Skip to main content
NCBI home page
Wiley Open Access Collection logoLink to Wiley Open Access Collection
. 2018 Mar 25;233(9):7067–7079. doi: 10.1002/jcp.26508

Bulleyaconitine A prevents Ti particle‐induced osteolysis via suppressing NF‐κB signal pathway during osteoclastogenesis and osteoblastogenesis

Liwei Zhang 1,2, Mingxuan Feng 3, Zhiyan Li 1,2, Min Zhu 2, Yongyong Fan 1, Binxiang Chu 1,2, Chiting Yuan 1, Lihua Chen 2, Haiyan Lv 2, Zhenghua Hong 1,✉, Dun Hong 1,✉
PMCID: PMC13482421  PMID: 29388671

Abstract

Balanced bone resorption and bone formation are vital for bone homeostasis. Excessive osteoclastic bone resorption in this process can cause a variety of bone disorders including osteoporosis, aseptic prosthetic loosening and tumor associated bone destruction. Bulleyaconitine A (BLA) is a natural compound that has been widely used for pain treatment but its role in osteolysis has not yet been investigated. In this study, we verified for the first time that BLA inhibited osteoclast formation, the mRNA expression of osteoclast‐related genes and osteoclastic bone resorption by inhibiting NF‐κB signal pathway and downstream NFATc1 expression. Meanwhile, BLA had a stimulatory effect in osteoblast differentiation and mineralization. Furthermore, BLA showed preventive effect in Ti particle‐induced osteolysis model in vivo. Together, all our data demonstrated that BLA suppressed osteoclastogenesis and promoted osteoblastogenesis via suppressing NF‐κB signal pathway and could be an alternative therapeutic choice against bone loss.

Keywords: bulleyaconitine A, NF‐κB signal pathway, osteoblast, osteoclast, osteolysis

Bulleyaconitine A prevents Ti particle‐induced osteolysis by preventing osteoclast formation and promoting osteoblast differentiation.

graphic file with name JCP-233-7067-g005.jpg

1. INTRODUCTION

Osteoclast is the only known cell that is capable of resorbing bone in our human body (Teitelbaum, 2000). Balanced osteoclast‐mediated bone resorption and osteoblast‐mediated bone formation are important for bone homeostasis (Zhou et al., 2016). However, excessive osteoclastic bone resorption is crucial for a variety of bone disorders including osteoporosis, aseptic prosthetic loosening and tumor associated bone destruction. Aseptic prosthetic loosening has been regarded as the major long‐term complication of total hip and knee joint replacement (Wooley & Schwarz, 2004). Implant debris including polymethylmethacrylate (PMMA) and titanium particles due to the persistent friction at the joint‐bone interface have been considered as the leading cause of this complication (Kadoya, Kobayashi, & Ohashi, 1998; Maloney & Smith, 1996). Macrophages that engulf these particles can subsequently release proinflammatory cytokines including TNF‐α, IL‐1, IL‐6, and IL‐8, which can in turn promote osteoclast formation and thus result in peri‐implant bone loss. Similarly, low bone mass and impaired bone structure due to the osteoclastic bone resorption are critical for osteoporosis. Enhanced osteoclast formation in postmanopausal women causes excessive bone matrix resorption and therefore results in less bone mass and fragile bone mechanical property. With the importance of osteoclasts in these bone diseases, searching for compounds targeting osteoclasts is of interests for the treatment of these diseases (Abu‐Amer, Darwech, & Clohisy, 2007; Wooley & Schwarz, 2004).

Activation of multiple signaling pathways such as NF‐κB, ERK, JNK, and p38 is essential for osteoclast differentiation during RANKL induction (Boyce, 2013). Among those, NF‐κB signaling is essential for osteoclast differentiation as knockout of NF‐κB subunits impaired osteoclastogenesis (Franzoso et al., 1997; Iotsova et al., 1997). In the unstimulated cells, NF‐κB proteins locate in the cytoplasm combined with inhibitory κB proteins (IκB). Upon RANKL stimulation, the phosphorylation and subsequent degradation of IκB following activation of IκB kinases (IKK) led to NF‐κB nucleus translocation, thus NF‐κB binds to DNA target sites to initiate osteoclast‐specific gene transcription (Kim & Kim, 2016). Besides, NF‐κB regulates NFATc1 expression during osteoclastogenesis, which following influences c‐Fos and V‐ATPase d2 expression (Kim, Lee, Ha, Choi, & Kim, 2008; Takatsuna et al., 2005; Yamashita et al., 2007).

