Abstract
Non‐coding RNAs can exert significant roles various cancers, including NSCLC. Previously, we indicated that lncRNA DGCR5 can promote lung cancer progression through inhibiting hsa‐mir‐22‐3p. In our current study, we investigated the role of DGCR5 in cancer stem cell‐like properties of NSCLC. CSCs have been recognized as the frequent cause of tumor metastasis, tumor recurrence, and chemotherapy resistance. Here, lung cancer stem cells were successfully enriched from the parental NSCLC A549, H460, and H1299 cells by using tumor sphere formation assays and side population (SP) assays. We observed that DGCR5 was up‐regulated in the enriched CSCs of NSCLC. DGCR5 can inhibit the stemness of NSLCL while overexpression of DGCR5 promoted CSC‐like traits. In addition, miR‐330‐5p was predicted as target of DGCR5 and the correlation between them was validated by dual‐luciferase reporter assay, RIP assay, and RNA pull‐down assay. Meanwhile, it was found that miR‐330‐5p was decreased in CSCs of NSCLC. miR‐330‐5p mimics repressed the stemness while miR‐330‐5p inhibition enhanced CSC‐like properties by targeting CD44. Taken these together, DGCR5 can act as a crucial regulator of CSCs in NSCLC by modulating miR‐330‐5p/CD44 axis.
Keywords: CD44, CSCs, DGCR5, miR‐330‐5p, NSCLC
This is the first reporting of a possible mechanism for an interaction between DGCR and miR‐330‐5p in lung CSCs. We exhibited that DGCR5 silence can inhibit CSC‐like phenotypes in NSLCL by sponging miR‐330‐5p and increasing CD44 expression. These data suggested a possibility of developing DGCR5 as a potential target for NSCLC.

1. INTRODUCTION
Lung cancer is a frequent cancer all over the world (Siegel, Naishadham, & Jemal, 2012). Almost 85% of all lung cancers belong to non‐small cell lung cancer (NSCLC). In spite of recent advancements made in clinics, prognosis of NSCLC patients still remains poor (Kaira et al., 2013). As NSCLC is a multi‐gene disease, the biological mechanisms responsible for NSCLC tumorigenesis are complex. Therefore, it is urgent to identify the molecules in NSCLC and improve diagnosis and treatment for NSCLC patients. The difficulty to treat advanced cancers is partly attributed to the existence of a sub‐population of cancer cells, which are regarded as cancer stem cells (CSCs) (Zakaria et al., 2017). CSCs contain the self‐renewal abilities which are similar to the normal stem cells. Targeting CSCs can suggest an effective strategy to treat cancers (Esendagli & Gunel‐Ozcan, 2017).
LncRNAs are RNAs with more than 200 nts, which have little protein‐coding function (Chi, Tsai, Tsai, Yeh, & Lin, 2017). They have been reported to modulate crucial biological functions, including stem cell properties, and tumor development (Heery, Finn, Cuffe, & Gray, 2017; Sheng, Wu, Tang, & Liang, 2017). For example, lncRNA AC105461.1 knockdown can enhance colorectal CSC properties by targeting DIS3L2 (Liu, Zhu, et al., 2017). LncRNA HOTAIR can regulate CSC subpopulation, which is enriched from breast cancer cells (Deng et al., 2017). LncRNA lncCAMTA1 promotes CSC‐like properties of liver cancer via inhibition of CAMTA1 (Ding et al., 2016). LncRNA TCF7 can induce self‐renewal of NSCLC cells (Wu & Wang, 2017). Previously, we found that lncRNA DGCR5 can promote lung adenocarcinoma development via targeting hsa‐mir‐22‐3p (Dong, Wang, Zeng, & Pan, 2018). However, the role of DGCR5 in regulating CSC‐like traits of NSCLC remains unknown.
MicroRNAs exert biological roles through targeting mRNAs for cleavage or translational inhibition (Bartel, 2004). A lot of microRNAs are involved in CSC‐like properties in various cancers. miR‐34a is reported to be downregulated in human osteosarcoma stem‐like cells and it can promote OSCC stemness (Zou, Huang, Yang, Wu, & Luo, 2017). miRNA‐141 can inhibit prostate cancer stem cells by targeting pro‐metastasis genes (Liu, Liu, et al., 2017). miR‐410 can induce NSCLC stemness by inhibiting Gsk3β and upregulating β‐catenin (Ke et al., 2017). miR‐330‐5p can play tumor suppressive roles in many cancers. LncRNA EWSAT1 can promote ovarian cancer progression through sponging miR‐330‐5p (Fu, Zhang, Dan, Wang, & Xu, 2017). miR‐330‐5p can suppress glioblastoma cell progression through targeting ITGA5 (Feng, Ma, Ji, Liu, & Hu, 2017).
Our study was to investigate whether DGCR5 was involved in cancer stem cells of NSCLC. DGCR5 was increased while miR‐330‐5p was decreased in CSCs enriched from NSCLC parental cells. It was speculated that lncRNA‐DGCR5 can promote CSC‐like properties by modulating miR‐330‐5p/CD44 axis.
