Skip to main content
NCBI home page
Wiley Open Access Collection logoLink to Wiley Open Access Collection
. 2018 Apr 16;233(9):7367–7378. doi: 10.1002/jcp.26572

Oleic acid promotes prostate cancer malignant phenotype via the G protein‐coupled receptor FFA1/GPR40

Antonietta Liotti 1, Vincenzo Cosimato 1, Paola Mirra 2, Gaetano Calì 3, Domenico Conza 2, Agnese Secondo 4, Gelsomina Luongo 5, Daniela Terracciano 1, Pietro Formisano 1, Francesco Beguinot 2, Luigi Insabato 5,✉, Luca Ulianich 2,✉
PMCID: PMC13482116  PMID: 29663374

Abstract

Prostate cancer (PCa) is the most commonly diagnosed malignancy in men and the second leading cause of cancer‐related death in industrialized countries. Epidemiologic evidence suggests that obesity promotes aggressive PCa. Recently, a family of Free Fatty Acid (FFA) receptors (FFARs) has been identified and reported to affect several crucial biological functions of tumor cells such as proliferation, invasiveness, and apoptosis. Here we report that oleic acid (OA), one of the most prevalent FFA in human plasma, increases proliferation of highly malignant PC3 and DU‐145 PCa cells. Furthermore, docetaxel cytotoxic action, the first‐line chemotherapeutic agent for the treatment of androgen‐independent PCa, was significantly reduced in the presence of OA, when measured by the 3‐(4,5‐dimethylthiazol‐2‐yl)‐2,5‐diphenyl tetrazolium bromide assay, suggesting that this FFA plays also a role in chemoresistance. OA induced intracellular calcium increase, in part due to the store operated calcium entry (SOCE), measured by a calcium imaging technique. Moreover, PI3K/Akt signaling pathway was enhanced, as revealed by increased Akt phosphorylation levels. Intriguingly, attenuating the expression of FFA1/GPR40, a receptor for long chain FFA including OA, prevented the OA‐induced effects. Of relevance, we found that FFA1/GPR40 is significantly overexpressed in tissue specimens of PCa, compared to benign prostatic hyperplasia tissues, at both mRNA and protein expression level, analyzed by Real Time RT‐PCR and immunofluorescence experiments, respectively. Our data suggest that OA promotes an aggressive phenotype in PCa cells via FFA1/GPR40, calcium and PI3K/Akt signaling. Thus, FFA1/GPR40, might represent a potential useful prognostic biomarker and therapeutic target for the treatment of advanced PCa.

Keywords: calcium, FFA1/GPR40, oleic acid, prostate cancer

Oleic acid induces proliferation and resistance to docetaxel in prostate cancer cells via FFA1/GPR40 ‐ FFA1/GPR40 is overexpressed in prostate cancer tissues.

graphic file with name JCP-233-7367-g002.jpg

1. INTRODUCTION

Prostate cancer (PCa) is the most commonly diagnosed malignancy in men and the second leading cause of cancer‐related death in industrialized countries (Ferlay, Soerjomataram, & Ervik, 2013; Howlader et al., 2015). Obesity, defined as abnormal excess accumulation of fat in adipose tissue, is associated with an increased risk of developing several types of cancer, such as breast and colorectal cancer (Kushi & Giovannucci, 2002). The epidemiological evidence linking obesity to PCa incidence is conflicting (Lo et al., 2016). However, the relationship between obesity and death from PCa has been more firmly established (Freedland & Aronson, 2005) and it is estimated that obesity accounts for an increase of about 15% in the incidence of high‐grade prostate cancers over the past 30 years (Fesinmeyer et al., 2009). Obesity is correlated with dietary intake and, thus, obese men have a positive energy balance and consume greater amounts of dietary fat (Satia‐Abouta, Patterson, Schiller, & Kristal, 2002). Furthermore, unlike the majority of malignancies, PCa is characterized by low glycolysis and glucose uptake rates, resulting in the dominant uptake of fatty acids (FAs) over glucose (Liu, Zuckier, & Ghesani, 2010). This suggests that catabolism of FAs, not glucose, may be the dominant bioenergetics source in PCa and, thus, be an important fuel source for cell proliferation. However, it has been described that FAs, besides their role as bioenergetics source, can also act as extracellular signaling molecules, affecting different signaling pathways related to crucial biological functions of tumor cells such as proliferation (Kim et al., 2015; Kwan et al., 2014) and invasion (Brown et al., 2010; Soto‐Guzman, Navarro‐Tito, Castro‐Sanchez, Martinez‐Orozco, & Salazar, 2010), but also suppression of tumor progression (Chen et al., 2014; Miglietta et al., 2006) and apoptosis (Cui, Chen, & Hu, 2010; Hardy et al., 2003; Miglietta et al., 2006; Wang et al., 2013). In the last decade, several orphan G protein‐coupled receptors (GPCRs) that act as Free Fatty Acid (FFA) receptors (FFARs) have been identified and described to play important physiological roles in various diseases, including cancer. The FFAR family is comprised of FFA receptors 1–4, formerly known as GPR40, 43, 41, and 120, respectively (Hopkins & Meier, 2017). Among these receptors, FFA1/GPR40 and FFA4/GPR120 in particular have been described to play a role in different types of cancer, such as melanoma, breast and prostate cancer (Houthuijzen, 2016). These two receptors, bind specifically medium‐ and long‐chain FAs that include saturated FAs such as palmitic acid, monounsaturated FAs such as oleic acid (OA), and polyunsaturated omega‐3 fatty acids (n‐3 PUFAs) (Hopkins & Meier, 2017). They also share G‐protein coupling mechanisms, as they both couple through Gq/11, although FFA1/GPR40 also signals through Gi/o (Hopkins & Meier, 2017). Despite their similarities, FFA1/GPR40 and FFA4/GPR120 can exert very different, and even opposite, effects in cancer cells depending on both the specific FFA and the cancer type. Recently, n‐3 PUFAs have been shown to inhibit growth factor signaling in human prostate and breast cancer cells through FFA4/GPR120 (Hopkins, Zhang, Liu, & Meier, 2016; Liu et al., 2015). On the other hand, OA, one of the most prevalent FFA in human plasma (Pandalai, Pilat, Yamazaki, Naik, & Pienta, 1996), has been reported to modulate intracellular calcium ions concentration ([Ca2+]i) and to promote proliferation of breast cancer cells through FFA1/GPR40 (Hardy, St‐Onge, Joly, Langelier, & Prentki, 2005). Results from studies investigating the role of OA in PCa are scarce and controversial. Some studies indicate that OA has inhibitory effects on PCa cells (Hughes‐Fulford, Chen, & Tjandrawinata, 2001), including PC3 cells, while others report that OA increases proliferation of PC3 cells (Hagen, Rhodes, & Ladomery, 2013). This apparent contradiction might be explained, however, by an hormetic effect of OA in PC3 cells, as, in the two studies, different concentrations of OA were used. It has also been reported that OA might play a role in more advanced PCa (Kositsawat, Flanigan, Meydani, Choi, & Freeman, 2007; Persad, Gillatt, Heinemann, Habib, & Smith, 1990). However, the molecular mechanism/s involved, as the role of GPR40/FFA1, have been poorly investigated. A growing body of evidence strongly highlights the importance of [Ca2+]i homeostasis in prostate cancer pathophysiology (Brown & MacLeod, 2001). In particular, it has been reported that extracellular Ca2+ is associated with the onset of PCa metastasis (Liao, Schneider, Datta, & McCauley, 2006). However, the mechanism triggered by Ca2+ in prostate cancer cells and its repercussion on prostate gland pathophysiology remain unknown. In the present study we sought to investigate the effects of OA on poorly differentiated PCa cells and the role of FFA1/GPR40 and Ca2+ in mediating such effects.