Natural compounds play significant roles in the field of traditional Chinese medicine, and have been widely used for the treatment of bone metabolic disorders. For instance, natural compound icariin has been proved to protect osteoporosis by promoting osteoblast mineralization and inhibiting osteoclast bone resorption (Cui et al., 2014; Wang et al., 2016). Besides, recent finding have revealed that pilose antler peptide and oridonin potentiate osteogenesis and suppress osteoclastogenesis via inhibiting the p65 nuclear translocation of NF‐κB pathway (Liu et al., 2017; Xie et al., 2017). Therefore, further identifying other natural compounds that have protective effects on osteolytic diseases may provide alternative therapeutic choices for the treatment of these diseases.

Given the potential of natural compounds for the treatment of bone diseases, our group had screened a series of natural compounds and identified bulleyaconitine A (BLA) as a potential candidate. BLA is an active ingredient that is extracted from Aconitum bulleyanum plants and has curative effect in analgesia and anti‐inflammation (Weng et al., 2005; Xiong, Zhai, & Yao, 2014). In addition, it has been used to treat chronic pain by blocking the voltage‐dependent sodium channels (VGSCs) in state‐dependent manner (Li, Fan, & Wang, 2016; Wang, Gerner, Wang, & Wang, 2007;) and stimulating dynorphin A to eliminate pain hypersensitivity and morphine tolerance in afferent neurons (Li, Wu, Wang, Li, & Wang, 2017). However, the effects of BLA on bone cells such as osteoclast and osteoblast have not yet been defined. Hence, the objective of our study was to reveal the pharmacological action of BLA on bone cells and identify its underlying mechanism.

2. MATERIALS AND METHODS

2.1. Media and reagents

Bulleyaconitine A was purchased from Meilunbio® (Dalian, China. HPLC ≥ 98%) and dissolved in Dimethylsulfoxide (DMSO). The α‐minimum essential medium (α‐MEM), penicillin/streptomycin, and foetal bovine serum (FBS) were obtained from Gibco BRL (Grand Island, NY). Mouse recombinant macrophage‐colony stimulating factor (M‐CSF) and receptor activator for nuclear factor‐κB ligand (RANKL) were purchased from PeproTech (London, UK). MTT Cell Proliferation and Cytotoxicity Assay Kit was supplied by Beyotime Biotechnology (Haimen, China). Specific antibodies against p65, p‐p65, IκBα, p‐IκBα, NFATC1, and GAPDH were obtained from Cell Signaling Technology (Cambridge, MA) and Absin Bioscience (Shanghai, China). Tartrate‐resistant acid phosphatase (TRAP) staining kit was obtained from Sigma–Aldrich (St. Louis, MO).

2.2. Cell culture

Bone marrow cells (BMCs) were collected from both femurs and tibias of 6‐week‐old C57BL/6 mice. To obtain bone marrow‐derived macrophages/monocyte (BMMs), BMCs were then incubated in complete α‐MEM with 30 ng/ml M‐CSF in incubator for 1 day. Nonadherent cells were then transfered to 6‐cm petri dishes and further cultured until reaching 90% confluence. Bone marrow mesenchymal stem cells (BMSCs) were harvested from the femurs and tibias of Wistar rats as previously described (Deliloglu‐Gurhan, Vatansever, Ozdal‐Kurt, & Tuglu, 2006; Shen et al., 2012). To further induce osteoblast differentiation, BMSCs were incubated in complete α‐MEM medium with 50 µg/ml ascorbic acid, 10 mM glycerophosphate, and 100 nM dexamethasone.

