Skip to main content
Wiley Open Access Collection logoLink to Wiley Open Access Collection
. 2018 Apr 16;233(9):7435–7446. doi: 10.1002/jcp.26589

Long noncoding RNA H19 mediates LCoR to impact the osteogenic and adipogenic differentiation of mBMSCs in mice through sponging miR‐188

Yijun Wang 1, Wentao Liu 2, Yadong Liu 3, Jianli Cui 1, Zhiwei Zhao 1, Hui Cao 1, Zhuo Fu 1, Bin Liu 1,
PMCID: PMC13482115  PMID: 29663375

Abstract

The research aimed to examine the expression of lncRNA H19, miR‐188, and LCoR in mouse bone marrow stromal stem cells (mBMSCs), and to investigate the regulatory mechanism of lncRNA H19/miR‐188/LCoR in osteogenic and adipogenic differentiation of mBMSCs. The expression of miR‐188 in mBMSCs and osteogenesis induced mBMSCs was detected by stem‐loop RT‐PCR, while the expression of H19 and LCoR in mBMSCs and adipogenesis induced mBMSCs was examined by qRT‐PCR. Luciferase reporter assay verified the targeted relationship between miR‐188 and H19 or LCoR. Cell proliferation ability was determined by MTT assay, while cell surface markers of mBMSCs were analyzed via flow cytometry. Alkaline phosphatase staining and Alizarin red staining was utilized to detect the osteogenic differentiation capability of mBMSCs, whereas Oil red O staining was applied to examine the ability of adipogenic differentiation of mBMSCs. The expression of miR‐188 was lower in osteogenesis induced mBMSCs compared with normal mBMSCs, while H19 and LCoR were downregulated in adipogenic induced mBMSCs. Si‐H19 could significantly increase the mRNA level of miR‐188. Meanwhile, miR‐188 directly regulated LCoR in mBMSCs. Overexpression of miR‐188 and knockdown of LCoR suppressed osteogenic differentiation and induced adipogenic differentiation in mBMSCs. Long noncoding RNA H19 mediates LCoR to regulate the balance between osteogenic and adipogenic differentiation of mBMSCs in mice through sponging miR‐188.

Keywords: adipogenic, LCoR, long noncoding RNAH19, mBMSCs, MiR‐188, Osteogenic


(i) The research aimed to examine the expression of lncRNA H19, miR‐188, and LCoR in mouse bone marrow stromal stem cells (mBMSCs), and to investigate the regulatory mechanism of lncRNA H19/miR‐188/LCoR in osteogenic and adipogenic differentiation of mBMSCs. (ii) Long noncoding RNA H19 mediates LCoR to regulate the balance between osteogenic and adipogenic differentiation of mBMSCs in mice through sponging miR‐188.

graphic file with name JCP-233-7435-g002.jpg


Abbreviations

ANOVA

analysis of variance

BMSCs

bone marrow stem cells

COPD

chronic obstructive pulmonary disease

CtBP

C‐terminal‐binding protein

FBS

fetal bovine serum

HDAC

histone deacetylase

IBMX

isbutylmethylxanthine

LCoR

ligand‐dependent corepressor

mBMSCs

mouse bone marrow stromal stem cells

miRNA

MicroRNAs

MSC

mesenchymal stem cell

1. INTRODUCTION

Mesenchymal stem cell (MSC) is a multipotent stromal cell with many important functions in tissue regeneration, immune privileged, and so on, which also represent a promising cell‐based therapy for a number of degenerative conditions (Li, Huang, et al., 2015). Bone marrow stem cells (BMSCs), also known as bone marrow‐derived mesenchymal stem cells, are considered the gold standard for use in tissue regeneration among MSCs (Yan et al., 2013). BMSCs play an important role in the pathophysiology of osteoporosis according to its differentiation abilities (An, Wu, Ma, Zhou, & Liu, 2015). Adipocyte/osteoblast balance and cell differentiation capacities were determined by the combination of adipogenesis and osteogenesis in primary culture of normal or heterogeneous BMSCs (Ghali et al., 2015). Age‐related osteoporosis is associated with the ability of BMSCs to differentiate into osteoblasts instead of adipocytes. BMSC of aged skeletal may preferentially commit adipogenic differentiation rather than osteogenic differentiation which lead to excessive adipogenesis in the bone marrow (Hay et al., 2014). Therefore, it is of significant importance to clarify the role of BMSCs in mediating the balance of bone forming and adipogenic differentiating for the development of new therapies for abnormal osteogenesis and adipogenesis.

Long non‐coding RNA (LncRNA), a class of non‐coding RNA with more than 200 nucleotides, is involved in the occurrence of various kinds of diseases (Zhang et al., 2017). Meanwhile, a mass of lncRNAs such as H19 and MEG3 had been reported to regulate the adipogenesis and osteogenesis in BMSCs (Wang et al., 2017; Zhuang et al., 2015). A considerable amount of evidence has identified that H19 stimulated osteogenic differentiation of mBMSC and suppressed adipogenic differentiation of mBMSCs (Huang et al., 2016; Wu et al., 2018). However, the regulatory mechanism of lncNRA H19/miR‐188 axis in mBMSCs remains unknown.

MicroRNAs (miRNA), as a kind of small non‐coding RNAs about 18–24 nucleotides, can negatively regulate gene expression at a post‐transcriptional level by repression or activation of translation or transcription (Wei et al., 2014). Several miRNAs have been demonstrated to be capable of targeting adipogenesis associated genes to be involved in the process of adipogenesis and osteogenesis (Gu et al., 2016; Guo, Chen, Guo, Jiang, & Lin, 2016). The studies of Belaya et al. (2017) reported that patients with higher expression of miR‐188‐3p had a higher risk of osteoporosis. MiR‐188, which is highly expressed in BMSCs of aged mice and human subjects, can regulate BMSCs osteogenic and adipogenic differentiation during aging. (Li, Cheng, et al., 2015).

