Abstract
In bone remodeling, osteoclasts are recruited via increased production of RANKL (receptor activator of nuclear factor‐κB ligand) and migrate to the bone surface, aided by matrix metalloproteinases (MMPs). NAMPT (nicotinamide phosphoribosyl transferase), which catalyzes the rate‐limiting step in the NAD+ salvage pathway, increases during in vitro osteogenic differentiation and inhibits RANKL‐induced osteoclast differentiation. Alveolar bone loss, due to disturbance of the remodeling process, is a major feature of periodontitis. Thus, we investigated the role of NAMPT in a synchronized alveolar bone remodeling rat model. NAMPT expression increased in osteogenic cells during the remodeling activation phase, in parallel with RANKL and MMP‐2 expression. Inhibition of NAMPT activity, by systemic delivery of its selective inhibitor FK866, decreased the recruitment of osteoclasts, but not their activity. In vitro, NAMPT mRNA, and protein expression also increased during osteoblast differentiation in primary calvarial osteoblast cultures. Recombinant NAMPT and NMN, its direct metabolite, dose‐dependently increased bone marker expression, including that of sialoprotein (BSP) and osteocalcin (OC), whereas their expression was inhibited by FK866 treatment. Recombinant NAMPT did not regulate MMP‐2, −9, MMP‐13, or RANKL/OPG mRNA expression in osteoblasts. Our data suggest that de novo NAMPT synthesis in osteoblasts controls cell differentiation through osteoclast recruitment during the activation of bone remodeling.
Keywords: bone remodeling, cell differentiation, MMP, NAMPT, osteoblast
Inhibition of NAMPT enzymatic activity using systemic FK866 delivery decreases osteoclast recruitment in the rat alveolar bone remodeling model.

1. INTRODUCTION
Bone remodeling is the process that continuously removes and replaces damaged bone to maintain the integrity of the adult skeleton and mineral homeostasis. This event involves the coupled activity of osteoclasts, which resorb bone, and osteoblasts, the specialized bone‐forming cells. The bone remodeling sequence, which consists of five successive phases, starts with the activation step. Cells from the osteoblast lineage, especially osteocytes, initiate bone remodeling by increasing the production of receptor activator of nuclear factor‐κB ligand (RANKL) and recruiting osteoclasts (Raggatt & Partridge, 2010). Matrix metalloproteinase (MMP) production allows osteoclast migration to the mineralized bone surface, by eliminating the protective osteoid seam (Blavier & Delaisse, 1995).
NAMPT (nicotinamide phosphoribosyl transferase), also called visfatin, is a ubiquitously expressed enzyme which catalyzes the rate‐limiting step in the NAD+ salvage pathway. The NAMPT coding sequence is highly conserved, suggesting an important function of this gene. Indeed, the NAMPT−/− mouse is embryonically lethal (Fukuhara et al., 2005). NAMPT is reported to be an intra‐ and extra‐cellular protein in mammals. Intracellular NAMPT (iNAMPT) is an essential cofactor for cell metabolism; it regulates the redox system by maintaining the NAD+/NADH ratio and the activity of NAD‐dependent enzymes, such as sirtuin 1 (SIRT1) (Imai & Guarente, 2014). Extra‐cellular NAMPT (eNAMPT) functions as an enzyme, a growth factor, or a pro‐inflammatory cytokine (Garten et al., 2015). Its expression increases in inflammatory diseases that involve bone resorption, such as rheumatoid arthritis, osteoarthritis, and periodontitis (Brentano et al., 2007; Gosset et al., 2008; Laiguillon et al., 2014; Pradeep et al., 2011). The role of NAMPT in bone remodeling, as well as osteoclast and osteoblast differentiation and activity, is still poorly understood. In vitro, iNAMPT expression increases in parallel with osteogenic differentiation of multipotent mouse C3H10T1/2 fibroblasts and MC3T3‐E1 pre‐osteoblasts (Li, He, He, Li, & Lindgren, 2013). In murine primary bone marrow stromal cell cultures, inhibition of NAMPT, either by the specific inhibitor FK866 or after NAMPT siRNA transfection, decreases alkaline phosphatase (ALP) activity and mineralized nodule formation and increases adipocyte differentiation (Li et al., 2011). In addition, recombinant NAMPT induces glucose uptake, proliferation, and type I collagen expression in cultured human osteoblasts (Xie et al., 2007). Recombinant NAMPT inhibits the early stage of osteoclast differentiation during osteoclastogenesis by downregulating early RANKL‐dependent signaling pathways in bone marrow macrophage‐derived osteoclast cultures (Baek et al., 2017).
Alveolar bone is a component of the periodontium, that is, the anchoring tissues of the tooth. This very specialized tissue is highly remodeled in response to masticatory forces (Saffar, Lasfargues, & Cherruau, 1997). Alveolar bone resorption occurs in periodontitis, a highly prevalent chronic inflammatory disease induced by oral bacteria dysbiosis (Hajishengallis, 2015). In periodontitis, inflammation stimulates an increase in the number of bone remodeling sequences, characterized by increased osteoclastogenesis, as well as an uncoupling of bone formation and resorption (Graves, Li, & Cochran, 2011). The role of NAMPT in the pathobiology of the alveolar bone is yet unknown. Here, we explored the role of NAMPT in alveolar bone remodeling using an experimental bone remodeling model in rats. Furthermore, we investigated the consequences of inhibiting NAMPT activity in this model using the selective inhibitor FK866. We also evaluated the role of NAMPT in osteoblastic differentiation in primary cultures of murine calvaria osteoblasts, focusing particularly on MMP expression. Our data show that NAMPT is expressed in osteogenic cells of the alveolar bone periosteum, where it controls osteoclast activation.
2. MATERIALS AND METHODS
All reagents were purchased from Sigma–Aldrich (Lyon, France) unless stated otherwise. Trypsin/EDTA was from Invitrogen (Cergy‐Pontoise, France). FK866 (Selleckchem) and bovine serum albumin (BSA) were from Euromedex (Souffelweyersheim, France). The CellTiter 96® Aqueous One Solution Cell Proliferation Assay was from Promega (Charbonnières‐les‐Bains, France). Recombinant mouse NAMPT (produced in Escherichia coli with residual lipopolysaccharide contamination <500 pg/ml, according to the manufacturers) was from Tebubio (Le Perray en Yvelines, France), Alexis Biochemicals (Paris, France), and US Biologicals (VWR, Fontenay sous Bois, France). The RT Verso cDNA kit was from Life Technologies (Saint‐Aubin, France). IL‐1β was from Peprotech (Neuilly sur Seine, France). The Verso cDNA kit, Fetal calf serum (FCS), αMEM Glutamax medium (Gibco), culture flasks (Falcon), and culture plates (Nunk) were from Thermo Fischer Scientific (Villebon‐sur‐Yvette, France). The Amersham ECL Prime Western Blotting Detection Reagent, Illustra RNA Spin Mini kit, and NanoVue were from GE Healtcare (Life Sciences, Velizy‐Villacoublay, France). The bicinchoninic acid assay (BCA) kit was from Perbio Science for Pierce (Bezons, France). Mini‐Protean® TGX™ gels and Trans‐Blot Transfer Medium were from BioRad (Marne la Coquette, France). Anti‐protease inhibitor cocktail was from Calbiochem, La Jolla, CA. Xylazine, ketamine, and Isoflurane were from Centravet (Maisons Alfort, France). SYBR Green PCR Master Mix and LightCycler LC480 were from Roche Life Sciences (Meylan, France). Alzet pumps (Durect) were from Charles River (Saint‐Germain Nuelles, France). Methylmethacrylate was from Merck (Darmstadt, Germany) and the ABC Vectastain Kit (Vector Laboratories) was purchased from Biovalley (Nanterre, France).