2.3. Cell viability assay

The effect of BLA on the viability of BMMs and BMSCs was examined by MTT cell proliferation and cytotoxicity assay kit. BMMs were seeded in 96‐well plates at a density of 8,000 cells/well in triplicate in complete α‐MEM supplemented with 30 ng/ml M‐CSF for 24 hr, then the cells were treated with different concentrations of BLA for 48, 96, and 144 hr. BMSCs were seeded at a density of 7,000 cells/well in 96‐well plates in complete medium with different concentrations of BLA for the same interval. MTT assay was then performed according to the direction.

2.4. Osteoclastogenesis assay in vitro

To generate mature osteoclasts, BMMs were seeded in a 96‐well plate at a density of 8,000 cells/well in triplicate, and incubated in complete medium containing 30 ng/ml M‐CSF for 12 hr. Then the BMMs were treated with 50 ng/ml RANKL and different concentrations of BLA (0, 2.5, 5, and 10 µM). The cell culture medium was replaced every other day until mature osteoclasts formed. After being washed twice with phosphate‐buffered saline (PBS) and fixed with 4% paraformaldehyde for 20 min, the cells were stained with TRAP staining kit. TRAP‐positive cells with more than three nuclei were counted as osteoclasts under a microscope.

2.5. Quantitative reverse transcription‐polymerase chain reaction (RT‐PCR)

RT‐PCR was used to investigate the effect of BLA on the specific gene expression during osteoclast formation and osteoblast differentiation. Total RNA was extracted with TRIzon reagent (Cwbiotech, Beijing, China) according to the specification. To obtain cDNA, equal amount of RNA was reverse‐transcribed into cDNA by using first strand cDNA synthesis kit with oligo‐dT primer (TaKaRa, Dalian, China). For relative quantitative real‐time PCR (qPCR), the total volume (20 µl) of each PCR reaction comprised by 10 µl SYBR Green qPCR Mix, 8 µl ddH2O, 1 µl cDNA, and 0.5 µl of each primer. Real‐time PCR was performed by an ABI 7500 Sequencing Detection System (Applied Biosystems, Foster City, CA) in triplicate according to the protocol. The GAPDH gene was used to normailze the quantity of each target. All the results of relative changes in gene expression from PCR experiments were analyzed by 2−ΔΔCT method as reported previously (Livak & Schmittgen, 2001). The sequences of specific primers used to detect the target genes were listed in Table 1.

Table 1.

Sequences of primers used in real‐time polymerase chain reaction (Real‐time PCR)

Gene Primer sequences (5′‐3′)
CTSK Forward CTTCCAATACGTGCAGCAGA
Reverse TCTTCAGGGCTTTCTCGTTC
CTR Forward TGCAGACAACTCTTGGTTGG
Reverse TCGGTTTCTTCTCCTCTGGA
V‐ATPase‐a3 Forward AATCATGGACGACTCCTTGG
Reverse GGCCACCTCTTCACTCCGGAA
TRAP Forward CACTCCCACCCTGAGATTTGT
Reverse CCCCAGAGACATGATGAAGTCA
DC‐STAMP Forward AAAACCCTTGGGCTGTTCTT
Reverse AATCATGGACGACTCCTTGG
NFATc1 Forward CCGTTGCTTCCAGAAAATAACA
Reverse TGTGGGATGTGAACTCGGAA
V‐ATPase‐d2 Forward AAGCCTTTGTTTGACGCTGT
Reverse TTCGATGCCTCTGTGAGATG
c‐Fos Forward CCAGTCAAGAGCATCAGCAA
Reverse AAGTAGTGCAGCCCGGAGTA
RUNX 2 Forward GCCTTCAAGGTTGTAGCCCT
Reverse GGACCGTCCACTGTCACTTT
OPN Forward TGTTCCTACCAAGATTATACCAAAT
Reverse CGCTCGATTTGCAGGTCTTT
OCN Forward CTTGAAGACCGCCTACAAACC
Reverse GCTGCTGTGACATCCATAC
ALP1 Forward CGGACAATGAGATGCGCCC
Reverse AGACATAGTGGGAGTGCTTGTG
GAPDH Forward ACCCAGAAGACTGTGGATGG
Reverse CACATTGGGGGTAGGAACAC
Open in a new tab