Ligand‐dependent corepressor (LCoR) is a transcriptional corepressor widely expressed in fetal and adult tissues, which can regulate relevant nuclear receptors (Fernandes et al., 2003). Ligand‐dependent corepressor (LCoR) was previously reported to function as a transcriptional corepressor in vitro (Song et al., 2012). Prior researches have revealed that LCoR acted as a negative regulator of hepatic lipogenesis (Palijan et al., 2009). LCoR expression was also found to be repressed in the early stage of adipogenesis in vitro (Cao et al., 2017). However, the functions of LCoR in regulating the adipogenesis and osteogenesis in BMSCs and the underlying mechanism are still needed to be further elucidated.

Herein, we detected the expression of miR‐188 in osteogenesis induced mBMSCs and the expression of H19 and LCoR in adipogenesis induced mBMSCs. Furthermore, we investigated the effects of knockdown of H19 on the expressions of miR‐188 and LCoR as well as the influence of their interaction on the osteogenic and adipogenic differentiation of mBMSCs. Our study proposed that H19/miR‐188/LCoR axis could be a new target for regulating adipocyte/osteoblast balance in mBMSCs.

2. MATERIAL AND METHODS

2.1. Animal experiments

About 5 or 6‐weeks‐old BALB/c mice (18–25 g) were purchased from Shanghai Experimental Animal Centre (Shanghai, China). Seven selected mice were sacrificed and put into 75% alcohol for 3–5 min, and then separation of femur, tibia were done in sterile environment. The bone marrow cavity was exposed by operative instruments. The cell suspension from bone marrow cavity were seeded in high glycose DMEM medium (Invitrogen, Camarillo, CA) containing 10% fetal bovine serum (FBS) (Invitrogen, New York, NY), penicillin (100 UI/ml) and streptomycin (100 mg/ml) at 37 °C in 5% CO2. All the operating procedures in the experiments were approved by The First Hospital of Jilin University.

2.2. Microarray analysis

The mRNA and lncRNA expression profile of mBMSCs was achieved through GEO database (Accession Series No. GSE107789) via GPL14550 platform, while the miRNA expression profile of mBMSCs was obtained from GPL17912 (GSE57127). The differentially expressed RNAs were screened by R programming language using Bayesian test and fold change (correction p < 0.05, |log2(fold change)|>1).

2.3. Cell culture and transfection

Primary mBMSCs cells were digested by 0.25% trypsin and 0.02% EDTA (Invitrogen, New York, NY) when reaching 90% cell confluence, and then transferred of culture at the rate of 1:2 and marked as P1. In terms of osteogenic differentiation, 50,000 P3‐P5 mBMSCs were seeded in 6‐well plates and changed to osteogenic medium after 2 or 3 days. The osteogenic medium contains α‐MEM with low glucose plus 10% FBS, 100 nmo1/L dexamethasone (Sigma, St.Louis, MO), 2 mmo1/L sodium glycerophosphate and 50 g/ml ascorbic acid (Sigma).

For adipogenic differentiation, 50,000 P3‐P5 mBMSCs were seeded in 6‐well plates and changed to adipogenic medium after 2 or 3 days. The adipogenic medium contains α‐MEM with low glucose plus 10% FBS, 0.5 mmo1/L isbutylmethylxanthine (IBMX), 10 µg/ml insulin, and 1 µmol/L dexamethasone (Sigma).

MiR‐188‐5p mimics (mirVana®, #4464066) or miR‐188‐5p inhibitor (mirVana®, #4464084), pCMV‐LCoR (Silencer®, #AM16708), si‐H19 (Silencer®, #4390771) were transfected into mBMSCs using Lipofectamine 2000 (Invitrogen, New York, NY).

2.4. Stem‐loop RT‐PCR and qRT‐PCR

Total RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, CA). A highly efficient and specific primers of miR‐188 (5′‐GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGAT ACGAaaacgt‐3′) and miR‐188 (5′‐CUCCCACAUGCAGGGUUU GCA‐3′) were constructed and examined by stem‐loop RT‐PCR. U6 was used as an internal control for miRNA detection. Total RNA was reversely transcribed using a reverse transcription kit (Invitrogen, New York, NY). The mRNA level of LCoR and H19 was detected by qRT‐PCR using Fluorescence Quantification PCR Kit (Invitrogen, New York, NY), with GAPDH as internal control. The expression of osteogenic and adipogenic differentiation related genes was detected using β‐actin as internal control. The above experiments were carried out at least five times. The sequences of primer were shown in Table 1.

Table 1.