2. MATERIALS AND METHODS

2.1. Patients and tissues

Specimens were composed of prostatic carcinomas (N = 20) and benign prostatic hyperplasia (N = 10), as specified in Table 1. They were collected from the Department of Anatomic Pathology of University of Naples “Federico II.” All specimens were examined and the tumors were histologically graded by an expert uropathologist (LI) according to the guidelines of the World Health Organization (Humphrey, Moch, Cubilla, Ulbright, & Reuter, 2016). Whole sections of a thickeness of 4 µm of prostatic tumors were used. 10 cases were low‐grade PCa 3 + 3 = 6 Gleason score, 5 cases were high‐grade PCa 4 + 4 = 8 Gleason score, 5 cases were high‐grade PCa 5 + 4 = 9 Gleason score, and 5 cases were high‐grade PCa 5 + 5 = 10 Gleason score. Moreover, 10 cases of benign prostatic hyperplasia were selected as control tissues.

Table 1.

Clinicopathological characteristics of the analysed prostate tissues

Low grade patients Age (years) BMI (kg/m2) Grading (Gleason score)
1 66 30.4 6
2 70 25.7 6
3 62 27.6 6
4 62 25.9 6
5 64 26.8 6
6 54 25.9 6
7 64 31.4 6
8 61 28.6 6
9 63 33.79 6
10 72 26.36 6
High grade patients Age (years) BMI (kg/m2) Grading (Gleason score)
11 57 26.12 8
12 60 26.36 8
13 64 28 8
14 51 24.9 8
15 62 28.07 8
16 71 33.2 9
17 66 30.2 9
18 68 32.6 9
19 67 26.8 10
20 70 28.9 10
BH patients (controls) Age (years) BMI (kg/m2) Grading (Gleason score)
21 58 28.33 ‐
22 62 25.51 ‐
23 64 24.16 ‐
24 60 29.94 ‐
25 62 28.07 ‐
26 71 23.91 ‐
27 70 30.42 ‐
28 64 25.76 ‐
29 67 26.48 ‐
30 66 25.92 ‐
Open in a new tab

2.2. Cell lines and reagents

PC3 and DU‐145 cells (ATCC, Manassas, VA) were maintained in DMEM medium containing 10% FBS, penicillin–streptomycin, l‐glutamine. Cells were grown at 37 °C with 5% CO2. DMEM, l‐glutamine, FBS and penicillin–streptomycin were from Lonza (Verviers, Belgium). MTT [3‐(4,5‐dimethylthiazol‐2‐yl)‐2,5‐diphenyltetrazolium bromide] was purchased from Sigma (St. Louis, MO). Anti‐FFA1/GPR40, anti‐tubulin, anti‐GAPDH, and anti‐14.3.3 antibodies were from Santa Cruz Biotechnologies (Dallas, TX), anti‐p‐Akt antibodies (Ser473) were from Cell Signaling (Laiden, NL), anti‐β‐catenin, and anti‐lamin A/C antibodies were from BD Biosciences (San Jose, CA). The Enhanced chemiluminescence Western blotting detection reagents were purchased from Pierce Biotechnology (Rockford, IL).

2.3. RNA isolation and real‐time reverse transcription‐PCR

Total RNA was extracted from 10 μm slices of formalin‐fixed, paraffin embedded tissue specimens with the RNeasy FFPE kit (Qiagen, Hilden, Germany). Total RNA was reverse transcribed to cDNA by using random hexamers and the ImProm‐II reverse transcriptase system Promega (Madison, WI). PCRs were performed using SYBR Green mix Invitrogen (Carlsbad, CA). Reactions were performed using Platinum SYBR Green qPCR Super‐UDG using an iCycler IQ multicolor Real Time PCR Detection System (Biorad, Hercules, CA). All reactions were performed in triplicate, and GAPDH was used as an internal standard. Oligonucleotides used were: 5′‐ GGGAGCCAAAAGGGTCATCA‐3′ and 5′‐TGGTTCACACCCATGACGAA‐3′ for GAPDH; 5′‐CGGTTACTTGGGAAGGGGTC‐3′ and 5′‐GCGTTACTTCTGGGACTTGC‐3′ for FFA1/GPR 40.

2.4. Cell proliferation, MTT assay, and Western blot

Cells (1 × 105 cells/well) were seeded in six‐well culture plates in a complete medium. The following day, the cells were starved in serum‐free DMEM 0.25% BSA for 16 hr and incubated with OA 100, 200, or 400 μM for 24 and 48 hr. Cell count was performed either by Bürker chamber or with the TC10 Automated Cell Counter (Bio‐Rad) according to the manufacturer's protocol. In vitro viability was assessed with MTT assay (Sigma–Aldrich). Briefly, 1 × 103 cells per well were plated onto 96‐well microtiter plates in medium with 10% FBS. Cells were mock treated or treated as described. At the end of incubation time plates were developed. For Western blot assays, cells were washed with ice‐cold phosphate‐buffered saline (PBS) and harvested in Laemmli buffer (with β‐mercaptoethanol) containing a mixture of phosphatase inhibitors (0.5 mM sodium vanadate, 2 mM sodium pyrophosphate, 5 mM β‐glycerolphosphate, and 50 mM sodium fluoride) and the proteases inhibitor phenylmethylsulfonyl fluoride (Sigma–Aldrich). Western blots were carried out as previously reported (Bifulco et al., 2012). Densitometric analysis was performed using NIH ImageJ software.

2.5. Cell fractionation

Cells were lysed in hypotonic buffer (20 mM Tris–HCl pH 7.4, 10 mM NaCl, 3 mM MgCl2 protease, and phosphatase inhibitor mixture solution) for 15 min at 4 °C. After centrifugation at 850g for 10 min, supernatants were collected to obtain the cytoplasmic proteins. The nuclear pellets were resuspended in extraction buffer (100 mM Tris Ph 7.4, 100 mM NaCl, 1 mM EDTA, 1 mM EGTA, 0.1% SDS, 1% Triton X100, 0.5% Deoxycholate, protease and phosphatase inhibitor mixture solution) for 30 min at 4 °C with vortexing. After centrifugation at 10,000g for 30 min the supernatants were collected.

2.6. Cell cycle analysis

The cells were starved in serum‐free DMEM 0.25% BSA for 16 hr and incubated with OA 200 μM for 48 hr, followed by trypsinization and collection. The single cell suspension was fixed with 70% ethanol (added drop‐wise) and stored overnight at −20 °C. The fixed cells were then washed twice with ice‐cold PBS and stained with PI (33 µg/ml with 0.1% Triton X–100) in the presence of 500 µg/ml RNase A in the dark for 1 hr at room temperature. DNA content was analyzed on a guava EasyCyte 8 flow cytometer (EMD Millipore; Billerica, MA). The derived data were analyzed with ModFit LT Software to estimate the percentages of cells at G0/G1, S, and G2/M phases.

