D). These findings demonstrate that ADF selectively reduces repressive H3K27 methylation at the LepRb promoter, rather than global alterations in histone modification.

3.4. Alternate-day fasting selectively induces hypothalamic JMJD3 expression.

H3K27 methylation is dynamically regulated by specific modifying enzymes, including the histone demethylase JMJD3, Ubiquitously Transcribed Tetratricopeptide Repeat on Chromosome X (UTX; histone demethylase), as well as the histone methyltransferase Enhancer of Zeste Homolog 2 (EZH2). Given the observed reduction in H3K27 methylation at the LepRb promoter, we next examined whether ADF regulates expression of these H3K27-modifying enzymes in the hypothalamus. After 5 cycles of ADF, mice displayed significantly increased Jmjd3 mRNA expression compared with AL controls, whereas expression of Ezh2 and Utx showed no significant changes (Fig. 4A), indicating selective induction of the H3K27 demethylase JMJD3 rather than global alterations in H3K27-modifying enzymes. Immunofluorescence analysis after 5 cycles of ADF confirmed increased JMJD3 expression at the protein level in the ARC and VMH of ADF mice (Fig. 4B).

Figure 4. Alternate-day fasting selectively induces hypothalamic JMJD3 expression.

Figure 4.

Open in a new tab

(A) mRNA expression of H3K27-modifying enzymes (Jmjd3, Ezh2, and Utx) in hypothalamic tissue from ad libitum (AL) and alternate-day fasting (ADF) mice after 5 cycles (n=8 per group). (B) Representative immunofluorescence images of JMJD3 (red) in the ARC and VMH mice after 5 cycles of AL and ADF (n = 4 per group). Scale bar = 200 μm. Quantification of JMJD3-positive cells per field is shown below each image. (C) Hypothalamic Jmjd3 mRNA expression under fed, fasted (24 h), and refed (24 h fasting followed by 6 h feeding) conditions (n=4 per group). Data are presented as mean ± SEM. * p<0.05 vs. AL or fed group.

To determine whether JMJD3 expression is acutely responsive to nutritional availability, we measured hypothalamic Jmjd3 mRNA levels under fed, fasted (24 h), and refed (24 h fasting followed by 6 h feeding) conditions. 24 h-fasting increased Jmjd3 mRNA expression, which returned toward fed levels following refeeding (Fig. 4C).

3.5. JMJD3 is required for alternate-day fasting-induced hypothalamic LepRb upregulation and metabolic responses.

To determine whether JMJD3 is necessary for ADF-mediated leptin sensitizing and metabolic effects, we performed bilateral stereotaxic injection of AAV vectors expressing either Jmjd3-targeting shRNA (AAV8-CAG-Jmjd3 shRNA; shJmjd3) or a scrambled control sequence (AAV8-CAG-scrambled shRNA; shCont) into the mediobasal hypothalamus (MBH), encompassing both the ARC and VMH (Fig. 5A). The shRNA cassette was driven by the ubiquitous CAG promoter and packaged in AAV serotype 8 to ensure efficient neuronal transduction. AAV-mediated knockdown significantly reduced hypothalamic Jmjd3 mRNA expression by approximately 80% compared to AL controls (Fig. 5B).

Consistent with earlier findings, ADF significantly reduced body weight and food intake in shCont-injected mice (Fig. 5C and 5D). However, these effects were markedly attenuated in shJmjd3-injected mice (Fig. 5C and 5D), indicating that JMJD3 is required for the metabolic response to ADF. Additionally, ADF-induced upregulation of LepRb was abolished by Jmjd3 knockdown (Fig. 5E). At the chromatin level, the ADF-associated reduction in H3K27me2 and me3 enrichment at the LepRb promoter (#1 region; −500 bp to TSS) was reversed in shJmjd3-injected mice (Fig. 5F), demonstrating that JMJD3 mediates ADF-induced histone remodeling of LepRb. Collectively, these findings establish JMJD3 as an epigenetic mediator through which ADF promotes H3K27 demethylation at the LepRb promoter, enhances LepRb expression, and restores hypothalamic leptin signaling.

4. Discussion

Leptin resistance is a hallmark of obesity and is characterized by diminished hypothalamic responsiveness to leptin despite chronically elevated circulating leptin levels [24]. Dietary interventions aimed at overcoming leptin resistance have been widely explored as first-line strategies for the management of obesity [25].