Sequences of primer

Primer Sequence (5′‐3′)
H19‐F 5′‐AGACCTGGGCAGTGAAGGTA‐3′
H19‐R 5′‐TATGTGCCATTCTGCTGCGA‐3′
miR‐188‐F 5′‐ATGTACACAAGCACACCTTCTCATT‐3′
miR‐188‐R 5′‐TCAGAAAGCTCACCCTCCACCAT‐3′
U6‐F 5′‐CTCGCTTCGGCAGCACACA‐3′
U6‐R 5′‐AACGCTTCACGAATTTGCGT‐3′
LCoR‐F 5′‐AAGTCCATGTGCTGGCAGCACT‐3′
LCoR‐R 5′‐ATCACCACTCCGAAGTCCGTCT‐3′
GAPDH‐F 5′‐GAAGGTGAAGGTCGGAGTC‐3′
GAPDH‐R 5′‐GAAGGTGAAGGTCGGAGTC‐3′
BMP‐2‐F 5′‐GATCGATGTGGACGTTTCCAA‐3′
BMP‐2‐R 5′‐GTTGGCAGCCTCAGAGAGGT‐3′
OCN‐F 5′‐GCTTCCTGGAACAGCAAAAC‐3′
OCN‐R 5′‐ATCTTGGAGCTTCTGCCTCA‐3′
OSX‐F 5′‐GACAGAAACGAGACTGGGTCA‐3′
OSX‐R 5′‐CCGGTGATGCTGTAGAAAACC‐3′
PPARγ‐F 5′‐TGTCGGTTTCAGAAGTGCCTTG‐3′
PPARγ‐R 5′‐TTCAGCTGGTCGATATCACTGGAG‐3′
Leptin‐F 5′‐ACCTGTCTACTCATGCCAGCACTC‐3′
Leptin‐R 5′‐CTGGTCCTGCAGCCTGTTTG‐3′
Adiponectin‐F 5′‐GTCAGTGGATCTGACGACACCAA‐3′
Adiponectin‐R 5′‐ATGCCTGCCATCCAACCTG‐3′
β‐Actin‐F 5′‐GACCTCTATGCCAACACAGTGC‐3′
β‐Actin‐R 5′‐GTACTCCTGCTTGCTGATCCAC‐3′

F, forward; R, reverse.

2.5. Western blot

The mBMSCs were washed with cold PBS for three to four times, then added RIPA buffer (Invitrogen, #V89901) containing protease inhibitor and placed in ice for 5 min, followed by centrifugation of cell lysate at 4 °C/10,000 rpm for 10 min. Protein concentration was detected by BCA kit (Invitrogen, #23227). Protein extracts were mixed with 5 × SDS‐PAGE loading buffer and boiled for 5 min, and then subjected to separation by 6% SDS‐PAGE electrophoresis. The membranes were respectively incubated with the primary antibody at 4 °C overnight, and second antibody for 1 hr. Having been washed with TBST for three times, ECL (Abcam, Cambridge, MA, #ab65623) was added and exposed for 5 min, detected and analyzed by Quantity One software. The primary and secondary antibodies used in this study are listed in Table 2.

Table 2.

Primary and secondary antibodies used in this study

Protein Antibodys Manufactures
BMP‐2 Rabbit polyclonal Anti‐BMP2 antibody (1:500) Abcam, # ab14933
Goat Anti‐Rabbit IgG H&L (HRP) (1:2,000) Abcam, # ab205718
OCN Rabbit polyclonal Anti‐Osteocalcin antibody (1:500) Abcam, # ab93876
Goat Anti‐Rabbit IgG H&L (HRP) (1:2,000) Abcam, # ab205718
OSX Rabbit polyclonal to Sp7/Osterix‐ChIP Grade (1:500) Goat Anti‐Rabbit IgG H&L (HRP) (1:2,000) Abcam, # ab22552 Abcam, # ab205718
PPARγ Rabbit polyclonal to PPAR gamma‐ChIP Grade (1:500) Abcam, # ab45036
Goat Anti‐Rabbit IgG H&L (HRP) (1:2,000) Abcam, # ab205718
Leptin Rabbit polyclonal Anti‐Leptin antibody (1:500) Abcam, # ab16227
Goat Anti‐Rabbit IgG H&L (HRP) (1:2,000) Abcam, # ab205718
Adiponectin Rabbit polyclonal Anti‐Adiponectin antibody (1:500) Abcam, #ab62551
Goat Anti‐Rabbit IgG H&L (HRP) (1:2,000) Abcam, # ab205718
LCoR Rabbit polyclonal Anti‐LCoR antibody (1:500) Abcam, #ab48339
Goat Anti‐Rabbit IgG H&L (HRP) (1:2,000) Abcam, # ab205718
GAPDH Rabbit polyclonal Anti‐GAPDH antibody (1:2,500) Abcam, #ab9485
Goat Anti‐Rabbit IgG H&L (HRP) (1:2,000) Abcam, # ab205718

2.6. Luciferase reporter assay

CHO cell line was purchased from Chinese Academy of Sciences cell bank. To identify the target of miR‐188, putative target genes were searched using Targetscan software (www.targetscan.org/). Wild‐type or mutated LCoR and H19 3'UTR including the predicted miR‐188–binding site, were PCR‐amplifed and inserted into the pMIR‐reporter plasmid, the 3'UTR sequence of wildtype and mutated LCoR as well as H19 were showed in Table 3. The luciferase reporter plasmids of wild‐type or mutated LCoR and H19 were transfected into CHO cells respectively, miR‐188 mimics were also transfected. Luminescence was measured 48 hr after transfection using a dual‐luciferase detection kit (Promega, Madison, WI), according to the manufacturer's instructions. Measurements of luminescence were performed on a GloMax 20/20 Luminometer (Promega Corporation).

Table 3.