2. MATERIALS AND METHODS
2.1. Cell culture
A549 cells, H460, H1299 cells, and HEK‐293T cells were obtained from American Type Culture Collection (ATCC, Manassas, VA). All the cells were indicated in RPMI 1640 medium with 10% heat‐inactivated fetal bovine serum (FBS, GIBCO, Carlsbad, CA), 100 U/ml penicillin and 100 mg/ml streptomycin. Cells were incubated at 37 °C in an appropriate incubator containing 5% CO2.
2.2. Lentiviral vector transfection
The shDGCR5 and DGCR5 sequences were designed using shLuc as the negative control (NC). The objective products were constructed into pcDNA3.1 (Invitrogen, Carlsbad, CA). The constructed vectors and the lentivirus packaging vectors (pMD2.G, pMDL‐G/P‐RRE) were co‐transfected into the cells for 48 hr, respectively. Cells seeded in 24‐well plates were transfected with lentivirus, using 8 µg/ml polybrene (Sigma, St. Louis, MO). LV‐shDGCR5, LV‐DGCR5, or their corresponding negative control was transduced into the cells. miR‐330‐5p mimics, inhibitors, or their parental negative controls were transfected into the cells or HEK‐293T cells.
2.3. Sphere formation assay
Cells were indicated with 10 ng/ml of human recombinant basic fibroblast growth factor (bFGF), and 20 ng/ml of epidermal growth factor (EGF) (R&D Systems, Minneapolis, MN) in serum‐free DMEM‐F12 (GIBCO, Carlsbad, CA) medium. Cells were treated every 48 hr and grown for 7 days.
2.4. Flow cytometry assay
For SP (side population) assay, cells were suspended in PBS and then cells were stained using 5 µg/ml Hoechst 33342 (Sigma, St. Louis, MO) with or without 50 µM verapamil (Sigma, St. Louis, MO) at 37 °C for 90 min. After that, cells were stained using 2 µg/ml propidium iodide (Sigma, St. Louis, MO). FACS AriaIII system (BD Biosciences, San Jose, CA) was emplyed. For CD44+ cell analysis, cells were washed, re‐suspended, and incubated at 4 °C for 30 min with fluorescence‐conjugated monoclonal antibodies obtained from BD Biosciences against human CD44 APC and its isotype IgG1.
2.5. qRT‐PCR
Total RNA was extracted by the RNAiso Plus, reverse transcribed by the Prime Script TM RT Master Mix and qPCR was carried out by SYBR Premix Ex Taq II (Takara Bio Technology, Dalian, China). The primers for qRT‐PCR were described in Table 1. The Applied Biosystems 7,900 Real Time PCR System (Applied Biosystems, Foster City, CA) was used to do Real‐time PCR. Fold change was measured by 2−ΔΔCt.
Table 1.
Primers used for real‐time PCR
| Genes | Forward(5′–3′) | Reverse(5′–3′) |
|---|---|---|
| GAPDH | CAAGGTCATCCATGACAACTTTG | GTCCACCACCCTGTTGCTGTAG |
| U6 | CTCGCTTCGGCAGCACA | AACGCTTCACGAATTTGCGT |
| DGCR5 | CACGAGTGTAGTGCCCAGTT | GGTCAGGGACCTTTGTCGTT |
| CD44 | TGAGCATCGGATTTGAGAC | CATACTGGGAGGTGTTGGA |
| miR‐330‐5p | TCTCTGGGCCTGTGTCTTAGGC | TTAATGGGGTGATTGGTGGT |
2.6. Luciferase activity assay
The wild‐type (WT) or mutant (MUT) DGCR5 binding hsa‐mir‐330‐5p was subcloned into pGL3 Basic vector (Promega, Madison, WI). Mimics of hsa‐mir‐330‐5p (RiboBio, Guangzhou, China) were cotransfected with 10 µg pLUC‐WT‐DGCR5 or pLUC‐MUT‐DGCR5. Similar protocols were performed to between CD44 hsa‐mir‐330‐5p. Luciferase activity was measured using the Dual‐Luciferase Reporter Assay System (Promega, Madison, WI).
2.7. RIP assay
RIP assay was conducted using Magna RIP Kit (EMD Millipore, Billerica, MA). Cells were lysed in RIP lysis buffer and magnetic beads conjugated to human anti‐Ago2 antibody (Millipore, Billerica, MA) or isotype‐matched control antibody (normal mouse IgG; Millipore, Billerica, MA) was added to the cell lysis.
2.8. RNA pull‐down assay
Purified RNAs were labeled by biotin using Pierce RNA 3′‐End Desthiobiotinylation Kit (Thermo Fisher Scientific, Waltham, MA). Cell lysates were indicated with positive control (biotin‐labeled wild‐type hsa‐mir‐330‐5p, hsa‐mir‐330‐5p‐Bio), negative control (mutant hsa‐mir‐330‐5p, hsa‐mir‐330‐5p‐Bio‐mut), and biotinylated RNAs (NC‐Bio). Magnetic beads were added to the binding reaction.