Multiple mechanisms have been implicated in the development of leptin resistance in obesity. These include impaired leptin transport across the blood-brain barrier [26], dysregulation of intracellular signaling regulators such as suppressor of cytokine signaling 3 (SOCS3) [27] and protein tyrosine phosphatase 1B (PTP1B) [28], endoplasmic reticulum (ER) stress [29], and defects in leptin-responsive neural circuitry, such as melanocortin 4 receptor (MC4R) [30] and tropomyosin receptor kinase B (TrkB) [31] signaling. In addition to these post-receptor mechanisms, proper hypothalamic LepRb expression is required to activate downstream anorexigenic signaling pathways, and thus reduction in LepRb expression can directly contribute to impaired leptin responsiveness [5]. Indeed, loss-of-function mutations in the LepRb gene in humans result in severe hyperphagia and early-onset obesity due to disturbed leptin signaling [32]. Diet-induced obesity reduces hypothalamic LepRb expression [6–9], suggesting that transcriptional repression of LepRb represents a mechanism linking obesogenic diet to central leptin resistance. Our previous work demonstrated that epigenetic regulation plays a critical role in controlling hypothalamic LepRb expression in obesity. We showed that the transcription factor Slug is upregulated by diet-induced obesity, and represses LepRb transcription through recruitment of epigenetic modifiers that target H3K27 [23]. LepR+-cell specific deletion of Slug in mice reduced H3K27 methylation at the LepRb promoter, resulting in increased LepRb expression and enhanced leptin sensitivity. Consistent with these previous findings, the present study further supports the concept that modulation of H3K27 methylation at the LepRb promoter is a key regulatory mechanism controlling leptin responsiveness, highlighting its potential as a therapeutic target for leptin resistance.

Nutritional status dynamically regulates chromatin remodeling and histone modifications across metabolic tissues, including liver, skeletal muscle, adipose tissue, and brain [33–35]. Fluctuations in energy availability alter intracellular abundance of metabolites and cofactors that directly influence chromatin-modifying enzymes. For example, metabolic intermediates such as acetyl-CoA [36], S-adenosylmethionine (SAM) [37], α-ketoglutarate [38], flavin adenine dinucleotide (FAD) [39] and nicotinamide adenine dinucleotide (NAD+) [40] serve as substrates or essential cofactors for histone acetyltransferases, methyltransferases, and demethylases. Consequently, changes in nutrient supply can reshape histone modification patterns and chromatin accessibility, thereby coupling cellular metabolic state to transcriptional regulation. In this context, intermittent fasting, characterized by periodic deprivation of nutrient and energy intake, limits substrate utilization and reshapes epigenetic landscapes. Among chromatin-modifying enzymes, a family of JmjC domain-containing histone demethylases has been shown to be highly sensitive to metabolic state, as their catalytic activity depends on α-ketoglutarate, a TCA cycle intermediate, and other nutrient-derived cofactors [41]. Consistent with this metabolic dependency, fasting has been shown to activate the JmjC-containing histone demethylase JMJD3 in the liver, where it epigenetically promotes mitochondrial β-oxidation and autophagy through selective demethylation of H3K27me3 at target gene promoters [18,19]. Mechanistically, JMJD3 functions in concert with nutrient-sensing regulators such as SIRT1 and PPARα, and is activated downstream of fasting-associated signaling pathways, including PKA and FGF21 signaling, to promote transcription of fasting-responsive genes [19]. Our results extend this paradigm to the hypothalamus, identifying JMJD3 as a nutrient-responsive epigenetic mediator that links intermittent fasting to selective H3K27 demethylation at its target genes. Our findings, in which fasting-induced JMJD3 upregulation in the ARC and VMH promotes LepRb transcription through promoter-specific H3K27 demethylation, suggest that nutrient deprivation directly reprograms hypothalamic hormone receptor expression via targeted chromatin remodeling.

Notably, this effect was selective for repressive H3K27 methylation and was necessary for enhanced leptin responsiveness, as JMJD3 knockdown restored H3K27 methylation and attenuated the metabolic benefits of fasting (Fig. 5C and 5D). These data support a model in which intermittent fasting functions as an epigenetic regulator of central metabolic signaling and illustrate how nutritional status can dynamically regulate histone marks to restore hormone sensitivity in obesity.