Primer sequences

Primer Sequences (5′‐3′)
LCoRWT forward 5′‐CCCAAG CTT GGG ACG TAG T TTC TAA AAG GGG‐3′
LCoRWT upstream 5′‐GGGA CTA GTC CGA ATA CTG TAG AGT GCC AAT‐3′
LCoRMUT forward 5′‐CCCAAG CTT GGG TGC ATCA TTC TAA AAG GGG‐3′
LCoRMUT upstream 5′‐GGGA CTA GTC CGT TAT GAC TAG AGT GCC AAT‐3′
H19 WT forward 5′‐CCCAAG CTT GGG ACG TAG T TGC CAG AGC CTC‐3′
H19 WT upstream 5′‐GGGA CTA GTC CGA ATA CTG GCC TCA TGG GAA‐3′
H19 MUT forward 5′‐CCCAAG CTT GGG TGC ATCA TGC CAG AGC CTC‐3′
H19 MUT upstream 5′‐GGGA CTA GTC CGT TAT GAC GCC TCA TGG GAA‐3′

2.7. MTT cell proliferation assay

A tatal of 20 µl MTT (Invitrogen, #V13154) was added in mBMSCs each well and incubated at 37 °C, 5% CO2. After 4 hr, the liquid was withdrawn, and 100 µl DMSO was added per well, shocked at a low speed at 37 °C for 10 min, the light absorbance was detected using a Microplate reader.

2.8. Flow cytometry for detecting cell surface marker

The P3 generation of mBMSCs were harvested and then centrifuged at 800 r/min for 5 min. The deposit was resuspended with PBS containing 3% FBS. Each centrifuge tube was incubated with 2 µl of mouse monoclonal antibody CD14, CD29, CD34, CD44, CD45, CD105 (Abcam) at 4 °C for 2 hr. After cells were washed with PBS containing 3% FBS for three times, the expression of each CD markers on the cells was calculated based on percentage and mean fluorescence intensity (MFI).

2.9. Alkaline phosphatase staining

Alkaline Phosphatase Assay Kit (Beyotime, Shanghai, China) was used to detect alkaline phosphatase activity. Cells were washed twice with PBS, then 50 µl 0.2% Triton X–100 were added and maintained at 4 °C overnight. Afterwards, 50 µl ALP buffer and 50 µl matrix solution were supplemented, incubated at 37 °C for another 15 min, and then 100 µl ALP color solution was added. Then OD value was detected at 520 nm wavelength using Spectrophotometer.

2.10. Alizarin red staining

Cells were fixed with 4% paraformaldehyde for 15–20 min, then stained with 1% alizarin red (Sigma) to detect deposited mineral, which was photographed by phase contrast microscopy. Alizarin red in 6‐well plate was isolated with 500 µl 100 mmol/L cetylpyridinium chloride, and OD values were detected by spectrophotometer.

2.11. Oil red O staining

At the end of adipogenic induction, the cells were washed with PBS and frozen at −20 °C for 20 min. Differentiated adipocytes were stained with oil red O (Sigma–Aldrich, St.Louis, MO). Following the addition of 1 ml PBS, the color reaction was observed under a microscopy.

2.12. Statistical analysis

Statistical analysis was achieved by the software GraphPad Prism version 6.0. Measurement data were showed as mean ± standard deviation. Student's t test was used for comparison between the two groups, while one‐way analysis of variance (Lopez et al., 2017) was applied for multi‐group comparison. Each experiment was repeated at least three times. A two‐tailed p < 0.05 was considered to be statistically significant.

3. RESULTS

3.1. Cell culture of mBMSCs and identification of mBMSCs

The cell viability of P3, P5, and P7 mBMSCs were detected by MTT assays (Figure 1a). The pictures of alkaline phosphatase staining showed that positive alkaline phosphatase could be detected in mBMSCs after osteogenic inducing, while the visible could hardly detected in normal mBMSCs (p < 0.01, Figure 1b). Mineralized nodules could be seen after Alizarin red staining, normal mBMSCs could not be stained by Alizarin red (p < 0.01, Figure 1c). Red lipid droplet were showed in cytoplasm with oil red O staining after 14 days of adipogenic inducing, while normal mBMSCs could not see the red lipid droplet (p < 0.01, Figure 1d). Surface antigen of mBMSCs were detected by flow cytometry, the results showed a high expression of CD29, CD44, CD105, and low expression of CD14, CD34, CD45 in mBMSCs (Figure 1e). Above all, we achieved the accepted mBMSCs.

Figure 1.

Figure 1

Cell culture of mBMSCs and identification of mBMSCs. (a) Cell viability was detected by MTT assay. (b) Alkaline phosphatase staining assay. (c) Alizarin red staining. (d) Oil red O staining. (e) Flow cytometry detected surface antigen of mBMSCs. **p < 0.01 compared with normal group

3.2. Microarray analysis found the differentially expressed miRNAs, lncRNAs, and mRNAs

According to the screening conditions (p < 0.05, |log2(fold change)|>1), the differentially expressed miRNAs, lncRNAs, and mRNAs were screened out. There were 133 up‐expressed and 175 down‐expressed miRNAs in osteogenic induced mBMSCs compared with normal mBMSCs (Figure 2a). Top 10 of up‐expressed and down‐expressed miRNAs including miR‐188 were selected to make heatmap (Figure 2b). A total of 140 upregulated and 151 downregulated lncRNAs in adipogenic induced mBMSCs compared with normal mBMSCs were showed in Figure 2c, heatmap revealed the top 10 of up‐expressed and down‐expressed lncRNAs including H19 (Figure 2d). A total of 142 up‐expressed and 134 down‐expressed mRNAs in adipogenic induced mBMSCs compared with normal mBMSCs were analyzed (Figure 2e). Top 20 of up‐expressed and down‐expressed mRNA including LCoR were selected to make heatmap (Figure 2f)

Figure 2.