2.7. Sh‐RNA targeting

To inhibit expression of endogenous FFA1/GPR40, PC3 cells have been transiently transfected with either constructs containing short hairpin (sh)‐RNAs specific to human FFA1/GPR40 or a scramble construct with no homology to any known human mRNA, as negative control (Qiagen, Valencia, CA).

2.8. Wound healing

Cells (1 × 106 per well) were seeded in six‐well plates and allowed to adhere for 24 hr. Confluent monolayer cells were scratched by a 200 μl pipette tip, washed three times with PBS to clear cell debris and suspension cells and fresh medium was added. Cells were treated with the indicated stimuli and the cells were allowed to close the wound for 48 hr. Photographs were taken at 0 and 48 hr at the same position of the wound and the distance between the edges was measured.

2.9. Immunofluorescence

Cells grown on glass coverslips were fixed with methanol at −20 °C for 10 min followed by 1 min incubation with ice cold acetone and then treated as previously described (Calì et al., 2014). Nuclei were stained with Hoechst 33258 Sigma. As negative control, secondary antibody alone was used.

2.10. [Ca2+]i measurement

[Ca2+]i was measured by single cell computer‐assisted videoimaging (Secondo et al., 2007). Briefly, PC3 cells grown on glass coverslips were loaded with 6 μM Fura‐2 acetoxymethyl ester (Fura‐2AM) (Calbiochem, San Diego, CA) for 30 min at 37° C. At the end of the Fura‐2AM loading period, the coverslips were placed into a perfusion chamber (Medical System, Co. Greenvale, NY) mounted onto a Zeiss Axiovert 200 microscope (Carl Zeiss, Germany) equipped with a FLUAR 40× oil objective lens. The experiments were carried out with a digital imaging system composed of MicroMax 512BFT cooled CCD camera (Princeton Instruments, Trenton, NJ), LAMBDA 10–2 filter wheeler (Sutter Instruments, Novato, CA,), and Meta‐Morph/MetaFluor Imaging System software (Universal Imaging, West Chester, PA). After loading, cells were alternatively illuminated at wavelengths of 340 nm and 380 nm by a Xenon lamp. The emitted light was passed through a 512 nm barrier filter. Fura‐2AM fluorescence intensity was measured every 3 s. Ratiometric values were automatically converted by the software into [Ca2+]i using a preloaded calibration curve obtained in preliminary experiments as previously reported (Grynkiewicz, Poenie, & Tsien, 1985).

3. RESULTS

3.1. OA enhances the aggressive phenotype of PC3 cells

First of all we sought to establish whether OA was able to affect PCa cells proliferation. To this aim, we treated PC3 cells, a highly aggressive androgen‐independent PCa cell line derived from bone metastases, with increasing concentration of OA. As shown in Figure 1a, PC3 cells treated with OA for 48 hr showed a significant increase of their proliferation rate, when compared to untreated cells, in a dose‐dependent manner. Cell cycle analysis of treated cells indicated that OA increased the percentage of cells in S phase (Figure 1b), strengthening the cell proliferation data. Next, we tested whether OA was also capable to affect prostate cancer cell migration. To this aim, we performed wound healing experiments. As shown in Figure 1b, PC3 cells treated with 200 µM OA for 48 hr migrated faster toward the wounded area compared to untreated cells (0.25% BSA). However, when PC3 cells were preincubated with the cytostatic agent mitomycin, the migration rate increase induced by OA was still observable but did not reach statistical significance (Figure 1c), suggesting that OA influenced prevalently cell proliferation and to a lesser extent migration of PC3 cells. Finally, as reduced sensitivity to chemotherapeutic agents may represent an important feature of cancer cells aggressive phenotype, we sought to verify whether OA treatment might influence the response of PC3 cells to docetaxel treatment. Docetaxel‐based chemotherapy is widely used as the first‐line treatment for castration‐resistant PCa patients (Francini & Sweeney, 2016). However, many of these patients eventually acquire resistance to docetaxel over time (Armstrong & Gao, 2015). As shown by the MTT assay in Figure 1d, docetaxel treatment, as already reported (Lin et al., 2017), was able to induce a significant decrease of PC3 cell viability. However, when cells were treated with docetaxel in the presence of 200 μM OA, this effect was no longer observable, suggesting that OA was able to influence PC3 sensitivity to the drug. To strengthen the malignant role of OA in PCa, we performed the proliferation, migration and Dctx experiments in DU‐145, a second PCa cell line. Analogously to PC3 cells, OA increased the percentage of cells in S phase (Figure 2a). Again, migration was not significantly affected by OA treatment (Figure 2b) whereas it was able to affect the sensitivity of cells to docetaxel (Figure 2c). Together these data suggest that OA confers a more aggressive phenotype to PCa cells.

Figure 1.

Figure 1

Open in a new tab

OA induces proliferation and resistance to docetaxel treatment in PC3 cells. (a) PC3 cell were serum‐starved for 16 hr and incubated with 100, 200, or 400 μM OA for 24 and 48 hr. Cell number was evaluated as described in section 2. Data represent mean values ± SD of triplicate samples of three independent experiments. **p < 0.01. (b) PC3 cells were serum starved (0.25 % BSA) for 16 hr and then treated or not with 200 μM OA for 48 hr. Cell cycle distribution was measured by FACS using a PI staining assay. The values shown indicate the percentage of cells in G0/G1, S, and G2/M phase of the cell cycle. (c) Confluent monolayers of PC3 cells were wounded by manually scratching as described in section 2 and incubated with either medium containing 10% fetal bovine serum (FBS), BSA 0.25% alone or BSA 0.25% and 200 μM OA or BSA 0.25%, 200 μM OA and 10 μM mitomycin (Mito) for 48 hr. Images of wound gap were taken at 0 and 48 hr by a digital camera coupled to the microscope and percentage of wound distance was calculated with the camera software. The graph shows the percentage of gap closure at 48 hr compared with time 0. A complete gap closure was considered as 100%. Data represent mean values ± SD of triplicate samples of three independent experiments. *p < 0.05; **p < 0.01. (d) PC3 cells were treated with 200 μM OA, 16 nM docetaxel or both the substances for 48 hr. Cell viability was assessed by MTT assay as described in section 2. The results were reported as percentage of viable cells compared to control, considered as maximum viability (100%). Data represent the mean ± SD of triplicate samples of three independent experiments. **p < 0.01; ***p < 0.001

Figure 2.