There is a general consensus that intermittent fasting alters circulating leptin concentrations in humans, which has been associated with improved leptin responsiveness [42,43]. However, direct clinical assessment of leptin sensitivity following fasting interventions remains limited, in part because most studies rely on circulating leptin levels, which are strongly influenced by changes in body weight and adiposity. As a result, it has been challenging to distinguish whether improved leptin responsiveness is a direct effect of fasting or secondary to weight loss. Although the body weight trajectory during ADF suggests physiological adaptation to repeated fasting-refeeding cycles, plasma leptin concentrations remained unchanged after 5 cycles of ADF despite enhanced leptin responsiveness (Fig 2A). Given the comparable body weight and adiposity between groups at this time point (Fig 1B and 1C), these findings suggest that fasting directly improves leptin signaling independent of weight loss. To our knowledge, the present study provides one of the few mechanistic demonstrations that intermittent fasting directly enhances leptin sensitivity at the molecular level and is among the first to implicate epigenetic mechanisms in this process. In addition to alternate-day fasting, a 16/8 TRF (16-hour fasting followed by an 8-hour feeding window) also increased LepRb mRNA expression (Fig 2C), suggesting that other intermittent fasting paradigms may similarly enhance leptin responsiveness. Consistent with this, Arruda et al. reported that 16/8 TRF improved leptin action in obese mice through UCP1-mediated postprandial thermogenesis [44], indicating that fasting may enhance leptin sensitivity through both central and peripheral mechanisms.

Several limitations of this study should be acknowledged. Although AAV-mediated knockdown of Jmjd3 in the MBH established a causal role for JMJD3 in regulating LepRb expression, this approach lacked cellular specificity. Future studies employing Cre-dependent or cell-type-specific genetic approaches will be necessary to define the contribution of LepRb-expressing neurons and other hypothalamic cell populations to JMJD3-mediated regulation of leptin signaling.

5. Conclusion

In this study, we demonstrate that ADF, a form of intermittent fasting, enhances leptin sensitivity in diet-induced obese mice by increasing hypothalamic LepRb expression within the ARC and VMH, two critical nuclei for energy homeostasis. Mechanistically, ADF selectively reduced repressive H3K27 methylation at the LepRb promoter, thereby promoting its transcription. We further identified the H3K27 demethylase JMJD3 as a nutrient-responsive epigenetic mediator that drives this histone remodeling of LepRb during fasting (summarized in the graphical abstract). These findings identify histone modification and chromatin remodeling as key regulatory mechanisms in central energy homeostasis and highlight a previously underappreciated link between nutritional interventions and hormone signaling. Given the limited efficacy of leptin-based therapies in obesity, approaches that enhance LepRb expression, through dietary strategies such as intermittent fasting, may offer complementary therapeutic potential. Future studies, including clinical trials, are needed to determine whether similar nutrient-responsive epigenetic mechanisms operate in humans.

Highlights.

  • Alternate-day fasting enhances leptin responsiveness in diet-induced obese mice.

  • Alternate-day fasting upregulates hypothalamic leptin receptor expression.

  • Alternate-day fasting reduces repressive H3K27 methylation at the LepRb promoter.

  • JMJD3 mediates fasting-induced epigenetic remodeling of LepRb.

Acknowledgements

We thank Melissa Buder for her contributions to experimental work.

Funding

This work was supported by the R01DK139038 from the National Institute for Diabetes and Digestive and Kidney Diseases (M-H.K).

Footnotes

Declaration of competing interest: The authors report no conflict of interest to declare regarding the execution of this study nor manuscript for publication.

Declaration of interests

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

CRediT authorship contribution statement

Busayo Oladun: Investigation, Formal analysis, Data curation, Writing – original draft, Writing -review & editing, Conceptualization. Smita Mall: Investigation, Formal analysis, Data curation, Writing – original draft, Writing -review & editing, Conceptualization. Baochan fan: Investigation, Data curation, Writing -review & editing. Jisu Lee: Investigation, Data curation, Writing -review & editing. Jung-Heun Ha: Investigation, Data curation, Writing -review & editing. Joseph L. Roberts: Investigation, Data curation, Writing -review & editing. Min-Hyun Kim: Conceptualization, Supervision, Project administration, Funding acquisition, Writing – original draft, Writing -review & editing.

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Availability of data and materials

The data used and analyzed in this study are available from the corresponding author upon request.