2.6. Bone resorption assay in vitro

BMMs were seeded at a density of 2.4 × 104 cells/cm2 with complete α‐MEM medium containing 30 ng/ml M‐CSF. After 24 hr, the cells were stimulated by 50 ng/ml RANKL for 3 days. Then the cells were seeded onto bovine bone slices in triplicate with 0, 2.5, and 10 µM BLA and maintained for additional 3 days. After eliminating adherent cells from the slices by 5% sodium hypochlorite for 5 min, the plates were washed with PBS and dried. Resorption pits were visualized by a scanning electron microscope, and the bone resorption area was quantified by ImageJ software (v.1.51). Meanwhile, the cells that had already been stimulated by 50 ng/ml RANKL for 3 days were seeded onto six‐well plate. After adhered, the cells were treated with 50 ng/ml RANKL and 0, 2.5, 10 µM BLA for additional 3 days. Total RNA of each well was extracted for qRT‐PCR to evaluate the effect of BLA on bone resorption‐related genes expression.

2.7. Western blotting analysis

BMMs were seeded in six‐well plates at a density of 2 × 105 cells/well. After pretreated with 0 or 10 µM BLA for 2 hr, BMMs were stimulated with 50 ng/ml RANKL for 0, 5, 10, 20, 30, 60 min. In addition to further determine the effect of BLA on NF‐κB signal pathway and downstream NFATc1 expression, BMMs were treated under 50 ng/ml RANKL with 0, 2.5, 5, and 10 µM BLA for 3 days. To measure the effect of BLA on osteoblast mineralization, BMSCs were treated with osteogenic media and 0, 5, 10 µM BLA for 3 days. Total protein of each sample was extracted using Radio Immunoprecipitation Assay (RIPA) buffer (Beyotime, Shanghai, China) supplemented with Phenylmethanesulfonyl fluoride (PMSF) and phosphatase inhibitor (Medchemexpress, Princeton, NJ), and then protein concentration was determined by BCA protein assay kit (Beyotime, Shanghai, China). Equal amounts of protein lysates were separated on 10% SDS–PAGE gels and electroblotted onto PVDF membranes (Bio‐Rad, Hercules, CA). After being blocked in 5% nonfat dry milk, the membranes were incubated with primary antibodies at 4 °C overnight and then horseradish peroxidase‐conjugated secondary antibodies (Beyotime, Shanghai, China) for 1 hr at room temperature. The antibody reactivity was visualized by electrochemical luminescence reagent (Millipore, Billerica, MA) and ImageQuant LAS 500 (GE Health Care, Fairfield, CT). Quantitative analysis of the band intensity was quantified by ImageJ software.

2.8. Dual luciferase reporter assay

To measure the NF‐κB transcription activity, BMMs and BMSCs were seeded in 24‐well plates at a density of 1 × 105 cells/well. After reaching 90% confluence, cells were transfected with 1 µg of pGL4.32[luc2P/NF‐κB‐RE/Hygro] vector and 0.1 µg renilla luciferase reporter plasmid pRL‐SV40 (Promega, Madison, WI) using Lipo6000™ Transfection Reagent (Beyotime Biotechnology, Haimen, China) following the manufacturer's protocol. The pRL‐SV40 was served as an internal control to normalize the transfection efficiency and adjust the results from firefly luciferase activities. After 18 hr, the BMMs and BMSCs were pre‐treated with 0, 2.5, 5, 10 µM BLA for 2 hr, followed by 100 ng/ml RANKL stimulation for 8 hr in BMMs and osteogenic media for 16 hr in BMSCs. To detect luciferase activity, the cells were washed twice with PBS, lysed with 1× passive lysis buffer, and the cell lysate was then mixed with luciferase assay substrate using Dual Luciferase Reporter Gene Assay Kit (Beyotime Biotechnology, Haimen, China). The firefly luciferase and renilla luciferase activities were measured by fluorescence spectrophotometer according to the manufacturer's instructions.