2.9. Western blot assay
A lysis buffer (Sigma) was used for protein extraction. Equal proteins were separated on 10% sodium dodecyl sulfate polyacrylamide gels. Separated proteins were then transferred onto PVDF membrane (Millipore, Billerica, MA). Primary antibodies were used to incubate the membranes at 4 °C and HRP—conjugated secondary antibodies were used to incubate the membranes for 1 hr. The primary antibodies used in our study were as followed: anti‐CD44 (1:500, Abcam, Cambridge, Britain) and anti‐GAPDH (1:500, Abcam, Cambridge, Britain).
2.10. Statistical analysis
Data were exhibited as the mean ± SD. Comparison between groups was analyzed using a Student's t‐test or one‐way analysis of variance (ANOVA). Differences were significant when the p value was less than 0.05. (*p < 0.05, **p < 0.01,). The SPSS 19.0 (SPSS Inc, Chicago, IL) and GraphPad Prism v6.0 (Graphpad Software Inc) were performed to do statistical analysis.
3. RESULTS
3.1. LncRNA‐DGCR5 was significantly elevated in lung CSCs
Tumor sphere formation assay using serum‐free medium (SFM) culturing has been used to isolate CSCs (Zhu et al., 2017). In our current study, tumor sphere formation assay was performed to isolate lung CSCs from three human lung cancer cell lines A549, H460, and H1299. After SFM culturing for 7 days, Western blotting assay and qRT‐PCR were used to test Sox2, Nanog, and Oct4 expression in A549 cells. We observed that both Sox2, Nanog, and Oct4 protein expression and mRNA levels were significantly increased in A549 tumor spheres cultured in SFM compared to serum‐supplied medium (SSM) (Figure 1a). In addition, side population (SP) cells are recognized to be a subgroup of cells, which can exhibit canonical stem cell characteristics (Ho, Ng, Lam, & Hung, 2007). Therefore, SP assay was used to isolate CSCs from NSCLC parental cells. Here, it was found that Sox2, Nanog, and Oct4 were also greatly elevated in CSCs of lung cancer (Figure 1b). Besides these, it was shown that DGCR5 levels were markedly up‐regulated in A549, H460, and H1299 tumor spheres cultured in SFM compared to SSM (Figure 1c‐e). Consistently, DGCR5 was greatly increased in lung CSCs (Figure 1f‐h). These data indicated that DGCR5 was up‐regulated in lung CSCs.
Figure 1.

DGCR5 was increased in lung CSCs. (a) Sox2, Nanog, and Oct4 expression in sphere‐forming A549. Cells were indicated in serum‐supplemented medium (SSM) and serum‐free medium (SFM) for 7 days. GAPDH was used as a loading control. (b) Sox2, Nanog, and Oct4 expression in A549 cells. SP assay was used to isolate SP positive and SP negative cells. DGCR5 expression in sphere‐forming A549 (c), H460 (d), and H1299 (e) cells. DGCR5 expression in A549 (f), H460 (g), and H1299 (h) cells. Three independent experiments were performed. Error bars stand for the mean ± SD of at least triplicate experiments. *p < 0.05, **p < 0.01
3.2. DGCR5 modulated the CSC–like traits of lung CSCs
To investigate the function of DGCR5 in lung CSCs, A549 cells were infected with LV‐NC, or LV‐shDGCR5. The qRT‐PCR assay indicated that LV‐shDGCR5 inhibited DGCR5 expression in A549 cells dramatically (Figure 2a). Moreover, protein and mRNA levels of lung CSCs markers, including Sox2, Nanog, and Oct4 were reduced greatly (Figure 2b). For another, LV‐DGCR5 was infected into A549 cells and we observed that DGCR5 was increased significantly (Figure 2c). Meanwhile, SP positive cell ratios in A549 cells were elevated by LV‐DGCR5 (Figure 2c). These data indicated that DGCR5 modulated the CSC‐like characteristics of NSCLC cells.
Figure 2.

DGCR5 modulated lung CSCs in vitro. (a) DGCR5 expression in A549 cells. A549 cells were infected with the negative control (NC) or LV‐shDGCR5. Quantitative real‐time PCR was used to detect the expression. (b) Protein and mRNA expression of Sox2, Nanog, and Oct4 in A549 cells. (c) DGCR5 expression in A549 cells. A549 cells were infected with the negative control (NC) or LV‐DGCR5. (d) SP positive cell ratios. Three independent experiments were performed. Error bars stand for the mean ± SD of at least triplicate experiments. *p < 0.05, **p < 0.01
3.3. DGCR5 directly targeted miR‐330‐5p in NSCLC cells
To explore the targeted microRNAs regulated by DGCR5, bioinformatics analysis, including ChipBase, LncRNAdb, and StarBase were employed and miR‐330‐5p was identified DGCR5 target. The complementary binding regions between miR‐330‐5p and DGCR5 were exhibited in Figure 3a. To validate that miR‐330‐5p is a direct target of DGCR5, luciferase reporter plasmids containing wild‐type (WT) DGCR5, and mutant (MUT) DGCR5 were constructed (Figure 3b). Cotransfection of the luciferase reporter plasmid containing the WT‐DGCR5 with miR‐330‐5p mimics into HEK‐293T cells resulted in a decreased reporter activity (Figure 3c). Subsequently, to determine whether DGCR5 can sponge miR‐330‐5p, RIP assay was carried out. DGCR5 and miR‐330‐5p were more abundant in Ago2 pellet compared to in IgG pellet in A549 cells (Figure 3d). In addition, RNA pull‐down assay using biotin‐labeled miR‐330‐5p (miR‐330‐5p‐bio) probe increased the expression of DGCR5 than control (NC‐bio) or miR‐330‐5p probes (Figure 3e). Besides these, in Figures 3f and 3g, to detect the altered expression of miR‐330‐5p regulated by DGCR5 in A549 cells, DGCR5 loss and gain functional assay was carried out. It was indicated that DGCR5 can regulate miR‐330‐5p expression negatively. Based on these results, we revealed that miR‐330‐5p served as a direct target of DGCR5.