2.1. Experimental model of bone resorption
We used a synchronized model in which localized bone resorption is induced in rats along the periosteal surface of the buccal lower mandibular cortex. Briefly, the extraction of upper maxillary molars in rats causes lower right mandibular molar egress. As a result, a non‐traumatic, localized synchronous resorption sequence is triggered along the periosteal surface of the buccal lower mandibular cortex (Figure 1) (Baron et al., 1986; Tran Van et al., 1982). The periosteum is divided into two layers: an osteogenic compartment (approximately 65 μm thick) close to the bone and a non‐osteogenic compartment located behind, more distant from the bone surface (Cherruau, Facchinetti, Baroukh, & Saffar, 1999). The timing of resorption was determined as follows: monocyte (= osteoclast precursor) recruitment peaks 12 hr and osteoclastic resorption 4 days after induction (Baroukh, Cherruau, Dobigny, Guez, & Saffar, 2000).
Figure 1.

The synchronized alveolar bone remodeling model. Extraction of the upper jaw maxillary molars leads to egression of the opposing molars on the mandible. A localized synchronous resorption sequence is triggered along the periosteal surface of the buccal lower mandibular cortex. The events of bone remodeling are studied in an area localized to the first molar, from the distal face of the mesial root to the mesial face of the distal root
Thirty adult male Wistar rats (Janvier, Le Genest Saint Isle, France) weighing 200 ± 20 g were used. They were fed a standard rodent diet (M25 Extralabo; U.A.R., Villemoisson, France); food and water were given ad libitum. The animals were maintained in a temperature‐controlled (25 °C) facility with a 12‐hr light/dark cycle. Rats were anesthetized with xylazine (100 mg/kg bw) and ketamine (80 mg/kg bw) injected intraperitoneally, and their right maxillary molars extracted. Groups of six rats were killed at baseline, 12, 18, 24, 48, 72, and 96 hr after molar extraction. Chemical methods were used for euthanizing the rats according to the ethical protocol approved by the Animal Care Committee of the French Veterinary Services (DPP Haut de Seine, France: agreement number C‐9204901). Animals were used in compliance with European Union recommendations on laboratory animal care. All experiments were performed according to protocols approved by the Paris Descartes University ethics committee (approval number CEEA34.MG.036.12) and complied with the European Union recommendations for laboratory animal care (decree 87‐848–04/19/1987).
2.2. In vivo inhibition of NAMPT
NAMPT activity was inhibited by systemic delivery of its specific inhibitor FK866. Two days before molar extraction, rats were anesthetized with Isoflurane. Alzet pumps® (2ML1 model), loaded with either vehicle or FK866, were subcutaneously implanted in the back (n = 6), according to the protocol described by Evans et al. (2011). Osmotic pumps allowed continuous and regular systemic delivery of NAMPT inhibitor at a rate of 20 μg/kg/hr throughout the experimental period. This rate was determined in a pilot experiment. No adverse effects, modification of rat behavior, or weight loss were noticed. Rats were killed at the peak of osteoclast recruitment, that is, 4 days after tooth extraction.
2.3. Sample processing
After killing the rats, the right hemi‐mandibles were dissected out and fixed in either cold (4 °C) 4% paraformaldehyde or cold (4 °C) 70% ethanol. After dehydration, they were embedded, without demineralization, in methylmethacrylate and polymerized at −20 °C for 48 hr. They were cut perpendicular to the molar root axis using a Polycut E microtome (Leica, Wetzlar, Germany). Serial sections (4 μm thick) were taken from the top of the crest of the alveolar process in the zone of resorption.
2.4. Immunochemistry
The sections were incubated with monoclonal antibodies against NAMPT (Adipogen, Incheon, South Korea, AG‐20A‐0034, 1:250, room temperature [RT]) or MMP‐2 (Abcam, Cambridge, UK, ab37150, 1:100, 4 °C), or polyclonal antibodies against MMP‐13 (Santa Cruz Biotechnology, Dallas, TX, sc‐30073, 1:500, RT), RANKL (Interchim, Poway, CA, 3963, 1:160, RT), or SIRT1 (Santa‐Cruz; sc15404, 1:50, 4 °C) overnight in a moist chamber with phosphate‐buffered saline (PBS)/0.05% Tween‐20 and 1% BSA. Then, sections were rinsed and incubated with appropriate secondary biotinylated antibodies (horse anti‐mouse IgG; Vector, 1:200 or goat anti‐rabbit IgG, Vector; 1:200, 90 min at RT). After treatment with 3% hydrogen peroxide for 30 min and avidin‐biotin peroxidase complex (ABC Vectastain Kit) for 1 hr, the chromogen 3,3′−diaminobenzidine tetrahydrochloride (DAB) was added. PBS (0.1 M) was used for washes. Negative controls were prepared by omitting the primary antibody, replacing the primary antibody with non‐immune serum, or using an irrelevant secondary antibody.
2.5. Tartrate‐resistant acid phosphatase (TRAP) staining
TRAP staining was used to reveal mononucleated preosteoclasts and osteoclasts with fast red TR salt (Sigma–Aldrich) and naphthol ASTR phosphate (Sigma–Aldrich), in agreement with a previous study (Baroukh et al., 2000); non‐osteoclastic acid phosphatase activity was inhibited with 50 mmol/L tartric acid added to the substrate solution. The following parameters were recorded: (a) number of TRAP+ osteoclasts per mm of bone surface (N.Oc/BPm), (b) the sum of osteoclast lacunae observed on the bone surface (resorption surface (Oc.S:BS, in %), and (c) the mean number of nuclei per osteoclast (N.Nc).