Figure 2

Microarray analysis identified the differentially expressed miRNA, mRNAs, and lncRNAs. (a and b) Volcano plots and heatmap of differentially expressed miRNAs. (c and d) Volcano plots and heatmap of differentially expressed lncRNAs. (e and f) Volcano plots and heatmap of differentially expressed mRNAs

3.3. The expression of H19, miR‐188, and LCoR in osteogenic and adipogenic induced mBMSCs respectively

H19 and LCoR was significantly upregulated in osteogenic induced mBMSCs while the expression of miR‐188 was downregulated (p < 0.01, Figure 3a). In turn, the expression of H19 and LCoR was downregulated while the expression of miR‐188 was upregulated in adipogenic induced mBMSCs (p < 0.01, Figure 3b). Western blot results showed that LCoR had a high protein expression in osteogenic differentiation of mBMSC and a reversely low protein expression in adipogenic differentiation of mBMSC (p < 0.01, Figures 3c and 3d).

Figure 3.

Figure 3

The expression of H19, miR‐188, and LCoR in osteogenic and adipogenic induced mBMSCs respectively. (a) Qrt‐PCR detected the expression of H19, miR‐188, and LCoR in osteogenic differentiation of mBMSCs. (b) Qrt‐PCR detected the expression of H19, miR‐188, and LCoR in adipogenic differentiation of mBMSCs. (c) Western blot assay detected the expression of LCoR protein in osteogenic differentiation of mBMSCs. (d) Western blot assay detected the expression of LCoR protein in adipogenic differentiation of mBMSCs. **p < 0.01 compared with normal group

3.4. The relationship between H19 and miR‐188

Luciferase reporter assay was used to verify that the targeted relationship between miR‐188 and H19, Luciferase activity was significantly decreased in pMIR‐wt‐H19 and miR‐188 system (p < 0.05, Figure 4b). The binding site between H19 and miR‐188 was showed in Figure 4a. After transfection of si‐H19 in osteogenic induced mBMSCs, the expression of miR‐188 was significantly upregulated compared with NC (p < 0.01, Figure 4c). However, transfection of miR‐188 mimics could not reversely affect the expression of H19 (Figure 4d).

Figure 4.

Figure 4

The relationship between H19 and miR‐188. (a) The sequences of wildtype and mutant H19 3′‐UTR predicted by TargetScam. (b) Luciferase reporter assay showed that H19 directly targeting miR‐188. (c) Knockdown of H19 increased the expression of miR‐188 in osteogenic differentiation of mBMSCs. (d) Overexpression of miR‐188 didn't affect H19. *p < 0.05, **p < 0.01 compared with normal group

3.5. The relationship between miR‐188 and the mRNA of LCoR

We used luciferase reporter assay to verify that if miR‐188 directly targeting the 3′‐UTR of mRNA of LCoR. PMIR‐reporter vector containing the 3′‐UTR of wildtype or mutant LCoR were transfected into CHO cells with miR‐188 (Figure 5a). Luciferase activity was decreased in pMIR‐wt‐LCoR and miR‐188 system, while the luciferase activity in pMIR‐mut‐LCoR and miR‐188 system did not change (p < 0.05, Figure 5b). The differential expression relationship between miR‐188 and mRNA of LCoR were analysed in osteogenic induced mBMSCs by means of qRT‐PCR, overexpression of miR‐188 could notably reduce the expression of LCoR (p < 0.05, Figures 5c and 5d) Western blot showed that miR‐188 mimics could reduce the protein expression of LCoR, while miR‐188 inhibitor could significantly increase the protein expression (p < 0.01, Figures 5e and 5f).

Figure 5.

Figure 5

The relationship between miR‐188 and LCoR. (a) The sequences of wildtype and mutant LCoR 3′‐UTR predicted by TargetScam. (b) Luciferase reporter assay showed that miR‐188 directly targeting LCoR. (c) Overexpression of miR‐188 reduced the expression of LCoR in osteogenic differentiation of mBMSCs. (d) Silence of LCoR did not affect miR‐188. (e and f) Western blot showed the expression of LCoR after transfected with miR‐188 mimics and miR‐188 inhibitor in osteogenic differentiation of mBMSCs. *p < 0.05, **p < 0.01 compared with normal group

3.6. The relationship between miR‐188 and the mRNA of LCoR mediated the osteogenic and adipogenic differentiation of mBMSCs

Cell transfection assay was divided into six groups. (1) NC group: Vector. (Verma, Krishnan, Lin, Yang, & Hahn, 2017) miR‐188 group: (2) miR‐188‐5p mimics. (3) miR‐188 inhibitor group: miR‐188‐5p inhibitor. (4) LCoR group: pCMV‐LCoR. (5) si‐LCoR group: si‐LCoR. (6) miR‐188 + LCoR group: miR‐188‐5p mimics and pCMV‐LCoR. All the miRNA, siRNA, and plasmid mentioned above were transfected into mBMSCs, respectively. After transfection, the expression of osteogenic and adipogenic related genes in mBMSCs were detected by qRT‐PCR (Figures 6a and 6b) and Western blot (Figures 7a and 7b). Key genes of osteogenic differentiation like BMP‐2, OSX, and OCN were down regulated, key genes of adipogenic differentiation like Adiponectin, PPARγ, leptin were up regulated in miR‐188 (p < 0.05) group and si‐LCoR group (p < 0.05) compared with NC. Key genes of osteogenic differentiation like BMP‐2, OSX, and OCN were up regulated, key genes of adipogenic differentiation like Adiponectin, PPARγ, leptin were down regulated in miR‐188 inhibitor group (p < 0.05) and pCMV‐LCoR group (p < 0.05) compared with NC. NC group and miR‐188 + LCoR group had no statistically significance (p > 0.05).

Figure 6.

Figure 6

The effect of miR‐188 and LCoR on osteogenic and adipogenic in mBMSCs. (a and b) qRT‐PCR was used to detected the osteogenic and adipogenic related genes expression. *p < 0.05, compared with NC group

Figure 7.