Figure 3.

MiR‐330‐5p was a direct target of DGCR5. (a) Binding region between miR‐330‐5p and DGCR5. ChipBase, LncRNAdb, and StarBase were used. (b) The luciferase reporter constructs containing the wild‐type (WT‐DGCR5) or mutant DGCR5 (MUT‐DGCR5) sequence. (c) WT‐DGCR5 or MUT‐DGCR5 was cotransfected into HEK‐293T cells with miR‐330‐5p mimics or their corresponding negative controls. (d) The correlation between DGCR5 and Ago2 was assessed by RIP assay. Cellular lysates were immunoprecipitated using Ago2 antibody or IgG. SNRNP70 level was used as a positive control. (e) RNA pull‐down assay indicated the direct interaction between miR‐330‐5p and DGCR5. Cellular lysates were pulled down using biotinylated control (NC‐Bio), miR‐330‐5p (miR‐330‐5p‐Bio), or miR‐330‐5p probe containing mutations in the DGCR5‐binding site (miR‐330‐5p‐Bio‐mut). (f) Expression of miR‐330‐5p in A549 cells. The cells were infected with LV‐shDGCR5 or their parental NCs. After 48 hr, Quantitative real‐time PCR was carried out to test miR‐330‐5p expression. (g) Expression of miR‐330‐5p in A549 cells. The cells were infected with LV‐DGCR5 or their parental NCs. Three independent experiments were carried out. Error bars stand for the mean ± SD of at least triplicate experiments. *p < 0.05, **p < 0.01
3.4. MiR‐330‐5p inhibited stemness of NSCLC cells
After SFM culturing for 7 days, it was observed that miR‐330‐5p was decreased in lung CSCs by performing qRT‐PCR assay (Figure 4a‐c). Consistently, SP assay demonstrated that miR‐330‐5p was downregulated in SP positive cells (Figure 4d‐f). To investigate the role of miR‐330‐5p in CSC‐like traits in NSCLC, miR‐330‐5p mimics, inhibitors, or their negative controls were transfected into A549 cells. We found that CSC markers including Sox2, Nanog, and Oct4 expression was decreased by miR‐330‐5p mimics significantly (Figure 5a). miR‐330‐5p inhibitors greatly induced SP positive cell percentages in A549, H460, and H1299 cells (Figure 5b‐d). These data indicated that miR‐330‐5p might inhibit lung CSCs.
Figure 4.

MiR‐330‐5p was decreased in lung CSCs. miR‐330‐5p expression in sphere‐forming A549 (a), H460 (b), and H1299 (c) cells. Cells were indicated in serum‐supplemented medium (SSM) and serum‐free medium (SFM) for 7 days. U6 was used as a loading control. miR‐330‐5p expression in A549 (d), H460 (e), and H1299 (f) cells. SP assay was used to isolate SP positive and SP negative cells. Three independent experiments were performed. Error bars stand for the mean ± SD of at least triplicate experiments. *p < 0.05, **p < 0.01
Figure 5.

MiR‐330‐5p modulated lung CSCs. (a) Protein and mRNA expression of Sox2, Nanog, and Oct4 in A549 cells. Cells were transfected with miR‐330‐5p mimics for 48 hr. SP positive cell ratios in A549 (b), H460 (c), and H1299 (d) cells. Three independent experiments were performed. Error bars stand for the mean ± SD of at least triplicate experiments. *p < 0.05, **p < 0.01
3.5. CD44 was a direct target of miR‐330‐5p
Next, to investigate the detailed mechanism of miR‐330‐5p in lung CSCs, bioinformatics analysis including TargetScan, Starbase, miRanda, and miRDB database were performed to predict CD44 as the downstream target of miR‐330‐5p. The complementary binding sites between miR‐330‐5p and CD44 were exhibited in Figure 6a. Luciferase reporter plasmids of wild‐type CD44 and mutant CD44 binding sites were manifested in Figure 6b. Cotransfection of the luciferase reporter plasmid containing WT‐CD44 with miR‐330‐5p mimics in HEK‐293T cells led to a decreased reporter activity (Figure 6c). Besides these, it was shown that CD44 mRNA was down‐regulated by miR‐330‐5p mimics in NSCLC cells (Figure 6d). These findings indicated that CD44 can serve as a direct target of miR‐330‐5p.
Figure 6.