2.6. Morphometry
All sections were examined at the same magnification (×200) with a semi‐automatic image analyzer coupling the microscope to a video camera and computer. The periosteal zone in the area undergoing remodeling extended along the buccal cortex from the distal face of the first molar mesial root to the distal face of the first molar distal root. For stained cell quantification, stained cells were counted using Image J software and expressed as positive cells per millimeter of adjacent bone surface. For stained matrix quantification, the stained area was measured using Image J software and expressed as the percentage of the total area of the zone of interest.
2.7. Primary culture of murine osteoblasts
Osteoblasts were obtained by enzymatic digestion of calvaria bone of 2 to 3 day‐old Swiss mice. α‐MEM‐GlutaMAX medium supplemented with 100 UI/ml penicillin and 100 µg/ml streptomycin was used for enzymatic digestions and supplemented with 10% FBS for cell culture. Briefly, calvaria from newborns were dissected out, pooled, and sequentially digested for 60 min at 37 °C in a 0.2% collagenase IV solution. Cells were collected by centrifugation and incubated in T75 cm2 flasks (0.9 × 106 cells/flask) for 2 days. Cells were then harvested with 25% trypsin diluted in 0.2 g/L EDTA, rinsed, counted, and seeded under non‐mineralizing or mineralizing conditions (cell media supplemented with 50 µM ascorbic acid, 10 nM dexamethasone, and 5 mM β‐glycerophosphate) in 6‐well‐plates (1 × 105 cells/well) or 24‐well‐plates (25 × 103 cells/well). Media was changed three times a week. Cells were cultured for 1, 2, or 3 weeks.
2.8. Treatment of primary osteoblasts
The role of NAMPT enzymatic activity in primary osteoblast differentiation was assessed by treating cells for 3 weeks with FK866 (0.1, 1, or 10 nM) or the direct metabolite of NAMPT, that is, NMN (1, 10, or 100 μM). Cytotoxicity was tested using the CellTiter 96 AQueous One Solution Cell Proliferation Assay.
The effect of extra‐cellular NAMPT was assessed on mature osteoblasts (3 weeks differentiation) stimulated for 6–24 hr with recombinant NAMPT (4, 20, or 100 nM) in serum‐free medium. Experiments were performed with recombinant NAMPT from Alexis Biochemicals and were reproduced using recombinant NAMPT from other manufacturers (see list of reagents above).
2.9. Immunocytocytofluorescence
Osteoblasts were seeded on LabTek coverglasses at a density of 25 × 103 cells/coverslip and cultured for 3 weeks. Then, cells were rinsed twice with PBS, fixed with 4% paraformaldehyde in PBS for 10 min at RT, and incubated with the SIRT1 antibody (1:250) overnight at 4 °C. After two washes in PBS, the cells were incubated with Alexa Fluor 488‐conjugated secondary antibody (Invitrogen), diluted 1/1,000 in PBS, for 2 hr at RT and then DAPI for 5 min. After three washes in PBS, coverglasses were mounted with Moewiol and observed with a Nikon Diaphot 300 microscope equipped with a mercury lamp.
2.10. RT‐PCR analysis
Total RNA was extracted from osteoblasts using the Illustra RNA Spin Mini kit, with a DNAse step, according to the manufacturer's instructions. Concentrations were determined spectrophotometrically using a NanoVue device. Reverse transcription was performed on 500 ng total RNA using the Verso cDNA kit and a 2720 thermocycler (Crocodile Applied Biosystems, University Park, IL) with oligo(dT) primers. cDNA of interest was amplified at 55 °C with specific primers (Table 1) in a SYBR Green PCR Master Mix using a LightCycler LC480. GAPDH was used as a housekeeping gene for normalization, and results were confirmed using TBP as an alternative housekeeping gene.
Table 1.
List of primers used for real time RT‐PCR
| Target gene | Amplicon length | Forward Primer 5′‐3′ | Reverse Primer 5′‐3′ |
|---|---|---|---|
| BSP | 87 pb | AAACAGGCAACGAATACAAC | CCTCATAAGCTCGGTAAGTG |
| GAPDH | 150 pb | TGTGTCCGTCGTGGATCTGA | TTGCTGTTGAAGTCGCAGGAG |
| NAMPT | 233 pb | CCTTTTGTCATTAATCAGC | TTTGGCATCACTGGTACATA |
| OC | 80 pb | GGAGCAGTGTGAGCTTAACCC | ACCGCCTACAAACGCATCTATG |
| TBP | 103 pb | CCCCACAACTCTTCCATTCT | GCAGGAGTGATAGGGGTCAT |
| Sirt‐1 | 207 pb | ATGACGTCTTGTCCTCTAGT | CTCTCCGTATCATCTTCCAA |
2.11. Western blot analysis
Primary osteoblasts were washed with ice‐cold PBS and lysed in cold lysis buffer (5 mM EDTA, 150 mM NaCl, 0.2% Triton X–100, 50 mM Tris‐HCl, pH 7.5 supplemented with 1/100 Protease Inhibitor Cocktail Set V EDTA free. The lysed cells were disrupted by sonication and centrifuged at 13.000g for 10 min at 4 °C. The supernatant was used as the whole cell lysate. Protein concentrations were determined using the BCA assay kit. Equal amounts of denatured protein samples were migrated through 10% pre‐cast Stain‐Free gels (Mini‐Protean® TGX™ Stain Free gels), which allows normalization without immunostaining of a housekeeping protein (Gilda & Gomes, 2013; Rivero‐Gutierrez, Anzola, Martinez‐Augustin, & de Medina, 2014). Separated proteins were transferred to a nitrocellulose membrane. The membrane was blocked with 5% v/v BSA and incubated overnight at 4 °C with antibodies against NAMPT (Bethyl Laboratories, Montgomery, AL, A300‐372A, 1:1,000) or BSP (LF84, Kind gift from Larry Fisher, NIH, 1:1000). After incubation with peroxidase‐conjugated swine anti‐IgG at a 1/10,000 dilution for 1 hr at RT, the membrane was developed by ECL Prime Western Blotting Detection. Image Lab software (Bio‐Rad) was used for normalization and quantification of the blots.
2.12. Statistics
Calculations of descriptive statistics and statistical tests were performed using R software (R Foundation for Statistical Computing). For in vivo experiments, data were compared after calculating measures of central tendency and dispersion using nonparametric tests consisting of the Kruskal–Wallis test followed, if significant, by group comparisons with the Mann–Whitney U‐test. For in vitro experiments, the expression of NAMPT and SIRT1 during osteoblast differentiation under non‐mineralizing or mineralizing conditions was analyzed by paired‐two‐way ANOVA, followed, if significant, by group comparisons with the paired Student t‐test using the Benjamini‐Hochberg correction method. The effect of NAMPT, NMN, and FK866 on osteoblast activity and differentiation was studied by comparing the data using the paired Student t‐test. Finally, the effect of recombinant NAMPT plus IL‐1 on MMP expression was analyzed using a paired‐one‐way ANOVA test, followed, if significant, by group comparisons with the paired Student t‐test using the Benjamini–Hochberg correction. Differences were considered to be significant for p < 0.05 for all statistical tests.