References

  • [1].Masood B, Moorthy M. Causes of obesity: a review. Clinical Medicine 2023;23:284–91. 10.7861/clinmed.2023-0168. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [2].Enriori PJ, Evans AE, Sinnayah P, Cowley MA. Leptin Resistance and Obesity. Obesity 2006;14:254S–258S. 10.1038/oby.2006.319. [DOI] [PubMed] [Google Scholar]
  • [3].Pal R, Sahu A. Leptin Signaling in the Hypothalamus during Chronic Central Leptin Infusion. Endocrinology 2003;144:3789–98. 10.1210/en.2002-0148. [DOI] [PubMed] [Google Scholar]
  • [4].Liu J, Lai F, Hou Y, Zheng R. Leptin signaling and leptin resistance. Medical Review 2022;2:363–84. 10.1515/mr-2022-0017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [5].Martin RL, Perez E, He Y-J, Dawson R, Millard WJ. Leptin resistance is associated with hypothalamic leptin receptor mRNA and protein downregulation. Metabolism - Clinical and Experimental 2000;49:1479–84. 10.1053/meta.2000.17695. [DOI] [PubMed] [Google Scholar]
  • [6].Wilsey J, Scarpace PJ. Caloric restriction reverses the deficits in leptin receptor protein and leptin signaling capacity associated with diet-induced obesity: role of leptin in the regulation of hypothalamic long-form leptin receptor expression. J Endocrinol 2004;181:297–306. 10.1677/joe.0.1810297. [DOI] [PubMed] [Google Scholar]
  • [7].Liu Z-J, Bian J, Liu J, Endoh A. Obesity Reduced the Gene Expressions of Leptin Receptors in Hypothalamus and Liver. Horm Metab Res 2007;39:489–94. 10.1055/s-2007-981680. [DOI] [PubMed] [Google Scholar]
  • [8].Zhai L, Zhao J, Zhu Y, Liu Q, Niu W, Liu C, et al. Downregulation of leptin receptor and kisspeptin/GPR54 in the murine hypothalamus contributes to male hypogonadism caused by high-fat diet-induced obesity. Endocrine 2018;62:195–206. 10.1007/s12020-018-1646-9. [DOI] [PubMed] [Google Scholar]
  • [9].Townsend KL, Lorenzi MM, Widmaier EP. High-fat diet-induced changes in body mass and hypothalamic gene expression in wild-type and leptin-deficient mice. Endocrine 2008;33:176–88. 10.1007/s12020-008-9070-1. [DOI] [PubMed] [Google Scholar]
  • [10].C F-G, T F-AC, C A, N G, A A, et al. Decreased leptin uptake in hypothalamic nuclei with ageing in Wistar rats. The Journal of Endocrinology 2001;171. 10.1677/joe.0.1710023. [DOI] [PubMed] [Google Scholar]
  • [11].Laugesen A, Højfeldt JW, Helin K. Molecular Mechanisms Directing PRC2 Recruitment and H3K27 Methylation. Molecular Cell 2019;74:8–18. 10.1016/j.molcel.2019.03.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [12].Ling C, Rönn T. Epigenetics in Human Obesity and Type 2 Diabetes. Cell Metabolism 2019;29:1028–44. 10.1016/j.cmet.2019.03.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [13].Patterson RE, Laughlin GA, LaCroix AZ, Hartman SJ, Natarajan L, Senger CM, et al. Intermittent Fasting and Human Metabolic Health. Journal of the Academy of Nutrition and Dietetics 2015;115:1203–12. 10.1016/j.jand.2015.02.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [14].Shkorfu W, Fadel A, Hamsho M, Ranneh Y, Shahbaz HM. Intermittent Fasting and Hormonal Regulation: Pathways to Improved Metabolic Health. Food Science & Nutrition 2025;13:e70586. 10.1002/fsn3.70586. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [15]. Sharma B, Negi R, Chaudhury S, Singh P. Epigenetic modifications and aging: intermittent fasting as a catalyst for positive epigenetic changes. The Potential of Intermittent Fasting in Age-related Diseases and Precision Antiaging Therapeutics, Academic Press; 2026, p. 163–84. 10.1016/B978-0-443-30060-8.00011-X. [DOI] [Google Scholar]