CD44 was a direct target of miR‐330‐5p. (a) Binding region between miR‐330‐5p and CD44. TargetScan, Starbase, miRanda, and miRDB database were employed to predict putative targets of miR‐330‐5p. (b) The luciferase reporter constructs containing the wild‐type (WT‐CD44) or mutant CD445 (MUT‐CD44) sequence. (c) WT‐CD44 or MUT‐CD44 was cotransfected into HEK‐293T cells with miR‐330‐5p mimics or their corresponding negative controls. (d) mRNA expression of CD44 in A549, H460, and H1299 cells. The cells were transfected with miR‐330‐5p mimics or their corresponding negative controls. After 48 hr, Quantitative real‐time PCR was carried out to test CD44 expression. Three independent experiments were carried out. Error bars stand for the mean ± SD of at least triplicate experiments. *p < 0.05, **p < 0.01
3.6. DGCR5 modulate CD44 through sponging miR‐330‐5p
To investigate whether CD44 can be mediated by DGCR5 in NSCLC, LV‐shDGCR5 was infected into NSCLC cell. LV‐shDGCR5 greatly inhibited CD44 expression (Figures 7a and 7b). Reversely, LV‐DGCR5 increased CD44 mRNA expression and induced CD44 positive cell populations in NSCLC cells (Figures 7c and 7d). These findings suggested that CD44 can be modulated by DGCR5 in which DGCR5 can sponge miR‐330‐5p.
Figure 7.

CD44 were positively regulated by DGCR5. (a) CD44 mRNA expression in NSCLC cells. Cells were infected with the negative control (NC) or LV‐shDGCR5. Quantitative real‐time PCR was used to detect the expression. (b) CD44 protein expression in NSCLC cells. Western blotting assay was used and GAPDH was a reference control. (c) CD44 mRNA expression in NSCLC cells. Cells were infected with the negative control (NC) or LV‐DGCR5. (c) CD44 positive cell populations in A549 cells. Three independent experiments were carried out. Error bars stand for the mean ± SD of at least triplicate experiments. *p < 0.05, **p < 0.01
4. DISCUSSION
Increasing studies have reported that lncRNAs can regulate various cellular processes in cancer, including the existence of cancer stem cells (Cai et al., 2017). In our current study, we observed that DGCR5 was increased in lung CSCs. DGCR5 inhibition can inhibit CSC‐like properties of NSCLC cells while DGCR5 overexpression exhibited a reverse phenomenon. In addition, we found that miR‐330‐5p was decreased in lung CSCs and a negative correlation between miR‐330‐5p and DGCR5 was indicated. Besides this, CD44 was predicted as a target of miR‐330‐5p. Therefore, we hypothesized that DGCR5 can contribute to stemness of NSCLC via modulating miR‐330‐5p and CD44 in vitro.
A lot of studies have identified cancer stem cells being a source of cancers. For instance, exostosin 1 can inhibit cancer cell stemness in breast cancer (Manandhar et al., 2017). GMI is able to ablate cancer stemness in oral cancer stem cells via inactivating IL‐6/Stat3 (Wang et al., 2017). Tumor sphere formation has been used to confirm the presence of thyroid CSCs in thyroid cancer cell lines (Nagayama, Shimamura, & Mitsutake, 2016). Serum‐free medium (SFM) culture in vitro has been used to enrich lung CSCs (Zhu et al., 2017). In addition, side population assay has been widely used to isolate CSC‐like cells from cancer cells and primary cells. From human lung cancer cell lines, SP assay can be performed to enrich stem‐like cancer cells (Ho et al., 2007). In our current study, in order to investigate the mechanism of CSCs in lung cancer, the SP assay, and tumor sphere formation were employed.
LncRNAs can regulate the initiation of cancers by mediating CSCs. For example, DANCR can induce osteosarcoma progression features by increasing AXL and binding to miR‐33a‐5p (Jiang et al., 2017). LncRNA FOXF1‐AS1 inhibition can regulate EMT and stemness NSCLC cells (Miao et al., 2016). LncRNA‐MALAT1 downregulation can inhibit stemness markers levels in glioma stem cell line (Han et al., 2016). DGCR5, which is also known as Linc00037, is a kind of lncRNA involved in Huntington's disease neurodegeneration, hepatocellular carcinoma, and lung cancer (Dong et al., 2018; Huang et al., 2016; Johnson, 2012). Here, we found that DGCR5 was increased in lung CSCs by performing SP assays and tumor sphere formation tests. DGCR5 silence can greatly inhibit CSC‐like properties in NSCLC. Expression of CSCs markers including Sox2, Nanog, and Oct4 was repressed by downregulation of DGCR5. In addition, overexpression of DGCR5 can enhance SP cell ratios of A549 cells.