3. RESULTS
3.1. NAMPT expression increases in the osteogenic layer during bone remodeling
We assessed NAMPT expression in the mandibular periosteum in a synchronized alveolar bone remodeling model at baseline, 12, 18, 24, and 48 hr after induction (i.e., maxillary molar extraction) (Tran Van et al., 1982). There was low basal NAMPT expression in cells localized at the center of the osteogenic layer (Figures 2a and 2e). At 12 hr, NAMPT expression increased throughout the osteogenic layer, particularly in the center. The increase in NAMPT expression was significant at 12 hr relative to baseline (x1.9 vs. baseline, p < 0.01, Figures 2a and 2e), and peaked at 18 hr (x2.7 vs. baseline, p < 0.01, Figures 2a and 2e). The number of NAMPT‐positive cells decreased to baseline levels after 24 and 48 hr. No osteocyte was immunostained at baseline, but we observed a few NAMPT‐positive osteocytes at 18 hr. There was no expression in the non‐osteogenic layer or osteoclasts present at 48 hr.
Figure 2.

NAMPT, RANKL, MMP‐2, and MMP‐13 expression in alveolar bone remodeling. Extraction of the first maxillary molar induced egression of the opposing tooth. A synchronized alveolar bone remodeling sequence was triggered in the mandibular buccal area. Animals were sacrificed at various times after model onset. NAMPT (a), RANKL (b), MMP‐2 (c), and MMP‐13 (d) expression was analyzed by immunohistochemistry and quantified using Image J software (e–g). Magnification ×400. Boxes are delimited by the first and third quartiles (Q1, Q3) and the line shows the median. Outliers are represented by the extreme values, defined as values lower then Q1—1.5 IQR (Inter Quartile Range) or higher then Q3 + 1.5 IQR. (+) represents the mean, *p ≤ 0.05, **p ≤ 0.01 by the Mann–Whitney U‐test
3.2. RANKL and MMP‐2 expression parallels NAMPT expression, whereas MMP‐13 expression is delayed
We then explored RANKL and MMP expression as they are respectively involved in osteoclast recruitment and osteoid seam proteolysis (a prerequisite for osteoclast access to the mineralized bone surface). We also investigated MMP‐2 and MMP‐9 expression, which are highly involved in alveolar bone homeostasis (Accorsi‐Mendonca et al., 2008; Takahashi et al., 2006), as well as that of MMP‐13, which has been shown to be regulated by NAMPT (Gosset et al., 2008).
RANKL and MMP‐2 expression paralleled that of NAMPT (Figures 2b and 2c). The number of RANKL+ cells increased as early as 12 hr (1.4‐fold vs. baseline, p < 0.05, Figures 2b and 2f) and peaked at 18 hr (1.63‐fold vs. baseline, p < 0.01, Figures 2b and 2f). Thereafter, the number of RANKL+ cells significantly decreased to baseline (0.76‐fold vs. baseline at 24 hr, NS, Figures 2b and 2f). The immunopositive cells were located throughout the compartment. Osteocytes close to the bone surface did not express RANKL. MMP‐2 was expressed at baseline throughout the osteogenic layer with more marked expression in cells close to the bone surface. There was also faint immunostaining of osteocytes. By 12 hr, MMP‐2 expression in osteoblasts was strongly reduced throughout the layer and the intensity of the immunostaining was weaker than in controls (Figure 2c). However, MMP‐2 staining significantly increased within the extra‐cellular matrix of the periosteum osteogenic compartment at 12 hr (3.3‐fold vs. baseline, p < 0.05, Figure 2g). By 18 hr, MMP‐2 expression was high in cells adjacent to the bone surface and osteoid seam, whereas it was weak at the periphery of the layer (Figure 2c). Globally, MMP‐2 staining increased significantly within the matrix relative to baseline (4.6‐fold vs. baseline, p < 0.01, Figure 2g). By 24 hr, MMP2+ cells were present throughout the layer, but the staining was weaker than at baseline (Figure 2c). In parallel, MMP‐2 staining within the matrix decreased down to basal levels (Figure 2g).
At baseline, MMP‐13+ cells were located within the mineralized bone matrix at a distance from the bone surface corresponding to older osteocytes. The number of MMP‐13+ osteocytes decreased from baseline to 72 hr. However, MMP‐13 immunostaining appeared at the bone surface from 48 to 72 hr. This corresponds to the appearance of, and increase in, differentiated osteoclasts (Baroukh et al., 2000). Finally, at 96 hr, there was strong staining of newly embedded osteocytes (Figure 2d).
3.3. Inhibition of NAMPT enzymatic activity decreases osteoclast recruitment but not their activity
We used FK866, a selective NAMPT inhibitor, to test the role of NAMPT enzymatic activity (Evans, Williams, Hayes, Jones, & Nowell, 2011). The number of TRAP+ osteoclasts per mm of bone surface (N.Oc/BPm) was lower in FK866‐treated rats than in Sham‐treated animals (−46%, p < 0.01; Figures 3a and 3b) at 4 days, that is, the peak of osteoclast recruitment (Baroukh et al., 2000). This was accompanied by a decrease in the resorption surface (OcS/BS) relative to that of Sham‐treated animals (−30%, p < 0.05; Figure 3c). The number of nuclei per cell (N.Nc), an index of osteoclast activity, did not vary (control vs. FK866: 2.75 vs. 3.1 nuclei/osteoclast, NS, Figure 3d).
Figure 3.

Inhibition of NAMPT enzymatic activity decreases osteoclast recruitment in the bone remodeling model. FK866‐loaded osmotic pumps were implanted 48 hr before maxillary‐molar extraction. Rats were sacrificed 4 days after tooth extraction. Osteoclast recruitment and activity were analyzed by TRAP enzymatic staining (a) and quantified (b, c and d). N.Oc/BPm: number of TRAP+ osteoclasts per mm of bone surface, Oc.S:BS (%): resorption surface, N.Nc: mean number of nuclei per osteoclast. Magnification ×200. Boxes are delimited by the first and third quartiles (Q1, Q3) and the line shows the median. Outliers are represented by the extreme values, defined as values lower then Q1—1.5 IQR (Inter Quartile Range) or higher then Q3 + 1.5 IQR. (+) represents the mean, *p ≤ 0.05, **p ≤ 0.01 by the Mann–Whitney U‐test
3.4. NAMPT is expressed during in vitro osteoblast differentiation
We assessed NAMPT mRNA and protein expression in primary cultures of murine calvaria osteoblasts under non‐mineralizing and mineralizing conditions from 1 to 3 weeks. NAMPT mRNA expression increased with osteoblast differentiation (3.3‐fold; p < 0.05 and 2.7‐fold; p < 0.01 in 21 day‐cultured cells relative to baseline under non‐mineralizing and mineralizing conditions, respectively; Figure 4a). At each time point, NAMPT mRNA expression did not vary with respect to mineralizing conditions. At 3 weeks, NAMPT protein expression was higher in osteoblasts under mineralizing condition compared to non‐mineralizing condition (1.7‐fold; p < 0.05; Figure 4b and 4c).