Figure 2

Open in a new tab

OA induces proliferation and resistance to docetaxel treatment in DU‐145 cells. (a) DU‐145 cells were serum starved (0.25 % BSA) for 16 hr and then treated or not with 200 μM OA for 48 hr. Cell cycle distribution was measured by FACS using a PI staining assay. The values shown indicate the percentage of cells in G0/G1, S, and G2/M phase of the cell cycle. (b) Confluent monolayers of DU‐145 cells were wounded by manually scratching as described in section 2 and incubated with either medium containing 10% fetal bovine serum (FBS), BSA 0.25% alone or BSA 0.25% and 200 μM OA or BSA 0.25%, 200 μM OA and 10 μM mitomycin (Mito) for 48 hr. Images of wound gap were taken at 0 and 48 hr by a digital camera coupled to the microscope and percentage of wound distance was calculated with the camera software. The graph shows the percentage of gap closure at 48 hr compared with time 0. (a) complete gap closure was considered as 100%. Data represent mean values ± SD of triplicate samples of three independent experiments. *p < 0.05; ***p < 0.001. (c) DU‐145 cells were treated with 200 μM OA, 16 nM docetaxel or both the substances for 48 hr. Cell viability was assessed by MTT assay as described in section 2. The results were reported as percentage of viable cells compared to control, considered as maximum viability (100%). Data represent the mean ± SD of triplicate samples of three independent experiments. *p < 0.01

3.2. OA affects PC3 cells viability and response to docetaxel via FFA1/GPR40

As it has been reported that OA can bind FFA1/GPR40 (Briscoe et al., 2003) and that OA can induce breast cancer cells proliferation and protect them from apoptosis (Hardy et al., 2005), we sought to verify whether OA could affect PCa cells proliferation and viability through FFA1/GPR40. To this aim we transiently transfected PC3 cells with shRNA constructs (ShRNA 1–4) specific to FFA1/GPR40 or with a construct containing a scramble sequence with no homology to any known human gene. As shown in Figure 3a, the Sh constructs, except for the case of Sh2, were able to attenuate significantly the expression of FFA1/GPR40, compared to the scramble construct. Next, we performed wound healing experiments on PC3 cells transfected with these constructs. As shown in Figure 3b, PC3 cells transfected with the scramble construct and treated with 200 µM OA for 48 hr, analogously to what observed in parental PC3 cells (Figure 1b), migrated faster toward the wounded area compared to untreated cells. At variance, in PC3 cells transfected with the Sh3 construct, OA was unable to increase the rate of wound closure, suggesting that the effect of OA on wound closure was mediated by FFA1/GPR40. Next, we performed MTT assays on transfected cells. As shown in Figure 3c, PC3 cells transfected with the scramble construct, as expected, showed a significant increase of cell viability following OA treatment and a significant reduction of cell viability, when treated with docetaxel. Again, analogously to what observed in parental PC3 cells, when docetaxel treatment was performed in the presence of OA, the effect of the drug on cells viability was lost (Figure 3c). Intriguingly, OA failed to improve cells viability when FFA1/GPR40 expression was attenuated by the transfection of the FFA1/GPR40 specific construct Sh3 (Figure 3c), suggesting that FFA1/GPR40 might mediate the pro‐proliferative action of OA in PC3 cells. Moreover, the attenuation of FFA1/GPR40 expression restored cells sensitivity to docetaxel treatment in the presence of OA, as cells viability was comparable to that of cells treated with docetaxel alone (Figure 3c), suggesting that FFA1/GPR40 might play a role in the response to docetaxel in the presence of OA in PC3 cells.

Figure 3.

Figure 3

Open in a new tab

The silencing of FFA1/GPR40 prevents OA effects on both proliferation and response to docetaxel treatment. (a) PC3 cells were transiently transfected with short hairpin‐RNA constructs either containing a scramble sequence or a sequence specific to FFA1/GPR40 (Sh1‐4) as described in section 2. After 48 hr, total protein extracts were obtained and Western blot experiments were performed as described in section 2. Tubulin was used as a loading control. Data represent the mean ± SD of three independent experiments. **p < 0.01. B. PC3 cells were transiently transfected with short hairpin‐RNA constructs either containing a scramble sequence or a sequence specific to FFA1/GPR40 (Sh3) as described in section 2. Confluent monolayers were wounded by manually scratching and incubated with either medium containing 10% fetal bovine serum (FBS), or BSA 0.25% alone or BSA 0.25% and 200 μM OA or BSA 0.25%, 200 μM OA and 10 μM mitomycin (Mito) for 48 hr. Images of wound gap were taken at 0 and 48 hr by a digital camera coupled to the microscope and percentage of wound distance was calculated with the camera software. The graph shows the percentage of gap closure at 48 hr compared with time 0. A complete gap closure was considered as 100%. Data represent mean values ± SD of triplicate samples of three independent experiments. *p < 0.05. C. PC3 cells were transiently transfected with short hairpin‐RNA constructs either containing a scramble sequence or a sequence specific to FFA1/GPR40 (Sh3) as described in section 2. After 48 hr cells were left untreated or treated with 200 μM OA, 16 nM docetaxel or both the substances for 48 hr. Data represent the mean ± SD of triplicate samples of three independent experiments. *p < 0.05; ***p < 0.001

3.3. OA increases [Ca2+]i in PC3 cells via FFA1/GPR40

As OA has been described to determine a rapid increase of [Ca2+]i through FFA1/GPR40 activation (Yonezawa, Katoh, & Obara, 2004), we sought to evaluate whether OA was capable to exert a similar action on PC3 cells. As shown in Figure 4, the administration of OA in a Normal Krebs solution induced a rapid peak of [Ca2+]i that was followed by a subsequent [Ca2+]i increase in PC3 cells transfected with the scramble sequence and loaded with Fura 2‐AM. While the initial peak was abrogated by FFA1/GRP40 knocking down produced by Sh3 transfection, the second increase was due to the activation of store‐operated currents (SOC). Accordingly, the SOC inhibitor SKF 96365 reduced OA‐induced second [Ca2+]i peak, when perfused on the plateau phase of the peak and prevented SOC activation, when preincubated to the cells (Figure 4). Furthermore, shRNA against FFA1/GPR40 prevented the second [Ca2+]i peak elicited by OA in PC3 cells, thus underlying the link between FFA1/GPR40‐induced Ca2+ release from the endoplasmic reticulum and SOC activation.

Figure 4.

Figure 4

Open in a new tab

OA induces an increase of [Ca2+]i via FFA1/GPR40. (a) Representative single traces of the effect of OA (200 μM) on [Ca2+]i in the presence or absence of the construct specific to FFA1/GPR40 (Sh3) and its scrambled sequence (Scramble) or SKF 96365 (100 μM). In the first trace, SKF 96365 has been added to the plateau phase of [Ca2+]i whereas in the last trace, SKF 96365 was preincubated 5′ before OA addition. (b and c) represent the quantification of OA‐induced [Ca2+]i increases as the percentage increase over the basal level for peak 1 and peak 2, respectively. Each trace is representative of ∼30 cells recorded in three different experiments. *p < 0.05 versus basal values of [Ca2+]i; **p < 0.05 versus OA and OA + scramble

3.4. OA induces PI3K/Akt pathway activation

As it has been described that OA is able to induce, besides a rapid and transient rise in cytosolic Ca2+, also an increase in Akt phosphorylation (Hardy et al., 2005), we sought to verify whether OA activated the PI3K/Akt pathway in our cellular system. To this aim, we treated PC3 cells, previously transfected with scramble construct, with 200 µM OA for different times. As shown in Figure 5, OA‐induced Akt phosphorylation, which increased more than twofold during the first 15 min of treatment, peaked at 30 min and then slowly declined. Intriguingly, the attenuation of FFA1/GPR40 expression by transfecting PC3 cells with the Sh3 construct was able to prevent Akt phosphorylation by OA (Figure 5), suggesting that OA induced the PI3K/Akt pathway activation via FFA1/GPR40. It has been recently described that increased FFA levels can affect clear cell renal cell carcinoma proliferation through β‐catenin stabilization (Kim et al., 2015). However, we did not observe the increase of β‐catenin following OA treatment in our cellular system (Supplementary Figure S1).