Figure 7

The effect of miR‐188 and LCoR on osteogenic and adipogenic in mBMSCs. (a and b) Western blot was used to detected the osteogenic and adipogenic related genes expression. *p < 0.05, compared with NC group

The activity of alkaline phosphatase was induced in miR‐188 inhibitor group and pCMV‐LCoR group, while miR‐188 group and si‐LCoR group were suppressed the activity of alkaline phosphatase. The results were positive in miR‐188 inhibitor group and pCMV‐LCoR group. NC had no difference compared with miR‐188 + LCoR group (p < 0.05, Figure 8a). MiR‐188 inhibitor group and pCMV‐LCoR group could induce the formation of calcium nodules, while miR‐188 group and si‐LCoR group suppressed the calcium nodules formation, NC had no difference with miR‐188 + LCoR group (p < 0.05, Figure 8b). MiR‐188 group and si‐LCoR group could induce the lipid droplets formation, miR‐188 inhibitor group and pCMV‐LCoR group suppressed the formation of lipid droplets, NC had no difference with miR‐188 + LCoR group (p > 0.05, Figure 8c). The number of lipid droplets could be quantitative analyzed by supporting software.

Figure 8.

Figure 8

The effect of miR‐188 and LCoR on osteogenic and adipogenic in mBMSCs. (a) Alkaline phosphatase staining assay determined the activity of alkaline phosphatase; (b) Alizarin red staining detected the Calcium nodules in mBMSCs. (c) Oil red O staining detected the lipid droplets in mBMSCs. *p < 0.05, compared with NC group

4. DISCUSSION

In our study, miR‐188 was identified to present a low expression in mBMSCs osteogenic differentiation while H19 and LCoR had a high expression in mBMSCs adipogenic differentiation. We also confirmed that there were targeted relationships between H19 and miR‐188, as well as between miR‐188 and LCoR. Knockdown of H19 could significantly increase the expression of miR‐188 and overexpression of miR‐188 could reduce the LCoR expression at both mRNA and protein level. Furthermore, other characterizations such as Alkaline phosphatase staining, Alizarin red staining and Oil red O staining showed that miR‐188 inhibited osteoblastic differentiation and promoted adipogenic differentiation of mBMSCs by inhibiting the effects of LCoR on mBMSCs.

MSC is characterized by multiple potentials into cells of mesodermal origin, like adipocytes and osteocytes (Dominici et al., 2006). MiRNAs have important regulatory functions in osteogenic differentiation, including adipogenesis and osteogenesis (Hwang et al., 2014). Accumulating evidence indicated that miRNA was an essential factor in MSC function by regulating gene expression (Hao et al., 2016). For example, miR‐196 inhibited MSC growth by targeting HOXB7 (Candini et al., 2015). Onodera et al. (2017) demonstrated that miR‐155 induced ROS generation through downregulation of antioxidation‐related genes in MSC. Guo et al. (2016) discovered that miR‐23a/b regulated BMSCs differentiation by directly targeting Teme64. Previously, miR‐188 was verified to be associated with MSC commitment to adipocytes or cartilage cells over the osteoblasts (Belaya et al., 2017). Li, Cheng, et al., 2015 identified highly expressed miR‐188 from the BMSCs of aged mice and human subjects, which also stimulated trabecular and cortical‐endosteal bone formation and decreased bone marrow fat accumulation in aged mice. In present study, we observed that miR‐188 was down‐regulated in mBMSCs, and its overexpression inhibited the expression of key genes (BMP‐2, OSX, and OCN) of osteogenic differentiation, while promoted the expression of key genes (Adiponectin, PPARγ, and leptin) of adipogenic differentiation. The results of our experiments are concordant with previous study, which demonstrated that treatment with antagomiR‐188 via a BMSC‐specific aptamer increased bone formation and decreased bone marrow fat accumulation in aged mice (Li, Cheng, et al., 2015). In another study, Heilmeier et al. (2016) found that miR‐188‐3p did not exert an effect on adipogenesis human MSCs. The different results we reached are attributed to the distinct objects in each experiment.

Several lncRNAs have been reported to regulate the adipogenesis and osteogenesis in BMSCs. Wu et al. (2018) demonstrated that H19 could stimulate osteogenic differentiation of mBMSC and suppresses adipogenic differentiation of mBMSC, which was also further verified in our research. It was previously shown that lncRNAs could act as a molecular sponge regulating miRNAs. Liang et al. (2015) found that H19 promotes epithelial to mesenchymal transition by functioning as miRNA sponges in colorectal cancer. Our studies also found that H19 could significantly regulate miR‐188.

It has been reported that LCoR could act as not only a corepressor but also a transcriptional corepressor, which suggested that LCoR was involved in different mechanisms to regulate transcription (Cao et al., 2017). LCoR has been determined to act as a negative regulator of adipogenesis in previous study (Cao et al., 2017). To further explore the molecular mechanism of mBMSCs, we examined the expression level of LCoR in mBMSCs and verified that low expression of LCoR inhibited the adipogenic differentiation of mBMSCs. Analogously, Cao et al. (2017) revealed that LCoR repressed early adipogenesis by inhibiting C/EBPβ transcriptional activity. However, whether there was an interaction between miR‐188 and LCoR was not clear. In this work, various experiments were performed to probe into the inner mechanism. We surprisingly discovered that there was a negative correlation between miR‐188 and LCoR, and substantiated that miR‐188 could decrease of mBMSCs osteocyte differentiation and increase of mBMSCs adipocyte differentiation through targeting LCoR.