Figure 4.

NAMPT expression in differentiating calvaria osteoblasts in primary culture. Primary osteoblasts were cultured under mineralizing (M) or non‐mineralizing conditions (NM) for 7, 14, or 21 days. (a) NAMPT mRNA expression was assessed by real‐time RT‐PCR. GAPDH was used as a housekeeping gene to normalize the data. Data represent the fold‐induction of four independent experiments performed in duplicate. *p < 0.05 by the paired t‐test after 21 days under NM conditions, **p < 0.01 by the paired t‐test after 21 days under M conditions. (b) NAMPT protein expression was analyzed by Western blot. Normalization was performed in accord with the stain free detection technique. The image is representative of three independent experiments. The graph represents the fold‐induction of three independent experiments. ×p < 0.05 by the paired t‐test after 21 days in M compared to NM conditions
We evaluated the effect of NAMPT on bone marker expression. Recombinant NAMPT did not induce expression of early differentiation markers of osteoblasts, that is, type 1 collagen, ALP, or Runx‐2 (data not shown). In contrast, 4, 20, and 100 nM NAMPT induced mRNA expression of the late differentiation markers bone sialoprotein (BSP) and osteocalcin (OCN) (BSP: 1.5‐, 1.4‐, and 1.6‐fold; OCN: 2.1‐, 2‐, and 1.7‐fold relative to control for 4, 20, and 100 nM NAMPT, respectively; results were significant for 4 and 100 nM NAMPT p < 0.05) (Figures 5a and 5c). There was a similar trend for BSP protein expression in response to 4–100 nM recombinant NAMPT challenge (1.7‐fold, 1.8‐fold, and 2.1‐fold respectively, NS, Figure 5b).
Figure 5.

Effect of NAMPT on osteoblast differentiation. (a–c) Mature osteoblasts (21 days of culture under mineralizing conditions) were stimulated with 4, 20, or 100 nM recombinant NAMPT. mRNA and protein extractions were performed after 6 and 24 hr, respectively. (d–i)‐ Osteoblasts were cultured for 21 days in mineralizing media supplied with 1, 10, or 100 μM NMN (d–f) or 0.1, 1, or 10 nM FK866 (g–i) before mRNA and protein extraction. NMN is the metabolite resulting from NAMPT enzymatic activity. FK866 is a specific inhibitor of NAMPT enzymatic activity. The data represent the fold‐induction in each of two to three independent experiments, performed in duplicate. *p < 0.05 and p < 0.01 by the Student t‐test
In a second set of experiments, we tested the effect of NMN, the metabolite of NAMPT enzymatic activity. One, 10, and 100 μM NMN did not induce type I collagen, ALP, or Runx‐2 mRNA expression (data not shown), nor BSP and OCN mRNA expression (BSP: 1.5‐, 3.8‐, and 3‐fold relative to control; OCN: no induction, 1.8‐, and 1.4‐fold relative to control, NS) (Figures 5d and 5f). BSP protein expression also increased in response to NMN treatment (2.7‐, 2.1‐, and 2‐fold respectively, p < 0.05, Figure 5e).
Finally, we used FK866 to inhibit the enzymatic activity of NAMPT in osteoblast cultures. FK866 (0.1–10 nM) did not influence early differentiation marker expression. However, BSP and OCN mRNA expression was lower after treatment with 10 nM FK866 (−93% for BSP and −99% for OCN relative to DMSO treated cells, p < 0.05) (Figures 5g and 5i). This decrease was paralleled by the dramatic decrease of BSP protein expression (Figure 5h). There were no differences in ALP or Red Alizarin staining or in the number of viable cells in response to NMN or FK866 treatment (data not shown).
3.5. NAMPT does not induce MMP or RANKL/OPG expression in osteoblasts
We assessed MMP‐2, MMP‐9, MMP‐13, and RANKL/OPG mRNA expression in 20 nM recombinant NAMPT‐treated osteoblasts, with or without 1 ng/ml IL‐1β. Neither NAMPT nor NAMPT plus IL‐1β induced MMP‐2, MMP‐9, MMP‐13, or RANKL/OPG mRNA expression (data not shown).
3.6. SIRT1 expression is regulated in the bone remodeling model and osteoblast cell cultures
SIRT1 activity depends on NAD+ cofactor consumption and is involved in osteoblast activity (Iyer et al., 2014; Qu et al., 2016). Indeed, it has been shown that knockdown of NAMPT in C3H10T1/2 mesenchymal cells resulted in decreased SIRT1 activity and decreased osteoblastogenesis (Li et al., 2011). We checked the role of SIRT1 in the bone remodeling model. In vivo, there was basal SIRT1 expression in the periosteum osteogenic and non‐osteogenic compartments. The number of SIRT1+ cells peaked at 18 hr after induction of remodeling (1.9‐fold vs. baseline, p < 0.01, Figure 6a). There was strong staining mainly in the osteogenic compartment, in osteoblasts lining the bone surface, and in osteocytes close to the bone surface. The number of SIRT1+ cells dropped back to basal levels by 24 hr (Figure 6a).
Figure 6.

In vitro and in vivo SIRT1 expression in osteoblasts. Primary osteoblasts were cultured in non‐mineralizing (NM) or mineralizing (M) media for 7, 14, or 21 days. (a) SIRT1 protein expression was assessed in the bone remodeling model by immunohistochemistry. Boxes are delimited by the first and third quartiles (Q1, Q3) with the line showing the median. Outliers are represented by the extreme values, defined as values lower then Q1—1.5 IQR (Inter Quartile Range) or higher then Q3 + 1.5 IQR. (+) represents the mean. ***p < 0.01. (b and c) SIRT1 mRNA and protein expression were analyzed by real‐time RT‐PCR or immunocytofluorescence. The data represent the fold‐induction of four independent experiments performed in duplicate. Images are representative of two independent experiments performed in triplicate. The data represent the fold‐induction of four independent experiments performed in duplicate. *p < 0.05 by the paired t‐test after 21 days under NM conditions, **p < 0.05 by the paired t‐test after 21 days under M conditions
In vitro, SIRT1 mRNA expression in osteoblasts increased over time, irrespective of the mineralizing condition (1.5‐ and 1.4‐fold in 21 day‐cultured cells vs baseline in non‐mineralizing or mineralizing conditions, respectively, p < 0.05; Figure 6b). In contrast, SIRT1 protein expression was higher in osteoblasts cultured for 21 days under mineralizing conditions than those cultured under non‐mineralizing conditions. SIRT1 expression was observed in the nucleus in primary osteoblasts under both conditions (Figure 6c). There was no change in SIRT1 mRNA expression in response to NMN, FK866, or recombinant NAMPT protein challenge (data not shown).