MiRNAs can exert an important role in tumor initiation, progression, and metastasis. MicroRNA‐142‐5p can induce stemness of cutaneous squamous cell carcinoma (cSCC) via targeting PTEN (Bai, Zhou, Chen, Yang, & Xu, 2018). Downregulation of miR‐455‐3p can inhibit chemoresistance and ESCC progression (Liu, Yu et al., 2017). miR‐200b can regulate stemness of human hepatocellular carcinoma by targeting ZEB1 (Tsai et al., 2017). MiR‐7 can be targeted by HOTAIR, which can inhibit SETDB1, and breast CSCs by inhibiting STAT3 (Zhang et al., 2014). miR‐330‐5p can inhibit ITGA5 in human colorectal cancer (Yoo, Kim, & Yoon, 2016). miR‐330‐5p can enhance chemoradiotherapy sensitivity in oesophageal adenocarcinoma (Bibby, Reynolds, & Maher, 2015). In our study, we found that miR‐330‐5p expression was downregulated in lung CSCs and DGCR5 can modulate lung CSCs by sponging miR‐330‐5p. Additionally, miR‐330‐5p mimics can inhibit CSC‐like characteristics while miR‐330‐5p inhibitor exhibited a reverse process. In our future study, we will focus on whether miR‐330‐5p can modulate DGCR5 expression in lung cancer stem cells.
CD44 can serve as a downstream target of miR‐330‐5p in our study by carrying out bioinformatics analysis. CD44 has been reported to be involved in multiple cancers. CD44 is a multifunctional cell membrane receptor emerged as a cancer initiating or stem cell marker (Miletti‐Gonzalez et al., 2012). CD44 can regulate prostate cancer progression by targeting PDK1 and PFKFB4 (Li et al., 2017). miR‐221 can mediate CD44 in hepatocellular carcinoma via PI3K‐AKT‐mTOR signaling (Kim, Jiang, Badawi, & Schmittgen, 2017). MicroRNA‐145 can exert tumor‐suppressive roles and enhance chemotherapy sensitivity by inhibiting CD44 in gastric cancer (Zeng, Ma, Wang, & Wang, 2017). In NSCLC, miR‐143 can inhibit migration and invasion through targeting CD44 (Ma et al., 2013). Here, it was observed that CD44 was directly targeted by miR‐330‐5p and miR‐330‐5p can regulate CD44 expression negatively. Besides these, DGCR5 can modulate CD44 expression by sponging miR‐330‐5p in NSCLC. More studies are warranted to study the specific molecular mechanism of DGCR5 in NSCLC. In addition, in our future study, we are going to collect enough clinical samples and conduct animal studies to claim the effect of DGCR5 on NSCLC CSC characteristics.
Our findings in lung CSCs supported that DGCR5 can act as an oncogene, which is consistent to our previous report. This is the first reporting of a possible mechanism for an interaction between DGCR and miR‐330‐5p in lung CSCs. We exhibited that DGCR5 silence can inhibit CSC‐like phenotypes in NSLCL by sponging miR‐330‐5p and increasing CD44 expression. These data suggested a possibility of developing DGCR5 as a potential target for NSCLC.
CONFLICTS OF INTEREST
The authors declared no conflicts of interest.
Wang R, Dong H‐X, Zeng J, Pan J, Jin X‐Y. LncRNA DGCR5 contributes to CSC‐like properties via modulating miR‐330‐5p/CD44 in NSCLC. J Cell Physiol. 2018;233: 7447–7456. 10.1002/jcp.26590
Ren Wang and Hui‐Xing Dong contributed equally to this work.
Contributor Information
Jing Pan, Email: PJ1803@shtrhospital.com.
Xiao‐Yan Jin, Email: JXY0082@shtrhospital.com.
REFERENCES
- Bai, X. , Zhou, Y. , Chen, P. , Yang, M. , & Xu, J. (2018). MicroRNA‐142‐5p induces cancer stem cell‐like properties of cutaneous squamous cell carcinoma via inhibiting PTEN. Journal of Cellular Biochemistry, 119(2), 2179 –2188. 10.1002/jcb.26379 [DOI] [PubMed] [Google Scholar]
- Bartel, D. P. (2004). MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell, 116, 281–297. [DOI] [PubMed] [Google Scholar]
- Bibby, B. A. , Reynolds, J. V. , & Maher, S. G. (2015). MicroRNA‐330‐5p as a putative modulator of neoadjuvant chemoradiotherapy sensitivity in oesophageal adenocarcinoma. PLoS ONE, 10, e134180. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cai, Z. , Xu, K. , Li, Y. , Lv, Y. , Bao, J. , & Qiao, L. (2017). Long noncoding RNA in liver cancer stem cells. Discovery Medicine, 24, 87–93. [PubMed] [Google Scholar]