Figure 5.

Figure 5

Open in a new tab

OA induces PI3K/Akt pathway activation in PC3 cells via FFA1/GPR40. (a) PC3 cells were transiently transfected with short hairpin‐RNA constructs either containing a scramble sequence or a sequence specific to FFA1/GPR40 (Sh3) as described in section 2. After 48 hr, cells were serum‐starved for 16 hr and treated or not with 200 μM OA for the indicated times. Total protein extracts were obtained and Western blot experiments were performed as described in section 2. Graphs show protein expression levels normalized for 14.3.3 content. Values shown represent the mean (±s.d.) of three independent experiments. *p < 0.05; **p < 0.01

3.5. FFA1/GPR40 is overexpressed in PCa

As OA appeared to both improve viability and confer resistance to docetaxel in highly malignant PC3 cells through FFA1/GPR40, we hypothesized that FFA1/GPR40 expression might be deregulated in PCa tissues. To this aim, we performed Real‐Time RT‐PCR experiments on benign prostatic hyperplasia (C), low grade (LG) and high grade (HG) carcinoma tissues (Table 1). As shown in Figure 6a, the expression of FFA1/GPR40 is increased in both LG and HG even if only in HG PCa tissues the increase was statistically significant. Finally, to get informations about the expression and cellular localization of the protein, an immunofluorescence analysis was performed. As shown in Figure 6b, FFA1/GPR40 was slightly expressed in the prostatic epithelial of benign prostatic hyperplasia tissues (b2 and b5) whereas it was moderately expressed in LG PCa (b9 and b12) and highly expressed in HG PCa (b16 and b19), particularly with a cytoplasmic membrane localization, suggesting that FFA1/GPR40 expression might be upregulated in PCa tissues, in particular in less differentiated tumors.

Figure 6.

Figure 6

Open in a new tab

FFA1/GPR40 mRNA expression is increased in PCa tissues. (a) Total RNA was extracted from the formalin‐fixed paraffin‐embedded benign prostatic hyperplasia C, LG carcinomas and HG carcinomas (Table 1). Real‐Time RT‐PCR experiments were performed using oligonucleotides specific to FFA1/GPR40 and GAPDH as described in section 2. Values shown represent the mean (±s.d.) of triplicate samples of three independent experiments. **p < 0.01. (b) Representative image showing immunofluorescence experiments on tissue sections of benign prostatic hyperplasia (b1–b7), LG PCa (b8–b14), and HG PCa (b15–b21). In (b1, b8, and b15) the different tissues are stained with hematoxylin/eosin (H/E). FFA1/GPR40 is stained in green (b2, b5, b9, b12, b16, b19) by anti‐FFA1/GPR40 antibodies. Nuclei are stained in blue by HOECHST 33258 (b3, b6, b10, b13, b17, b20). Merge is shown in (b4, b7, b11, b14, b18, b21). White square in (b4, b11, b18) represent the enlarged area showed in (b5–b7, b12–b14, b19–b21), respectively. Scale bars on panels (b1), (b8), and (b15) measure 100 μm length; on panels (b2–b4, b9–b11, and b16–b18) 50 μm; on panels (b5–b7, b12–b14, and b19–b21) 10 μm

4. DISCUSSION

A great number of studies has firmly established an association between obesity and a poorer prognosis of prostate cancer (Khandekar, Cohen, & Spiegelman, 2011). Several common denominators potentially linking obesity and prostate cancer have been identified and include alterations in insulin/IGF‐1 axis, modulation of hormone levels including testosterone, activity of adipokines and inflammatory state (Felber & Golay, 2002). Conversely, despite the fact that obesity is associated with an increased FFAs availability (Felber & Golay, 2002), little is known about the roles of FFARs in mediating effects of FFAs in PCa cells. In this study we sought to evaluate the effect of OA, one of the most prevalent FFA in human plasma, on the malignant phenotype of PCa cells. Here we show that OA increases significantly proliferation of both PC3 and DU‐145 cells. OA has been described to exert a mitogenic effect on MDA‐MB‐231 breast cancer cells (Hardy, Langelier, & Prentki, 2000; Hopkins & Meier, 2017). However, in these studies, the authors did not evaluate whether OA was also able to affect the invasive phenotype of breast cancer cells. OA has been reported also to promote head and neck squamous cell carcinoma metastasis through the activation of the Akt/NF‐κB pathway (Chan, Tsai, Shen, Liao, & Chen, 2017). In our study, however, we did not observe a significant effect of OA on PC3 and DU‐145 cell migration. The apparent increase in the cell migration rate was mainly due by the increase of cell growth. The presence of mitomycin, an inhibitor of cell proliferation, was indeed sufficient to prevent OA effect on cell migration. We rather observed that OA had a dramatic effect on the decline of cell viability of PC3 and DU‐145 cells caused by docetaxel, the first‐line chemotherapeutic agent for the treatment of androgen‐independent PCa, as the viability of cells treated with this drug in the presence of OA was comparable to untreated cells. Thus, OA appeared to confer a more aggressive phenotype to PCa cells, at least in terms of cell proliferation and resistance to docetaxel. We hypothesized that these effects could be mediated by members of the FFARs family able to bind long chain FFAs, including OA, such as FFA1/GPR40 or FFA4/GPR120. As FFA4/GPR120 has been described to mediate prevalently inhibition signals (Hopkins et al., 2016; Liu et al., 2015), we focused our study on the role of FFA1/GPR40. Intriguingly, we observed that the inhibition of FFA1/GPR40 expression by using specific shRNA constructs was capable to prevent the increase of PC3 cells proliferation caused by OA, similarly to what described for breast cancer cells (Hopkins & Meier, 2017; Kwan et al., 2014). Furthermore, the inhibition of FFA1/GPR40 protein expression was also able to restore PC3 sensitivity to docetaxel suggesting that also this effect might be mediated by FFA1/GPR40. GPR40/FFA1 activation has been reported, indeed, to protect human renal proximal tubule epithelial cells from cisplatin‐induced apoptosis (Ma et al., 2014), suggesting a role for this receptor also in chemo‐resistance processes. Furthermore, FFA1/GPR40 has been reported to positively regulate malignant properties of lung cancer cells (Kita et al., 2016). However, in this study, the effect of FFAs has not been evaluated. This receptor has been the first FFAR to be identified as a long‐chain fatty acid receptor (Mancini & Poitout, 2013). FFA1/GPR40 expression has been described to be predominantly expressed in pancreatic beta cells (Mancini & Poitout, 2013) and for this reason the interest in FFA1/GPR40 as a possible target for the treatment of metabolic diseases such as diabetes has rapidly increased. FFA1/GPR40 stimulation by FFAs is able, indeed, to enhance glucose‐stimulated insulin secretion (GSIS) (Mancini & Poitout, 2013). Consequently, inhibition of FFA1/GPR40 expression or function resulted in a significant decrease in FFA potentiation of GSIS (Mancini & Poitout, 2013). The mechanisms linking FFAs activation of GPR40/FFA1 are only partially understood. GPR40/FFA1, as a classical 7‐transmembranre receptor, couples to the G protein subunit Gaq/11, which in turn is predicted to catalyze phospholipase C (PLC)‐mediated hydrolysis of phosphatidylinositol 4,5‐bisphosphate into diacylglycerol (DAG) and inositol triphosphate (IP3). DAG and IP3 subsequently serve as second messenger molecules to activate protein kinase C (PKC) and mobilize ER Ca2+ stores, respectively (Mancini & Poitout, 2013). Thus, we hypothesized that OA could mobilize ER Ca2+ stores in our cellular system via FFA1/GPR40 stimulation. We show, indeed, that OA causes a rapid increase of [Ca2+]i originated from intracellular Ca2+ stores that was followed by store‐operated Ca2+ entry. This second peak was dependent from the first one, as the SOC inhibitor SKF 96365 reduced OA‐induced second Ca2+ peak. Observed Ca2+ oscillations following OA treatment were mediated by FFA1/GPR40, as they were dramatically decreased when FFA1/GPR40 expression was inhibited. SOCE induction could be particularly relevant for PCa cells proliferation. Up‐regulation of SOCE has been reported, indeed, to promote the proliferation in many types of cells, including normal cells, such as endothelial progenitor cells (Lodola et al., 2012; Shi et al., 2010), human aortic smooth muscle cells (hASMCs) and human umbilical endothelial cells (Baryshnikov, Pulina, Zulian, Linde, & Golovina, 2009), as well as tumor cells, such as hepatic cell carcinoma (El Boustany et al., 2008). Furthermore, we report that OA‐induced [Ca2+]i increase is associated to PI3K/Akt pathway activation, as demonstrated by the increase of S473 Akt phosphorylation levels, a known substrate of mTORC2 activity (Chan et al., 2014). Intriguingly, the inhibition of FFA1/GPR40 expression prevented Akt phosphorylation. Akt controls cell cycle progression and is well known to participate in cell proliferation and survival (Brazil, Yang, & Hemmings, 2004). Furthermore, OA has been described to activate the PI3K/Akt pathway, to promote proliferation and to reduce apoptosis of MDA‐MB‐231 breast cancer cells (Hardy et al., 2005). Thus, [Ca2+]i increase and PI3K/Akt pathway activation appear to be both mediated by FFA1/GPR40 activation and might play a role not only in proliferation but also in protection of PC3 cells from docetaxel effects. However, not necessarily [Ca2+]i increase and PI3K/Akt pathway activation should be causally related. It has been hypothesized, indeed, that GPR40/FFA1 activation might also engage pathways other than the aforementioned Gαq/11/PLC/PKC/Ca2+ cascade, such as G protein‐independent, β‐arrestin‐dependent pathways to promote the activation of different and potentially crosstalking signaling pathways, such as ERK1/2, NF‐κB, and PI3K/Akt in a ligand‐ and context‐dependent manner (Whalen, Rajagopal, & Lefkowitz, 2011). This aspect is currently under investigation in our laboratory. Another signaling pathway that has been reported to be activated by FFAs is that involving β‐catenin stabilization (Kim et al., 2015). However, we did not observe the increase of β‐catenin following OA treatment in our cellular system . Finally, we show that FFA1/GPR40 expression is increased in PCa tissues, particularly in those with Gleason score 8–10 (HG). This could be relevant, particularly in obese subjects that have increased circulating FFAs levels, potentially promoting PCa growth and aggressiveness. Thus, FFA1/GPR40 might represent both a new prognostic factor and a molecular target for the treatment of advanced PCa. Further studies are currently ongoing in our laboratory trying to establish the role of FFA1/GPR40 in PCa progression in the obese patient.