4. DISCUSSION
In this study, the onset of a bone remodeling sequence triggered NAMPT overexpression in the osteogenic cells of the mandible alveolar bone periosteum. NAMPT enzymatic activity was involved in the control of osteoclast resorption, as FK866 treatment decreased osteoclast formation. In cell culture, NAMPT expression increased in parallel with osteoblast differentiation and NAMPT enzymatic activity regulated osteoblast marker expression. These results show that de novo NAMPT expression in osteoblasts regulates their differentiation toward a phenotype involved in the osteoclast recruitment that occurs during bone remodeling.
In the bone remodeling model studied here, the temporal and topographic expression of NAMPT, RANKL, and MMP‐2 were similar. This expression was restricted to periosteum osteogenic cells. Surprisingly, RANKL expression was not found in osteocytes, contradicting the current opinion of osteocytes as the prevalent source of RANKL during osteoclastogenesis (Bellido, 2014). This discrepancy may be explained by the specificity of the alveolar bone. The in vivo data on the role of osteocytes in resorption concern the endosteal and endocortical bone surfaces of the appendicular and axial skeletons (O'Brien, Nakashima, & Takayanagi, 2013; Xiong et al., 2015). Moreover, tooth eruption is not disturbed by the conditional deletion of the Tnfsf11 gene in osteocytes (Xiong et al., 2015), indicating that cells other than osteocytes are involved in osteoclast‐driven tooth eruption. Finally, alveolar and craniofacial bones differ from long bones in terms of embryological origins. Indeed calvaria osteoblasts in culture display a higher RANKL/OPG ratio and secrete higher levels of TNF‐α, involved in stimulating the differentiation of a higher number of TRAP+ multinucleated cells in calvaria osteoblast/osteoclast co‐cultures, than in long bone osteoblast/osteoclast co‐cultures (Wan et al., 2016). Thus, in alveolar bone, osteoblasts may be the key source of RANKL‐driven osteoclastogenesis.
The decrease in both osteoclast recruitment and activation under FK866 treatment is striking. It is possible that that the decrease of osteoclast activation may be due to the inhibition of NAMPT in the osteoclast lineage, as FK866 was systematically delivered by the pump system. However, osteoclasts did not start to produce NAMPT in the model until 48 hr (the beginning of osteoclast recruitment in the model, according to (Baroukh et al., 2000). Previous results have shown the control of osteoclastogenesis by recombinant NAMPT. Indeed, in vitro NAMPT treatment suppresses RANKL‐induced osteoclastogenesis from bone marrow macrophages by decreasing the activation of many signaling pathways, such as c‐Jun N‐terminal kinase, Akt, or glycogen synthase kinase‐3β, and the expression of osteoclast‐specific genes involved in their differentiation. Furthermore, the resorbing activity of the mature osteoclasts treated with NAMPT was similar to untreated control osteoclasts in the same study (Baek et al., 2017). According to the study, extracellular NAMPT release by osteoblasts should decrease osteoclast recruitment in the bone remodeling model. Here, we obtained opposite results, emphasizing an in vivo role of de novo osteoblast‐synthesized NAMPT in the control of osteoclast recruitment, but not in their resorbing activity.
In the alveolar bone, there was basal MMP‐13 staining of older osteocytes, located at a distance from the bone surface. MMP‐13 expression is involved in perilacunar remodeling of osteocytes located in the mid‐cortical bone matrix of tibiae and femora, a feature probably essential for the maintenance of bone quality (Tang, Herber, Ho, & Alliston, 2012). Here, MMP‐13 staining peaked at 72 hr along the bone surface, in agreement with its release by osteogenic cells, as shown in alveolar bone during orthodontic tooth movement (Leonardi, Talic, & Loreto, 2007). MMP‐13 is a potent enhancer of osteoclast recruitment in multiple myeloma cells, which promote osteolytic lesions (Fu et al., 2016). Thus, NAMPT‐driven MMP‐13 production in osteoblasts may be a new pathway of osteoclast recruitment in alveolar bone remodeling. However, recombinant NAMPT protein did not regulate MMP‐2, MMP‐9, MMP‐13, or RANKL/OPG mRNA expression in osteoblast cultures. Moreover, NAMPT only regulated BSP and OC expression, whereas it has been recently shown that NAMPT promotes increased function of Runx2 in osteoblast cultures (Ling et al., 2017). We used a mature osteoblast cell culture in which matrix production and mineralization were activated. Further experiments need to be performed on osteoblasts at a different stage of differentiation to determine whether this could influence the role of NAMPT.
In this study, intra‐cellular enzymatic activity, rather than a cytokine role, appears to explain the role of NAMPT in osteoblast metabolism. Immunostaining revealed intra‐cellular localization of NAMPT in the osteogenic cells. In vitro, NAMPT expression increased with osteoblast differentiation. Moreover, FK866, a specific cell‐permeable inhibitor of NAMPT enzyme activity (Hasmann & Schemainda, 2003), decreased BSP and osteocalcin expression. NAD, the product of NMN, regulates oxidative phosphorylation and redox reactions, both involved in osteoblast differentiation (Guntur, Le, Farber, & Rosen, 2014). The regulatory role of iNAMPT in osteogenic differentiation of MC3T3‐E1 cells (Li et al., 2013) and bone marrow‐derived mesenchymal stem cells (He et al., 2017) has already been reported. NAMPT inhibition using FK866 can impair osteoblastogenesis, characterized by a decrease in ALP activity and matrix mineralization and down‐regulation of osteoblast‐specific marker gene expression (He et al., 2017). However, it is challenging to decipher whether the role of NAMPT is dependent on its extra‐cellular or intra‐cellular form, because eNAMPT exhibits both enzymatic and cytokine activity (Carbone et al., 2017).
NAD is also consumed by enzymes, such as SIRT1, a regulator of osteoblast differentiation. Mesenchymal Stem Cells (MSCs) isolated from MSC‐specific SIRT1 knock‐out mice show reduced differentiation toward the osteoblastic pathway in vitro, due to an accumulation of β‐catenin in MCS nuclei (Simic et al., 2013). Furthermore, SIRT1 deletion in osteoprogenitors causes a decrease in cortical bone mass (Iyer et al., 2014). Here, we found SIRT1 expression in primary calvaria osteoblasts. In vivo, its expression in osteogenic cells during the activation phase of our remodeling model suggests that the effects of NAMPT on osteoblasts could be partly due to SIRT1. However, SIRT1 expression was not regulated in response to NAMPT, NMN, or FK866 in osteoblasts in vitro.