Nevertheless, there are still some limitations in our study. First, we only investigated the effects of miR‐188 and LCoR in mBMSCs, while their influence on human BMSCs needs to be further elucidated. Second, our experiments were carried out based on aged mice alone, and hence we would conduct relevant experiments in young and old mice in the following study. To better understand potential changes in osteoblastic differentiation and adipogenic differentiation of mBMSCs, our next study will explore whether miR‐188 or LCoR had impact on cell activity of BMSCs.

In conclusion, lncRNA H19 was downregulated in adipogenic differentiation of mBMSCs and significantly reduced the expression of miR‐188. Meanwhile, miR‐188 decreased mBMSCs osteocyte differentiation and increased mBMSCs adipocyte differentiation by regulating LCoR, which elucidated a novel mechanism underlying BMSCs.

CONFLICTS OF INTEREST

None.

AUTHORS' CONTRIBUTION

YW, WL, ZZ, and ZF contributed to the conception and design, YL, JC, HC, and BL analyzed and interpreted the data, YW, ZZ, and HC drafted the article, WL, YL, JC, ZF, and BL revised it critically for important intellectual content, and all authors approved the final version to be published.

REFERENCES

  1. An, Q. , Wu, D. , Ma, Y. , Zhou, B. , & Liu, Q. (2015). Suppression of Evi1 promotes the osteogenic differentiation and inhibits the adipogenic differentiation of bone marrow‐derived mesenchymal stem cells in vitro. International Journal of Molecular Medicine, 36(6), 1615–1622. [DOI] [PubMed] [Google Scholar]
  2. Belaya, Z. E. , Grebennikova, T. A. , Melnichenko, G. A. , Nikitin, A. G. , Solodovnikov, A. G. , Brovkina, O. I. , … Dedov, I. I. (2017). Effects of endogenous hypercortisolism on bone mRNA and microRNA expression in humans. Osteoporosis International: A Journal Established as Result of Cooperation Between the European Foundation for Osteoporosis and the National Osteoporosis Foundation of the USA, 29(1), 1–11. [DOI] [PubMed] [Google Scholar]
  3. Candini, O. , Spano, C. , Murgia, A. , Grisendi, G. , Veronesi, E. , Piccinno, M. S. , … Dominici, M. (2015). Mesenchymal progenitors aging highlights a miR‐196 switch targeting HOXB7 as master regulator of proliferation and osteogenesis. Stem Cells, 33(3), 939–950. [DOI] [PubMed] [Google Scholar]
  4. Cao, H. , Zhang, S. , Shan, S. , Sun, C. , Li, Y. , Wang, H. , … Ying, H. (2017). Ligand‐dependent corepressor (LCoR) represses the transcription factor C/EBPbeta during early adipocyte differentiation. The Journal of Biological Chemistry, 292(46), 18973–18987. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Dominici, M. , Le Blanc, K. , Mueller, I. , Slaper‐Cortenbach, I. , Marini, F. , Krause, D. , … Horwitz, E. (2006). Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for cellular therapy position statement. Cytotherapy, 8(4), 315–317. [DOI] [PubMed] [Google Scholar]
  6. Fernandes, I. , Bastien, Y. , Wai, T. , Nygard, K. , Lin, R. , Cormier, O. , … White, J. H. (2003). Ligand‐dependent nuclear receptor corepressor LCoR functions by histone deacetylase‐dependent and ‐independent mechanisms. Molecular Cell, 11(1), 139–150. [DOI] [PubMed] [Google Scholar]
  7. Ghali, O. , Broux, O. , Falgayrac, G. , Haren, N. , van Leeuwen, J. P. , Penel, G. , … Chauveau, C. (2015). Dexamethasone in osteogenic medium strongly induces adipocyte differentiation of mouse bone marrow stromal cells and increases osteoblast differentiation. BMC Cell Biology, 16, 9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Gu, C. , Xu, Y. , Zhang, S. , Guan, H. , Song, S. , Wang, X. , … Zhao, G. (2016). MiR‐27a attenuates adipogenesis and promotes osteogenesis in steroid‐induced rat BMSCs by targeting PPARgamma and GREM1. Scientific Reports, 6, 38491. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Guo, Q. , Chen, Y. , Guo, L. , Jiang, T. , & Lin, Z. (2016). MiR‐23a/b regulates the balance between osteoblast and adipocyte differentiation in bone marrow mesenchymal stem cells. Bone Research, 4, 16022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Hao, C. , Yang, S. , Xu, W. , Shen, J. K. , Ye, S. , Liu, X. , … Feng, Y. (2016). MiR‐708 promotes steroid‐induced osteonecrosis of femoral head, suppresses osteogenic differentiation by targeting SMAD3. Scientific Reports, 6, 22599. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Hay, E. , Dieudonne, F. X. , Saidak, Z. , Marty, C. , Brun, J. , Da Nascimento, S. , … Marie, P. J. (2014). N‐cadherin/wnt interaction controls bone marrow mesenchymal cell fate and bone mass during aging. Journal of Cellular Physiology, 229(11), 1765–1775. [DOI] [PubMed] [Google Scholar]
  12. Heilmeier, U. , Hackl, M. , Skalicky, S. , Weilner, S. , Schroeder, F. , Vierlinger, K. , … Link, T. M. (2016). Serum miRNA signatures are indicative of skeletal fractures in postmenopausal women with and without type 2 diabetes and influence osteogenic and adipogenic differentiation of adipose tissue‐derived mesenchymal stem cells In vitro. Journal of Bone and Mineral Research: The Official Journal of the American Society for Bone and Mineral Research, 31(12), 2173–2192. [DOI] [PubMed] [Google Scholar]