5. STATISTICAL ANALYSIS

Unless otherwise indicated, data were analysed with Statview software (Abacus Concepts, Piscataway, NJ) by one‐factor analysis of variance. p < 0.05 was considered statistically significant.

Supporting information

Additional Supporting Information may be found online in the supporting information tab for this article.

Fig. S1. OA treatment does not affect β‐catenin stability in PC3 and DU‐145 cells.

JCP-233-7367-s001.doc (457KB, doc)

ACKNOWLEDGMENTS

This study was funded by the European Foundation for the Study of Diabetes (EFSD), by the Ministero dell'Istruzione, Università e della Ricerca Scientifica (grants PRIN and FIRB MERIT, and PON 01_02460 and POR Campania Bioscience) and by the Società Italiana di Diabetologia (SID‐FO.DI.RI) and in part by Federico II University of Naples Grant, CUP E62F17000060001. Dr Antonietta Liotti was fellowship granted by the Italian Diabete Ricerca Foundation and Merck Sharp and Dohme Italy. The authors thank Antonio D'Andrea for excellent technical assistance.

Liotti A, Cosimato V, Mirra P, et al. Oleic acid promotes prostate cancer malignant phenotype via the G protein‐coupled receptor FFA1/GPR40. J Cell Physiol. 2018;233: 7367–7378. 10.1002/jcp.26572

Antonietta Liotti and Vincenzo Cosimato equally contributed to the study.

Contributor Information

Luigi Insabato, Email: g.insabato@gmail.com.

Luca Ulianich, Email: lulianic@unina.it.