Our results suggest that NAMPT is required for the acquisition of a pro‐resorbing phenotype by osteogenic cells, oriented toward osteoclast recruitment during alveolar bone remodeling. The effect of NAMPT on osteoblast differentiation and MMP production appears to be driven by the intra‐cellular enzymatic activity of NAMPT, whereas its extracellular form may be related to osteoclast recruitment. Overall, our data favor more in‐depth investigation of the role of NAMPT in bone pathobiology, as NAMPT is overexpressed in many inflammatory diseases involving bone resorption (Brentano et al., 2007; Gosset et al., 2008; Laiguillon et al., 2014; Pradeep et al., 2011).
CONFLICTS OF INTEREST
The authors declare no conflict of interest with respect to the authorship and/or publication of this article.
ACKNOWLEDGMENTS
The authors thank Gael Millot (Institut Pasteur, Paris France) for having kindly reviewed the biostatistics, and Maheva Garcia (EA2496) for animal care. This work was supported by Contract grant sponsors: University Paris Descartes, the French Society of Rheumatology (SFR), and the French Institute for Research in Odontology (IFRO).
REFERENCES
- Accorsi‐Mendonca, T. , Paiva, K. B. , Zambuzzi, W. F. , Cestari, T. M. , Lara, V. S. , Sogayar, M. C. , … Granjeiro, J. M. (2008). Expression of matrix metalloproteinases‐2 and −9 and RECK during alveolar bone regeneration in rat. Journal of Molecular Histology, 39(2), 201–208. [DOI] [PubMed] [Google Scholar]
- Baek, J. M. , Ahn, S. J. , Cheon, Y. H. , Lee, M. S. , Oh, J. , & Kim, J. Y. (2017). Nicotinamide phosphoribosyltransferase inhibits receptor activator of nuclear factor‐kappaB ligand‐induced osteoclast differentiation in vitro. Molecular Medicine Reports, 15(2), 784–792. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Baron, R. , Neff, L. , Tran Van, P. , Nefussi, J. R. , & Vignery, A. (1986). Kinetic and cytochemical identification of osteoclast precursors and their differentiation into multinucleated osteoclasts. The American Journal of Pathology, 122(2), 363–378. [PMC free article] [PubMed] [Google Scholar]
- Baroukh, B. , Cherruau, M. , Dobigny, C. , Guez, D. , & Saffar, J. L. (2000). Osteoclasts differentiate from resident precursors in an in vivo model of synchronized resorption: A temporal and spatial study in rats. Bone, 27(5), 627–634. [DOI] [PubMed] [Google Scholar]
- Bellido, T. (2014). Osteocyte‐driven bone remodeling. Calcified Tissue International, 94(1), 25–34. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Blavier, L. , & Delaisse, J. M. (1995). Matrix metalloproteinases are obligatory for the migration of preosteoclasts to the developing marrow cavity of primitive long bones. Journal of Cell Science, 108(12), 3649–3659. [DOI] [PubMed] [Google Scholar]
- Brentano, F. , Schorr, O. , Ospelt, C. , Stanczyk, J. , Gay, R. E. , Gay, S. , & Kyburz, D. (2007). Pre‐B cell colony‐enhancing factor/visfatin, a new marker of inflammation in rheumatoid arthritis with proinflammatory and matrix‐degrading activities. Arthritis Rheum, 56(9), 2829–2839. [DOI] [PubMed] [Google Scholar]
- Carbone, F. , Liberale, L. , Bonaventura, A. , Vecchie, A. , Casula, M. , Cea, M. , … Nencioni, A. (2017). Regulation and function of extracellular nicotinamide phosphoribosyltransferase/visfatin. Comprehensive Physiology, 7(2), 603–621. [DOI] [PubMed] [Google Scholar]
- Cherruau, M. , Facchinetti, P. , Baroukh, B. , & Saffar, J. L. (1999). Chemical sympathectomy impairs bone resorption in rats: A role for the sympathetic system on bone metabolism. Bone, 25(5), 545–551. [DOI] [PubMed] [Google Scholar]
- Evans, L. , Williams, A. S. , Hayes, A. J. , Jones, S. A. , & Nowell, M. (2011). Suppression of leukocyte infiltration and cartilage degradation by selective inhibition of pre‐B cell colony‐enhancing factor/visfatin/nicotinamide phosphoribosyltransferase: Apo866‐mediated therapy in human fibroblasts and murine collagen‐induced arthritis. Arthritis & Rheumatism, 63(7), 1866–1877. [DOI] [PubMed] [Google Scholar]
- Fu, J. , Li, S. , Feng, R. , Ma, H. , Sabeh, F. , Roodman, G. D. , … Lentzsch, S. (2016). Multiple myeloma‐derived MMP‐13 mediates osteoclast fusogenesis and osteolytic disease. Journal of Clinical Investigation, 126(5), 1759–1772. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fukuhara, A. , Matsuda, M. , Nishizawa, M. , Segawa, K. , Tanaka, M. , Kishimoto, K. , … Shimomura, I. (2005). Visfatin: A protein secreted by visceral fat that mimics the effects of insulin. Science, 307(5708), 426–430. [DOI] [PubMed] [Google Scholar]
- Garten, A. , Schuster, S. , Penke, M. , Gorski, T. , de Giorgis, T. , & Kiess, W. (2015). Physiological and pathophysiological roles of NAMPT and NAD metabolism. Nature Reviews Endocrinology, 11(9), 535–546. [DOI] [PubMed] [Google Scholar]
- Gilda, J. E. , & Gomes, A. V. (2013). Stain‐Free total protein staining is a superior loading control to beta‐actin for Western blots. Analytical Biochemistry, 440(2), 186–188. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gosset, M. , Berenbaum, F. , Salvat, C. , Sautet, A. , Pigenet, A. , Tahiri, K. , & Jacques, C. (2008). Crucial role of visfatin/pre‐B cell colony‐enhancing factor in matrix degradation and prostaglandin E2 synthesis in chondrocytes: Possible influence on osteoarthritis. Arthritis & Rheumatism, 58(5), 1399–1409. [DOI] [PubMed] [Google Scholar]
- Graves, D. T. , Li, J. , & Cochran, D. L. (2011). Inflammation and uncoupling as mechanisms of periodontal bone loss. Journal of Dental Research, 90(2), 143–153. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Guntur, A. R. , Le, P. T. , Farber, C. R. , & Rosen, C. J. (2014). Bioenergetics during calvarial osteoblast differentiation reflect strain differences in bone mass. Endocrinology, 155(5), 1589–1595. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hajishengallis, G. (2015). Periodontitis: From microbial immune subversion to systemic inflammation. Nature Reviews Immunology, 15(1), 30–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hasmann, M. , & Schemainda, I. (2003). FK866, a highly specific noncompetitive inhibitor of nicotinamide phosphoribosyltransferase, represents a novel mechanism for induction of tumor cell apoptosis. Cancer Research, 63(21), 7436–7442. [PubMed] [Google Scholar]