  • [16].Parnas H, Bartman J, Rosenberg T, Yosofov R, Gabsi N, Marco A. Intermittent Fasting Enhances Genome Integrity and Cytoprotective Pathways via (BHB) β-Hydroxybutyrate Signaling and Chromatin Remodeling. FASEB J 2026;40:e71681. 10.1096/fj.202503534R. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [17].Burchfield JS, Li Q, Wang HY, Wang R-F. JMJD3 as an epigenetic regulator in development and disease. The International Journal of Biochemistry & Cell Biology 2015;67:148–57. 10.1016/j.biocel.2015.07.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [18].Byun S, Seok S, Kim Y-C, Zhang Y, Yau P, Iwamori N, et al. Fasting-induced FGF21 signaling activates hepatic autophagy and lipid degradation via JMJD3 histone demethylase. Nat Commun 2020;11:807. 10.1038/s41467-020-14384-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [19].Seok S, Kim Y-C, Byun S, Choi S, Xiao Z, Iwamori N, et al. Fasting-induced JMJD3 histone demethylase epigenetically activates mitochondrial fatty acid β-oxidation. J Clin Invest 2018;128:3144–59. 10.1172/JCI97736. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [20].Fang H, Aoki K, Tokinoya K, Yonamine M, Sugasawa T, Kawakami Y, et al. Effects of High-Fat Diet on the Gut Microbiota of Renalase Gene Knockout Mice. Obesities 2022;2:303–16. 10.3390/obesities2030025. [DOI] [Google Scholar]
  • [21].Satoh N, Ogawa Y, Katsuura G, Hayase M, Tsuji T, Imagawa K, et al. The arcuate nucleus as a primary site of satiety effect of leptin in rats. Neuroscience Letters 1997;224:149–52. 10.1016/S0304-3940(97)00163-8. [DOI] [PubMed] [Google Scholar]
  • [22].Bingham NC, Anderson KK, Reuter AL, Stallings NR, Parker KL. Selective Loss of Leptin Receptors in the Ventromedial Hypothalamic Nucleus Results in Increased Adiposity and a Metabolic Syndrome. Endocrinology 2008;149:2138–48. 10.1210/en.2007-1200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [23].Kim M-H, Li Y, Zheng Q, Jiang L, Myers MG, Wu W-S, et al. LepRb+ cell–specific deletion of Slug mitigates obesity and nonalcoholic fatty liver disease in mice. J Clin Invest 2023;133. 10.1172/JCI156722. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [24].Myers MG, Leibel RL, Seeley RJ, Schwartz MW. Obesity and leptin resistance: distinguishing cause from effect. Trends in Endocrinology & Metabolism 2010;21:643–51. 10.1016/j.tem.2010.08.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [25].Mendoza-Herrera K, Florio AA, Moore M, Marrero A, Tamez M, Bhupathiraju SN, et al. The Leptin System and Diet: A Mini Review of the Current Evidence. Front Endocrinol 2021;12. 10.3389/fendo.2021.749050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [26].Kastin AJ, Pan W, Maness LM, Koletsky RJ, Ernsberger P. Decreased transport of leptin across the blood–brain barrier in rats lacking the short form of the leptin receptor☆. Peptides 1999;20:1449–53. 10.1016/S0196-9781(99)00156-4. [DOI] [PubMed] [Google Scholar]
  • [27].Bjørbæk C, Elmquist JK, Frantz JD, Shoelson SE, Flier JS. Identification of SOCS-3 as a Potential Mediator of Central Leptin Resistance. Molecular Cell 1998;1:619–25. 10.1016/S1097-2765(00)80062-3. [DOI] [PubMed] [Google Scholar]
  • [28].Morrison CD, White CL, Wang Z, Lee S-Y, Lawrence DS, Cefalu WT, et al. Increased Hypothalamic Protein Tyrosine Phosphatase 1B Contributes to Leptin Resistance with Age. Endocrinology 2007;148:433–40. 10.1210/en.2006-0672. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [29].Hosoi T, Sasaki M, Miyahara T, Hashimoto C, Matsuo S, Yoshii M, et al. Endoplasmic Reticulum Stress Induces Leptin Resistance. Molecular Pharmacology 2008;74:1610–9. 10.1124/mol.108.050070. [DOI] [PubMed] [Google Scholar]
  • [30].Farooqi IS, Keogh JM, Yeo GSH, Lank EJ, Cheetham T, O’Rahilly S. Clinical Spectrum of Obesity and Mutations in the Melanocortin 4 Receptor Gene. New England Journal of Medicine 2003;348:1085–95. 10.1056/NEJMoa022050. [DOI] [PubMed] [Google Scholar]