REFERENCES

  1. Armstrong, C. M. , & Gao, A. C. (2015). Drug resistance in castration resistant prostate cancer: Resistance mechanisms and emerging treatment strategies. American Journal of Clinical and Experimental Urology, 3, 64–76. [PMC free article] [PubMed] [Google Scholar]
  2. Baryshnikov, S. G. , Pulina, M. V. , Zulian, A. , Linde, C. I. , & Golovina, V. A. (2009). Orai1, a critical component of store‐operated Ca2+ entry, is functionally associated with Na+/Ca2+ exchanger and plasma membrane Ca2+ pump in proliferating human arterial myocytes. American Journal of Physiology Cell Physiology, 297, C1103–C1112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bifulco, G. , Miele, C. , Di Jeso, B. , Beguinot, F. , Nappi, C. , Di Carlo, C. , … Ulianich, L. (2012). Endoplasmic reticulum stress is activated in endometrial adenocarcinoma. Gynecologic Oncology, 125(1), 220–225. [DOI] [PubMed] [Google Scholar]
  4. Brazil, D. P. , Yang, Z. Z. , & Hemmings, B. A. (2004). Advances in protein kinase B signalling: AKTion on multiple fronts. Trends in Biochemical Sciences, 29, 233–242. [DOI] [PubMed] [Google Scholar]
  5. Briscoe, C. P. , Tadayyon, M. , Andrews, J. L. , Benson, W. G. , Chambers, J. K. , Eilert, M. M. , … Muir, A. I. (2003). The orphan G protein‐coupled receptor GPR40 is activated by medium and long chain fatty acids. The Journal of Biological Chemistry, 278(13), 11303–11311. [DOI] [PubMed] [Google Scholar]
  6. Brown, E. M. , & MacLeod, R. J. (2001). Extracellular calcium sensing and extracellular calcium signaling. Physiological Reviews, 81(1), 239–297. [DOI] [PubMed] [Google Scholar]
  7. Brown, M. D. , Hart, C. , Gazi, E. , Gardner, P. , Lockyer, N. , & Clarke, N. (2010). Influence of omega‐6 PUFA arachidonic acid and bone marrow adipocytes on metastatic spread from prostate cancer. British Journal of Cancer, 102, 403–413. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Calì, G. , Insabato, L. , Conza, D. , Bifulco, G. , Parrillo, L. , Mirra, P. , … Ulianich, L. (2014). GRP78 mediates cell growth and invasiveness in endometrial cancer. Journal of Cellular Physiology, 229(10), 1417–1426. [DOI] [PubMed] [Google Scholar]
  9. Chan, C. H. , Jo, U. , Kohrman, A. , Rezaeian, A. H. , Chou, P. C. , Logothetis, C. , & Lin, H. K. (2014). Posttranslational regulation of Akt in human cancer. Cell & Bioscience, 4(1), 59. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Chan, S. H. , Tsai, J. P. , Shen, C. J. , Liao, Y. H. , & Chen, B. K. (2017). Oleate‐induced PTX3 promotes head and neck squamous cell carcinoma metastasis through the up‐regulation of vimentin. Oncotarget, 8(25), 41364–41378. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Chen, Z. , Zhang, Y. , Jia, C. , Wang, Y. , Lai, P. , Zhou, X. , … Bai, X. (2014). MTORC1/2 targeted by n‐3 polyunsaturated fatty acids in the prevention of mammary tumorigenesis and tumor progression. Oncogene, 33, 4548–4557. [DOI] [PubMed] [Google Scholar]
  12. Cui, W. , Chen, S. L. , & Hu, K. Q. (2010). Quantification and mechanisms of oleic acid‐induced steatosis in HepG2 cells. American Journal of Translational Research, 2, 95–104. [PMC free article] [PubMed] [Google Scholar]
  13. El Boustany, C. , Bidaux, G. , Enfissi, A. , Delcourt, P. , Prevarskaya, N. , & Capiod, T. (2008). Capacitative calcium entry and transient receptor potential canonical 6 expression control human hepatoma cell proliferation. Hepatology, 47, 2068–2077. [DOI] [PubMed] [Google Scholar]
  14. Felber, J. , & Golay, A. (2002). Pathways from obesity to diabetes. International Journal of Obesity and Related Metabolic Disorders, 26(Suppl 2), S39. [DOI] [PubMed] [Google Scholar]
  15. Ferlay, J. , Soerjomataram, I. , Ervik, M. , Dikshit, R. , Eser, S. , Mathers, C. , … Bray, F. GLOBOCAN 2012 v1.0, Cancer Incidence and Mortality Worldwide: IARC CancerBase No. 11 [Internet]. Lyon, France: International Agency for Research on Cancer; 2013. Available from: http://globocan.iarc.fr, accessed on day/month/year.
  16. Fesinmeyer, M. D. , Gulati, R. , Zeliadt, S. , Weiss, N. , Kristal, A. R. , & Etzioni, R. (2009). Effect of population trends in body mass index on prostate cancer incidence and mortality in the United States. Cancer Epidemiology, Biomarkers and Prevention, 18, 808. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Francini, E. , & Sweeney, C. J. (2016). Docetaxel activity in the era of life‐prolonging hormonal therapies for metastatic castration‐resistant prostate cancer. European Urology, 70, 410–412. [DOI] [PubMed] [Google Scholar]
  18. Freedland, S. J. , & Aronson, W. J. (2005). Obesity and prostate cancer. Urology, 65, 433–439. [DOI] [PubMed] [Google Scholar]
  19. Grynkiewicz, G. , Poenie, M. , & Tsien, R. Y. (1985). A new generation of Ca2+ indicators with greatly improved fluorescence properties. The Journal of Biological Chemistry, 260(6), 3440–3450. [PubMed] [Google Scholar]
  20. Hagen, R. M. , Rhodes, A. , & Ladomery, M. R. (2013). Conjugated linoleate reduces prostate cancer viability whereas the effects of oleate and stearate are cell line‐dependent. Anticancer Research, 33(10), 4395–4400. [PubMed] [Google Scholar]
  21. Hardy, S. , Langelier, Y. , & Prentki, M. (2000). Oleate activates phosphatidylinositol 3‐kinase and promotes proliferation and reduces apoptosis of MDA‐MB‐231 breast cancer cells, whereas palmitate has opposite effects. Cancer Res, 60, 6353–6358. [PubMed] [Google Scholar]
  22. Hardy, S. , El‐Assaad, W. , Przybytkowski, E. , Joly, E. , Prentki, M. , & Langelier, Y. (2003). Saturated fatty acid‐induced apoptosis in MDA‐MB‐231 breast cancer cells. A role for cardiolipin. The Journal of Biological Chemistry, 278, 31861–31870. [DOI] [PubMed] [Google Scholar]
  23. Hardy, S. , St‐Onge, G. G. , Joly, E. , Langelier, Y. , & Prentki, M. (2005). Oleate promotes the proliferation of Breast cancer cells via the G protein‐coupled receptor GPR40. The Journal of Biological Chemistry, 280(14), 13285–13291. [DOI] [PubMed] [Google Scholar]
  24. Hopkins, M. M. , & Meier, K. E. (2017). Free fatty acid receptors and cancer: From nutrition to pharmacology. Handbook of Experimental Pharmacology, 236, 233–251. [DOI] [PubMed] [Google Scholar]
  25. Hopkins, M. M. , Zhang, Z. , Liu, Z. , & Meier, K. E. (2016). Eicosopentaneoic acid and other free fatty acid receptor agonists inhibit lysophosphatidic acid‐ and epidermal growth factor‐induced proliferation of breast cancer cells. Journal of Clinical Medicine, 5(2), E16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Houthuijzen, J. M. (2016). For better or worse: FFA1 and FFA4 signaling in cancer and diabetes. Molecular Pharmacology, 90(6), 738–743. [DOI] [PubMed] [Google Scholar]
  27. Howlader, N. , Noone, A. M. , Krapcho, M. , Garshell, J. , Miller, D. , Altekruse, S. F. , … Cronin, K. A. (eds). SEER Cancer Statistics Review, 1975‐2012, National Cancer Institute. Bethesda, MD, http://seer.cancer.gov/csr/1975_2012/, based on November 2014 SEER data submission, posted to the SEER web site, April 2015.
  28. Hughes‐Fulford, M. , Chen, Y. , & Tjandrawinata, R. R. (2001). Fatty acid regulates gene expression and growth of human prostate cancer PC‐3 cells. Carcinogenesis, 22, 701–707. [DOI] [PubMed] [Google Scholar]