- He, X. , He, J. , Shi, Y. , Pi, C. , Yang, Y. , Sun, Y. , … Li, Y. (2017). Nicotinamide phosphoribosyltransferase (Nampt) may serve as the marker for osteoblast differentiation of bone marrow‐derived mesenchymal stem cells. Experimental Cell Research, 352(1), 45–52. [DOI] [PubMed] [Google Scholar]
- Imai, S. , & Guarente, L. (2014). NAD+ and sirtuins in aging and disease. Trends in Cell Biology, 24(8), 464–471. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Iyer, S. , Han, L. , Bartell, S. M. , Kim, H. N. , Gubrij, I. , de Cabo, R. , … Almeida, M. (2014). Sirtuin1 (Sirt1) promotes cortical bone formation by preventing beta‐catenin sequestration by FoxO transcription factors in osteoblast progenitors. Journal of Biological Chemistry, 289(35), 24069–24078. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Laiguillon, M. C. , Houard, X. , Bougault, C. , Gosset, M. , Nourissat, G. , Sautet, A. , … Sellam, J. (2014). Expression and function of visfatin (Nampt), an adipokine‐enzyme involved in inflammatory pathways of osteoarthritis. Arthritis Research & Therapy, 16(1), R38. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Leonardi, R. , Talic, N. F. , & Loreto, C. (2007). MMP‐13 (collagenase 3) immunolocalisation during initial orthodontic tooth movement in rats. Acta Histochemica, 109(3), 215–220. [DOI] [PubMed] [Google Scholar]
- Li, Y. , He, J. , He, X. , Li, Y. , & Lindgren, U. (2013). Nampt expression increases during osteogenic differentiation of multi‐ and omnipotent progenitors. Biochemical and Biophysical Research Communications, 434(1), 117–123. [DOI] [PubMed] [Google Scholar]
- Li, Y. , He, X. , Li, Y. , He, J. , Anderstam, B. , Andersson, G. , & Lindgren, U. (2011). Nicotinamide phosphoribosyltransferase (Nampt) affects the lineage fate determination of mesenchymal stem cells: A possible cause for reduced osteogenesis and increased adipogenesis in older individuals. Journal of Bone and Mineral Research, 26(11), 2656–2664. [DOI] [PubMed] [Google Scholar]
- Ling, M. , Huang, P. , Islam, S. , Heruth, D. P. , Li, X. , Zhang, L. Q. , … Ye, S. Q. (2017). Epigenetic regulation of Runx2 transcription and osteoblast differentiation by nicotinamide phosphoribosyltransferase. Cell & Bioscience, 7, 27. [DOI] [PMC free article] [PubMed] [Google Scholar]
- O'Brien, C. A. , Nakashima, T. , & Takayanagi, H. (2013). Osteocyte control of osteoclastogenesis. Bone, 54(2), 258–263. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pradeep, A. R. , Raghavendra, N. M. , Prasad, M. V. , Kathariya, R. , Patel, S. P. , & Sharma, A. (2011). Gingival crevicular fluid and serum visfatin concentration: Their relationship in periodontal health and disease. Journal of Periodontology, 82(9), 1314–1319. [DOI] [PubMed] [Google Scholar]
- Qu, B. , Ma, Y. , Yan, M. , Gong, K. , Liang, F. , Deng, S. , … Pan, X. (2016). Sirtuin1 promotes osteogenic differentiation through downregulation of peroxisome proliferator‐activated receptor gamma in MC3T3‐E1 cells. Biochemical and Biophysical Research Communications, 478(1), 439–445. [DOI] [PubMed] [Google Scholar]
- Raggatt, L. J. , & Partridge, N. C. (2010). Cellular and molecular mechanisms of bone remodeling. Journal of Biological Chemistry, 285(33), 25103–25108. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rivero‐Gutierrez, B. , Anzola, A. , Martinez‐Augustin, O. , & de Medina, F. S. (2014). Stain‐free detection as loading control alternative to Ponceau and housekeeping protein immunodetection in Western blotting. Analytical Biochemistry, 467, 1–3. [DOI] [PubMed] [Google Scholar]
- Saffar, J. L. , Lasfargues, J. J. , & Cherruau, M. (1997). Alveolar bone and the alveolar process: The socket that is never stable. Periodontology 2000, 13, 76–90. [DOI] [PubMed] [Google Scholar]
- Simic, P. , Zainabadi, K. , Bell, E. , Sykes, D. B. , Saez, B. , Lotinun, S. , … Guarente, L. (2013). SIRT1 regulates differentiation of mesenchymal stem cells by deacetylating beta‐catenin. EMBO Molecular Medicine, 5(3), 430–440. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Takahashi, I. , Onodera, K. , Nishimura, M. , Mitnai, H. , Sasano, Y. , & Mitani, H. (2006). Expression of genes for gelatinases and tissue inhibitors of metalloproteinases in periodontal tissues during orthodontic tooth movement. Journal of Molecular Histology, 37(8–9), 333–342. [DOI] [PubMed] [Google Scholar]
- Tang, S. Y. , Herber, R. P. , Ho, S. P. , & Alliston, T. (2012). Matrix metalloproteinase‐13 is required for osteocytic perilacunar remodeling and maintains bone fracture resistance. Journal of Bone and Mineral Research, 27(9), 1936–1950. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Van PT, T. , Vignery, A. , & Baron, R. (1982). Cellular kinetics of the bone remodeling sequence in the rat. Anatomical Record, 202(4), 445–451. [DOI] [PubMed] [Google Scholar]
- Wan, Q. , Schoenmaker, T. , Jansen, I. D. , Bian, Z. , de Vries, T. J. , & Everts, V. (2016). Osteoblasts of calvaria induce higher numbers of osteoclasts than osteoblasts from long bone. Bone, 86, 10–21. [DOI] [PubMed] [Google Scholar]
- Xie, H. , Tang, S. Y. , Luo, X. H. , Huang, J. , Cui, R. R. , Yuan, L. Q. , … Liao, E. Y. (2007). Insulin‐like effects of visfatin on human osteoblasts. Calcified Tissue International, 80(3), 201–210. [DOI] [PubMed] [Google Scholar]
- Xiong, J. , Piemontese, M. , Onal, M. , Campbell, J. , Goellner, J. J. , Dusevich, V. , … O'Brien, C. A. (2015). Osteocytes, not osteoblasts or lining cells, are the main source of the RANKL required for osteoclast formation in remodeling bone. PLoS ONE, 10(9), e0138189. [DOI] [PMC free article] [PubMed] [Google Scholar]