  13. Huang, Y ., Zheng, Y ., Jin, C ., Li, X ., Jia, L. , & Li, W . (2016). Long non‐coding RNA H19 inhibits adipocyte differentiation of bone marrow mesenchymal stem cells through epigenetic modulation of histone deacetylases. Scientific Reports, 6, 28897. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Hwang, S. , Park, S. K. , Lee, H. Y. , Kim, S. W. , Lee, J. S. , Choi, E. K. , … Suh, N. (2014). MiR‐140‐5p suppresses BMP2‐mediated osteogenesis in undifferentiated human mesenchymal stem cells. FEBS Letters, 588(17), 2957–2963. [DOI] [PubMed] [Google Scholar]
  15. Li, C. J. , Cheng, P. , Liang, M. K. , Chen, Y. S. , Lu, Q. , Wang, J. Y. , … Luo, X. H. (2015). MicroRNA‐188 regulates age‐related switch between osteoblast and adipocyte differentiation. The Journal of Clinical Investigation, 125(4), 1509–1522. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Li, S. , Huang, K. J. , Wu, J. C. , Hu, M. S. , Sanyal, M. , Hu, M. , … Lorenz, H. P. (2015). Peripheral blood‐derived mesenchymal stem cells: Candidate cells responsible for healing critical‐sized calvarial bone defects. Stem Cells Translational Medicine, 4(4), 359–368. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Liang, W. C ., Fu, W. M ., Wong, C. W ., Wang, Y ., Wang, W. M ., Hu, G. X ., … Waye, M. M . (2015). The lncRNA H19 promotes epithelial to mesenchymal transition by functioning as miRNA sponges in colorectal cancer. Oncotarget, 6(26), 22513–22525. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Lopez, C. J. , Nagornaya, N. , Parra, N. A. , Kwon, D. , Ishkanian, F. , Markoe, A. M. , … Stoyanova, R. (2017). Association of radiomics and metabolic tumor volumes in radiation treatment of glioblastoma multiforme. International Journal of Radiation Oncology, Biology, Physics, 97(3), 586–595. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Onodera, Y. , Teramura, T. , Takehara, T. , Obora, K. , Mori, T. , & Fukuda, K. (2017). MiR‐155 induces ROS generation through downregulation of antioxidation‐related genes in mesenchymal stem cells. Aging Cell, 16(6), 1369–1380. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Palijan, A. , Fernandes, I. , Verway, M. , Kourelis, M. , Bastien, Y. , Tavera‐Mendoza, L. E. , … White, J. H. (2009). Ligand‐dependent corepressor LCoR is an attenuator of progesterone‐regulated gene expression. The Journal of Biological Chemistry, 284(44), 30275–30287. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Song, Y ., Shan, S ., Zhang, Y ., Liu, W ., Ding, W ., Ren, W ., … Ying, H . (2012). Ligand‐dependent corepressor acts as a novel corepressor of thyroid hormone receptor and represses hepatic lipogenesis in mice. Journal of Hepatology 56(1), 248–254. [DOI] [PubMed] [Google Scholar]
  22. Verma, V. , Simone, C. B., 2nd , Krishnan, S. , Lin, S. H. , Yang, J. , & Hahn, S. M. (2017). The rise of radiomics and implications for oncologic management. Journal of the National Cancer Institute, 109(7). [DOI] [PubMed] [Google Scholar]
  23. Wang, Q ., Li, Y ., Zhang, Y ., Ma, L ., Lin, L ., Meng, J ., … Zhang, Y . (2017). LncRNA MEG3 inhibited osteogenic differentiation of bone marrow mesenchymal stem cells from postmenopausal osteoporosis by targeting miR‐133a‐3p. Biomedicine & Pharmacotherapy=Biomedecine & Pharmacotherapie 89:1178–1186. [DOI] [PubMed] [Google Scholar]
  24. Wei, J. , Li, H. , Wang, S. , Li, T. , Fan, J. , Liang, X. , … Zhao, R. C. (2014). Let‐7 enhances osteogenesis and bone formation while repressing adipogenesis of human stromal/mesenchymal stem cells by regulating HMGA2. Stem Cells and Development, 23(13), 1452–1463. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Wu, J. , Zhao, J. , Sun, L. , Pan, Y. , Wang, H. , & Zhang, W. B . (2018). Long non‐coding RNA H19 mediates mechanical tension‐induced osteogenesis of bone marrow mesenchymal stem cells via FAK by sponging miR‐138. Bone, 108, 62–70. [DOI] [PubMed] [Google Scholar]
  26. Yan, Z. , Zeng, L. , Li, Z. , Zhang, H. , Chen, W. , Jia, L. , … Xu, K. (2013). Bone marrow‐derived endothelial progenitor cells promote hematopoietic reconstitution after hematopoietic stem cell transplantation. Transplantation Proceedings, 45(1), 427–433. [DOI] [PubMed] [Google Scholar]
  27. Zhang, Y ., Su, X ., Kong, Z ., Fu, F ., Zhang, P ., Wang, D ., … Li, Y . (2017). An androgen reduced transcript of LncRNA GAS5 promoted prostate cancer proliferation. PLoS ONE, 12(8), e0182305. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Zhuang, W ., Ge, X ., Yang, S ., Huang, M ., Zhuang, W ., Chen, P., … Li B. (2015). Upregulation of lncRNA MEG3 promotes osteogenic differentiation of mesenchymal stem cells from multiple myeloma patients by targeting BMP4 transcription. Stem Cells, 33(6), 1985–1997. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Cellular Physiology are provided here courtesy of Wiley

RESOURCES