  • [31].Yeo GSH, Connie Hung C-C, Rochford J, Keogh J, Gray J, Sivaramakrishnan S, et al. A de novo mutation affecting human TrkB associated with severe obesity and developmental delay. Nat Neurosci 2004;7:1187–9. 10.1038/nn1336. [DOI] [PubMed] [Google Scholar]
  • [32].Nunziata A, Funcke J-B, Borck G, von Schnurbein J, Brandt S, Lennerz B, et al. Functional and Phenotypic Characteristics of Human Leptin Receptor Mutations. J Endocr Soc 2018;3:27–41. 10.1210/js.2018-00123. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [33].Wang J, Wu Z, Li D, Li N, Dindot SV, Satterfield MC, et al. Nutrition, Epigenetics, and Metabolic Syndrome. Antioxidants & Redox Signaling 2012;17:282–301. 10.1089/ars.2011.4381. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [34].Gallou-Kabani C, Vigé A, Gross M-S, Junien C. Nutri-epigenomics: lifelong remodelling of our epigenomes by nutritional and metabolic factors and beyond. Clin Chem Lab Med 2007;45:321–7. 10.1515/CCLM.2007.081. [DOI] [PubMed] [Google Scholar]
  • [35].Bekdash RA. Epigenetics, Nutrition, and the Brain: Improving Mental Health through Diet. International Journal of Molecular Sciences 2024;25:4036. 10.3390/ijms25074036. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [36].Cai L, Sutter BM, Li B, Tu BP. Acetyl-CoA Induces Cell Growth and Proliferation by Promoting the Acetylation of Histones at Growth Genes. Molecular Cell 2011;42:426–37. 10.1016/j.molcel.2011.05.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [37].Li S, Swanson SK, Gogol M, Florens L, Washburn MP, Workman JL, et al. Serine and SAM Responsive Complex SESAME Regulates Histone Modification Crosstalk by Sensing Cellular Metabolism. Molecular Cell 2015;60:408–21. 10.1016/j.molcel.2015.09.024. [DOI] [PubMed] [Google Scholar]
  • [38].Sekita Y, Sugiura Y, Matsumoto A, Kawasaki Y, Akasaka K, Konno R, et al. AKT Signaling Promotes Epigenetic Reprogramming via Upregulation of TET and its Cofactor, Alpha-Ketoglutarate, During iPSC Generation 2020. 10.2139/ssrn.3754544. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [39].Song Y, Wang S, Yu B. Structural and Functional Landscape of FAD-Dependent Histone Lysine Demethylases for New Drug Discovery. J Med Chem 2023;66:71–94. 10.1021/acs.jmedchem.2c01324. [DOI] [PubMed] [Google Scholar]
  • [40].Imai S, Armstrong CM, Kaeberlein M, Guarente L. Transcriptional silencing and longevity protein Sir2 is an NAD-dependent histone deacetylase. Nature 2000;403:795–800. 10.1038/35001622. [DOI] [PubMed] [Google Scholar]
  • [41].Tsukada Y, Fang J, Erdjument-Bromage H, Warren ME, Borchers CH, Tempst P, et al. Histone demethylation by a family of JmjC domain-containing proteins. Nature 2006;439:811–6. 10.1038/nature04433. [DOI] [PubMed] [Google Scholar]
  • [42].Kazeminasab F, Behzadnejad N, Cerqueira HS, Santos HO, Rosenkranz SK. Effects of intermittent fasting combined with exercise on serum leptin and adiponectin in adults with or without obesity: a systematic review and meta-analysis of randomized clinical trials. Front Nutr 2024;11. 10.3389/fnut.2024.1362731. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [43].Gaeini Z, Mirmiran P, Bahadoran Z. Effects of Ramadan intermittent fasting on leptin and adiponectin: a systematic review and meta-analysis. Hormones 2021;20:237–46. 10.1007/s42000-021-00285-3. [DOI] [PubMed] [Google Scholar]
  • [44].Arruda AC, Santos RB, Freitas-Lima LC, Budu A, Perilhão MS, Wasinski F, et al. 16/8 intermittent fasting in mice protects from diet-induced obesity by increasing leptin sensitivity and postprandial thermogenesis. Acta Physiologica 2025;241:e70036. 10.1111/apha.70036. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data used and analyzed in this study are available from the corresponding author upon request.

RESOURCES