  29. Humphrey, P. A. , Moch, H. , Cubilla, A. L. , Ulbright, T. M. , & Reuter, V. E. (2016). The 2016 WHO classification of tumours of the urinary system and male genital organs‐part b: Prostate and bladder tumours. European Urology, 70(1), 106–119. [DOI] [PubMed] [Google Scholar]
  30. Khandekar, M. J. , Cohen, P. , & Spiegelman, B. M. (2011). Molecular mechanisms of cancer development in obesity. Nature Reviews. Cancer, 11(12), 886–895. [DOI] [PubMed] [Google Scholar]
  31. Kim, H. , Rodriguez‐Navas, C. , Kollipara, R. K. , Kapur, P. , Pedrosa, I. , Brugarolas, J. , … Ye, J. (2015). Unsaturated fatty acids stimulate tumor growth through stabilization of beta‐catenin. Cell Reports, 13, 496–503. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Kita, T. , Kadochi, Y. , Takahashi, K. , Fukushima, K. , Yamasaki, E. , Uemoto, T. , … Tsujiuchi, T. (2016). Diverse effects of G‐protein‐coupled free fatty acid receptors on the regulation of cellular functions in lung cancer cells. Experimental Cell Research, 342(2), 193–199. [DOI] [PubMed] [Google Scholar]
  33. Kositsawat, J. , Flanigan, R. C. , Meydani, M. , Choi, Y. K. , & Freeman, V. L. (2007). The ratio of oleic‐to‐stearic acid in the prostate predicts biochemical failure after radical prostatectomy for localized prostate cancer. Journal of Urology, 178, 2391–2396. [DOI] [PubMed] [Google Scholar]
  34. Kushi, L. , & Giovannucci, E. (2002). Dietary fat and cancer. American Journal of Medicine, 113, 63S–73S. [DOI] [PubMed] [Google Scholar]
  35. Kwan, H. Y. , Fu, X. , Liu, B. , Chao, X. , Chan, C. L. , Cao, H. , … Yu, Z. L. (2014). Subcutaneous adipocytes promote melanoma cell growth by activating the Akt signaling pathway. The Journal of Biological Chemistry, 289, 30525–30537. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Liao, J. , Schneider, A. , Datta, N. S. , & McCauley, L. K. (2006). Extracellular calcium as a candidate mediator of prostate cancer skeletal metastasis. Cancer Res, 66(18), 9065–9073. [DOI] [PubMed] [Google Scholar]
  37. Lin, J. Z. , Wang, Z. J. , De, W. , Zheng, M. , Xu, W. Z. , Wu, H. F. , … Zhu, J. G. (2017). Targeting AXL overcomes resistance to docetaxel therapy in advanced prostate cancer. Oncotarget, 8(25), 41064–41077. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Liu, Y. , Zuckier, L. S. , & Ghesani, N. V. (2010). Dominant uptake of fatty acid over glucose by prostate cells: A potential new diagnosticand therapeutic approach. Anticancer Research, 30, 369–374. [PubMed] [Google Scholar]
  39. Liu, Z. , Hopkins, M. M. , Zhang, Z. , Quisenberry, C. B. , Fix, L. C. , Galvan, B. M. , & Meier, K. E. (2015). Omega‐3 fatty acids and other FFA4 agonists inhibit growth factor signaling in human prostate cancer cells. Journal of Pharmacology and Experimental Therapeutics, 352(2), 380–394. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Lo, J. C. Y. , Clark, A. K. , Ascui, N. , Frydenberg, M. , Risbridger, G. P. , Taylor, R. A. , & Watt, M. J. (2016). Obesity does not promote tumorigenesis of localized patient derived prostate cancer xenografts. Oncotarget, 7(30), 47650–47662. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Lodola, F. , Laforenza, U. , Bonetti, E. , Lim, D. , Dragoni, S. , Bottino, C. , … Porta, C. (2012). Store‐operated Ca2+ entry is remodelled and controls in vitro angiogenesis in endothelial progenitor cells isolated from tumoral patients. PLoS ONE, 7(9), 42541. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Ma, S. K. , Joo, S. Y. , Choi, H. I. , Bae, E. H. , Nam, K. I. , Lee, J. , & Kim, S. W. (2014). Activation of G‐protein‐coupled receptor 40 attenuates the cisplatin‐induced apoptosis of human renal proximal tubule epithelial cells. International Journal of Molecular Medicine, 34(4), 1117–1123. [DOI] [PubMed] [Google Scholar]
  43. Mancini, A. D. , & Poitout, V. (2013). The fatty acid receptor FFA1/GPR40 a decade later: How much do we know? Trends in Endocrinology & Metabolism, 24(8), 398–407. [DOI] [PubMed] [Google Scholar]
  44. Miglietta, A. , Bozzo, F. , Bocca, C. , Gabriel, L. , Trombetta, A. , Belotti, S. , & Canuto, R. A. (2006). Conjugated linoleic acid induces apoptosis in MDA‐MB‐231 breast cancer cells through ERK/MAPK signalling and mitochondrial pathway. Cancer Letters, 234, 149–157. [DOI] [PubMed] [Google Scholar]
  45. Pandalai, P. K. , Pilat, M. J. , Yamazaki, K. , Naik, H. , & Pienta, K. J. (1996). The effects of omega‐3 and omega‐6 fatty acids on in vitro prostate cancer growth. Anticancer Research, 16, 815–820. [PubMed] [Google Scholar]
  46. Persad, R. A. , Gillatt, D. A. , Heinemann, D. , Habib, N. A. , & Smith, P. J. (1990). Erythrocyte stearic to oleic acid ratio in prostatic carcinoma. British Journal of Urology, 65, 268–270. [DOI] [PubMed] [Google Scholar]
  47. Satia‐Abouta, J. , Patterson, R. E. , Schiller, R. N. , & Kristal, A. R. (2002). Energy from fat is associated with obesity in U.S. men: Results from the prostate cancer prevention trial. Preventive Medicine, 34, 493–501. [DOI] [PubMed] [Google Scholar]
  48. Secondo, A. , Staiano, R. I. , Scorziello, A. , Sirabella, R. , Boscia, F. , Adornetto, A. , … Annunziato, L. (2007). BHK cells transfected with NCX3 are more resistant to hypoxia followed by reoxygenation than those transfected with NCX1 and NCX2: Possible relationship with mitochondrial membrane potential. Cell Calcium, 42(6), 521–535. [DOI] [PubMed] [Google Scholar]
  49. Shi, Y. , Song, M. , Guo, R. , Wang, H. , Gao, P. , Shi, W. , & Huang, L. (2010). Knockdown of stromal interaction molecule 1 attenuates hepatocyte growth factor‐induced endothelial progenitor cell proliferation. Experimental Biology and Medicine (Maywood), 235, 317–325. [DOI] [PubMed] [Google Scholar]
  50. Soto‐Guzman, A. , Navarro‐Tito, N. , Castro‐Sanchez, L. , Martinez‐Orozco, R. , & Salazar, E. P. (2010). Oleic acid promotes MMP‐9 secretion and invasion in breast cancer cells. Clinical and Experimental Metastasis, 27, 505–515. [DOI] [PubMed] [Google Scholar]
  51. Wang, X. , Bai, H. , Zhang, X. , Liu, J. , Cao, P. , Liao, N. ,… Hai, C. (2013). Inhibitory effect of oleanolic acid on hepatocellular carcinoma via ERK‐p53‐mediated cell cycle arrest and mitochondrial‐dependent apoptosis. Carcinogenesis, 34, 1323–1330. [DOI] [PubMed] [Google Scholar]
  52. Whalen, E. J. , Rajagopal, S. , & Lefkowitz, R. J. (2011). Therapeutic potential of beta‐arrestin‐ and G protein‐biased agonists. Trends in Molecular Medicine, 17, 126–139. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Yonezawa, T. , Katoh, K. , & Obara, Y. (2004). Existence of GPR40 functioning in a human breast cancer cell line MCF‐7. Biochemical and Biophysical Research Communications, 314, 805–809. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Additional Supporting Information may be found online in the supporting information tab for this article.

Fig. S1. OA treatment does not affect β‐catenin stability in PC3 and DU‐145 cells.

JCP-233-7367-s001.doc (457KB, doc)

Articles from Journal of Cellular Physiology are provided here courtesy of Wiley

RESOURCES