- Chi, H. C. , Tsai, C. Y. , Tsai, M. M. , Yeh, C. T. , & Lin, K. H. (2017). Roles of long noncoding RNAs in recurrence and metastasis of radiotherapy‐Resistant cancer stem cells. International Journal of Molecular Sciences, 18(9), pii: E1903. 10.3390/ijms18091903 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Deng, J. , Yang, M. , Jiang, R. , An, N. , Wang, X. , & Liu, B. (2017). Long non‐Coding RNA HOTAIR regulates the proliferation, self‐Renewal capacity, tumor formation, and migration of the cancer stem‐Like cell (CSC) subpopulation enriched from Breast cancer cells. PLoS ONE, 12, e170860. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- Ding, L. J. , Li, Y. , Wang, S. D. , Wang, X. S. , Fang, F. , Wang, W. Y. , … Qi, L. (2016). Long noncoding RNA lncCAMTA1 promotes proliferation and cancer stem cell‐like properties of liver cancer by inhibiting CAMTA1. International Journal of Molecular Sciences, 17(10), pii: E1617. 10.3390/ijms17101617 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dong, H. X. , Wang, R. , Zeng, J. , & Pan, J. (2018). LncRNA DGCR5 promotes lung adenocarcinoma (LUAD) progression via inhibiting hsa‐mir‐22‐3p. Journal of Cellular Physiology, 233(5), 4126 –4136. 10.1002/jcp.26215 [DOI] [PubMed] [Google Scholar]
- Esendagli, D. , & Gunel‐Ozcan, A. (2017). From stem cell biology to the treatment of lung diseases. Current Stem Cell Research and Therapy, 12, 493–505. [DOI] [PubMed] [Google Scholar]
- Feng, L. , Ma, J. , Ji, H. , Liu, Y. , & Hu, W. (2017). MiR‐330‐5p suppresses glioblastoma cell proliferation and invasiveness through targeting ITGA5. Bioscience Reports, 37(3). pii: BSR20170019. 10.1042/BSR20170019 [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- Fu, X. , Zhang, L. , Dan, L. , Wang, K. , & Xu, Y. (2017). LncRNA EWSAT1 promotes ovarian cancer progression through targeting miR‐330‐5p expression. American Journal of Translational Research, 9, 4094–4103. [PMC free article] [PubMed] [Google Scholar]
- Han, Y. , Zhou, L. , Wu, T. , Huang, Y. , Cheng, Z. , Li, X. , … Du, Z. (2016). Downregulation of lncRNA‐MALAT1 affects proliferation and the expression of stemness markers in glioma stem cell line SHG139S. Cellular and Molecular Neurobiology, 36, 1097–1107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Heery, R. , Finn, S. P. , Cuffe, S. , & Gray, S. G. (2017). Long non‐Coding RNAs: Key regulators of epithelial‐Mesenchymal transition, tumour drug resistance and cancer stem cells. Cancers (Basel), 9(4), pii: E38. 10.3390/cancers9040038 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ho, M. M. , Ng, A. V. , Lam, S. , & Hung, J. Y. (2007). Side population in human lung cancer cell lines and tumors is enriched with stem‐like cancer cells. Cancer Research, 67, 4827–4833. [DOI] [PubMed] [Google Scholar]
- Huang, R. , Wang, X. , Zhang, W. , Zhangyuan, G. , Jin, K. , Yu, W. , … Sun, B. (2016). Down‐Regulation of LncRNA DGCR5 correlates with poor prognosis in hepatocellular carcinoma. Cellular Physiology and Biochemistry, 40, 707–715. [DOI] [PubMed] [Google Scholar]
- Jiang, N. , Wang, X. , Xie, X. , Liao, Y. , Liu, N. , Liu, J. , … Peng, T. (2017). LncRNA DANCR promotes tumor progression and cancer stemness features in osteosarcoma by upregulating AXL via miR‐33a‐5p inhibition. Cancer Letters, 405, 46–55. [DOI] [PubMed] [Google Scholar]
- Johnson, R. (2012). Long non‐coding RNAs in Huntington's disease neurodegeneration. Neurobiology of Disease, 46, 245–254. [DOI] [PubMed] [Google Scholar]
- Kaira, K. , Takahashi, T. , Murakami, H. , Shukuya, T. , Kenmotsu, H. , Ono, A. , … Yamamoto, N. (2013). The role of betaIII‐tubulin in non‐small cell lung cancer patients treated by taxane‐based chemotherapy. International Journal of Clinical Oncology, 18, 371–379. [DOI] [PubMed] [Google Scholar]
- Ke, X. , Yuan, Y. , Guo, C. , Yang, Y. , Pu, Q. , Hu, X. , … Wei, Y. (2017). MiR‐410 induces stemness by inhibiting Gsk3beta but upregulating beta‐catenin in non‐small cells lung cancer. Oncotarget, 8, 11356–11371. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kim, J. , Jiang, J. , Badawi, M. , & Schmittgen, T. D. (2017). MiR‐221 regulates CD44 in hepatocellular carcinoma through the PI3K‐AKT‐mTOR pathway. Biochemical and Biophysical Research Communications, 487, 709–715. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liu, A. , Zhu, J. , Wu, G. , Cao, L. , Tan, Z. , Zhang, S. , … Li, J. (2017). Antagonizing miR‐455‐3p inhibits chemoresistance and aggressiveness in esophageal squamous cell carcinoma. Molecular Cancer, 16, 106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liu, C. , Liu, R. , Zhang, D. , Deng, Q. , Liu, B. , Chao, H. P. , … Tang, D. G. (2017). MicroRNA‐141 suppresses prostate cancer stem cells and metastasis by targeting a cohort of pro‐metastasis genes. Nature Communications, 8, 14270. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liu, W. , Yu, Q. , Ma, J. , Cheng, Y. , Zhang, H. , Luo, W., … Zhang, H. (2017). Knockdown of a DIS3L2 promoter upstream long noncoding RNA (AC105461.1) enhances colorectal cancer stem cell properties in vitro by down‐regulating DIS3L2. Onco Targets and Theraphy, 10, 2367–2376. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li, W. , Qian, L. , Lin, J. , Huang, G. , Hao, N. , Wei, X. , … Liang, J. (2017). CD44 regulates prostate cancer proliferation, invasion and migration via PDK1 and PFKFB4. Oncotarget, 8, 65143–65151. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Manandhar, S. , Kim, C. G. , Lee, S. H. , Kang, S. H. , Basnet, N. , & Lee, Y. M. (2017). Exostosin 1 regulates cancer cell stemness in doxorubicin‐resistant breast cancer cells. Oncotarget, 8, 70521–70537. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ma, Q. , Jiang, Q. , Pu, Q. , Zhang, X. , Yang, W. , Wang, Y. , … Zhu, W. (2013). MicroRNA‐143 inhibits migration and invasion of human non‐small‐cell lung cancer and its relative mechanism. International Journal of Biological Sciences, 9, 680–692. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Miao, L. , Huang, Z. , Zengli, Z. , Li, H. , Chen, Q. , Yao, C. , … Wang, Y. (2016). Loss of long noncoding RNA FOXF1‐AS1 regulates epithelial‐mesenchymal transition, stemness, and metastasis of non‐small cell lung cancer cells. Oncotarget, 7, 68339–68349. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Miletti‐Gonzalez, K. E. , Murphy, K. , Kumaran, M. N. , Ravindranath, A. K. , Wernyj, R. P. , Kaur, S. , … Scotto, K. (2012). Identification of function for CD44 intracytoplasmic domain (CD44‐ICD): Modulation of matrix metalloproteinase 9 (MMP‐9) transcription via novel promoter response element. The Journal of Biological Chemistry, 287, 18995–19007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nagayama, Y. , Shimamura, M. , & Mitsutake, N. (2016). Cancer stem cells in the thyroid. Front Endocrinolgy (Lausanne), 7, 20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sheng, S. R. , Wu, J. S. , Tang, Y. L. , & Liang, X. H. (2017). Long noncoding RNAs: Emerging regulators of tumor angiogenesis. Future Oncology, 13, 1551–1562. [DOI] [PubMed] [Google Scholar]
- Siegel, R. , Naishadham, D. , & Jemal, A. (2012). Cancer statistics, 2012. CA: A Cancer Journal for Clinicians, 62, 10–29. [DOI] [PubMed] [Google Scholar]
- Tsai, S. C. , Lin, C. C. , Shih, T. C. , Tseng, R. J. , Yu, M. C. , Lin, Y. J. , & Hsieh, S. Y. (2017). The miR‐200b‐ZEB1 circuit regulates diverse stemness of human hepatocellular carcinoma. Molecular Carcinogenesis, 56, 2035–2047. [DOI] [PubMed] [Google Scholar]
- Wang, T. Y. , Yu, C. C. , Hsieh, P. L. , Liao, Y. W. , Yu, C. H. , & Chou, M. Y. (2017). GMI ablates cancer stemness and cisplatin resistance in oral carcinomas stem cells through IL‐6/Stat3 signaling inhibition. Oncotarget, 8, 70422–70430. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wu, J. , & Wang, D. (2017). Long noncoding RNA TCF7 promotes invasiveness and self‐renewal of human non‐small cell lung cancer cells. Human Cell, 30, 23–29. [DOI] [PubMed] [Google Scholar]
- Yoo, H. I. , Kim, B. K. , & Yoon, S. K. (2016). MicroRNA‐330‐5p negatively regulates ITGA5 expression in human colorectal cancer. Oncology Reports, 36, 3023–3029. [DOI] [PubMed] [Google Scholar]
- Zakaria, N. , Satar, N. A. , Abu, H. N. , Ngalim, S. H. , Yusoff, N. M. , Lin, J. , & Yahaya, B. H. (2017). Targeting lung cancer stem cells: Research and clinical impacts. Front Oncology, 7, 80. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zeng, J. F. , Ma, X. Q. , Wang, L. P. , & Wang, W. (2017). MicroRNA‐145 exerts tumor‐suppressive and chemo‐resistance lowering effects by targeting CD44 in gastric cancer. World Journal of Gastroenterology, 23, 2337–2345. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang, H. , Cai, K. , Wang, J. , Wang, X. , Cheng, K. , Shi, F. , … Dou, J. (2014). MiR‐7, inhibited indirectly by lincRNA HOTAIR, directly inhibits SETDB1 and reverses the EMT of breast cancer stem cells by downregulating the STAT3 pathway. Stem Cells, 32, 2858–2868. [DOI] [PubMed] [Google Scholar]
- Zhu, J. , Jiang, Y. , Yang, X. , Wang, S. , Xie, C. , Li, X. , … Wu, J. (2017). Wnt/beta‐catenin pathway mediates (−)‐Epigallocatechin‐3‐gallate (EGCG) inhibition of lung cancer stem cells. Biochemical and Biophysical Research Communications, 482, 15–21. [DOI] [PubMed] [Google Scholar]
- Zou, Y. , Huang, Y. , Yang, J. , Wu, J. , & Luo, C. (2017). MiR‐34a is downregulated in human osteosarcoma stem‐like cells and promotes invasion, tumorigenic ability and self‐renewal capacity. Molecular Medicine Reports, 15, 1631–1637. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