2.9. Osteoblast differentiation and mineralization in vitro

For osteoblastogenesis assays, BMSCs were plated into 12‐well plates with complete medium. When confluent, cells were treated with osteogenic media described as above and different concentrations of BLA. Alkaline phosphatase (ALP) and alizarin red staining were performed using a staining kit (Beyotime, Shanghai, China) after 7 and 14 days respectively.

2.10. Ti particle‐induced murine calvarial osteolysis model in vivo

The animal experiments were approved by the Institutional Animal Ethics Committee of Taizhou Hospital. Eight‐week‐old male C57BL/6 mice were randomly and evenly divided into four experimental groups containing five mice each: sham group, vehicle group, BLA‐Low group, and BLA‐High group. After anesthetized by abdominal injection with 10% chloral hydrate, 30 mg Ti particles were embedded below the periosteum which is at the middle sutural line of the murine skulls apart from sham group. Then the mice were injected intraperitoneally with PBS (sham group and vehicle group) or BLA (0.15 mg/kg in BLA‐Low group and 0.30 mg/kg in BLA‐High group) every other day for 14 days. At the end of the experiment, all the mice were euthanized, then calvaria were separated and fixed in 4% paraformaldehyde for further histological and micro‐CT analysis.

2.11. Micro‐CT scan

The entire calvarial analysis were performed by a high‐resolution micro‐CT (µCT100, Scanco Medical, Brüttisellen, Switzerland). The scanning procedure was set at an equidistant resolution of 20 µm with 70 kV and 200 µA energy X‐ray with an exposure time of 300 ms. After three‐dimensional (3D) image reconstruction, a square region of interest (ROI) was then selected around the middle sutural line of skull. Bone volume/tissue volume (BV/TV), the proportion of total porosity of each sample were tested using scanco µ100 evaluation (Switzerland).

2.12. Histological and histomorphometric analysis

After fixated by 4% paraformaldehyd, the calcium of calvaria samples was removed by immersing in 10% EDTA for 3 weeks, and then the calvaria samples were embedded in paraffin wax. Histological samples were prepared for H&E and TRAP staining using standard procedures. After that, the photographs of the specimens were obtained using a high‐quality Olympus microscope. Then the quantity and area of TRAP+ osteoclasts with multi‐nucleus were tested. The results were analyzed using Image‐Pro Plus 7.0 software (Media Cybernetics).

2.13. RNA extraction from skulls

The skulls were cut according the ROI region, then pretreated by liquid nitrogen. Each sample was placed in 1.5 ml centrifuge tube with three nuclease‐free stainless steel particles. All the centrifuge tubes were transfered to TissueLyser (Jinxin Industrial Development Company, Shanghai, China) and shaken for 2 min at 60 Hz. Then 1 ml TRIzon reagent was added in each tube. After being shaken for 2 min at 60 Hz the second time, the RNA purification and cDNA synthesis were performed as above.

2.14. Statistical analysis

All values were presented as mean ± standard deviation (SD) from at least three independent experiments. Analysis of variance (ANOVA) with Dunnett's post‐hoc test was used for comparisons between the groups using SPSS 19.0 software (IBM Corp., Armonk, NY). p values less than 0.05 indicated a significant difference between groups.

3. RESULTS

3.1. BLA suppressed RANKL‐induced osteoclast formation in vitro

The cytotoxicity of BLA on BMMs was initially examined by 3‐(4,5)‐dimethylthiahiazo (‐z‐y1)‐3,5‐di‐phenytetrazoliumromide (MTT) assay. As shown in Figure 1a–c, BLA significantly inhibited BMMs viability at 200 µM after 48, 96, and 144 hr. However, no cytotoxicitywas observed at concentrations under 100 µM at these time points.

Figure 1.

Figure 1

Open in a new tab

BLA suppressed RANKL‐induced osteoclast formation without cytotoxicity. (a–c) Viability of BLA‐treated BMMs tested by MTT at 48, 96, and 144 hr. (d) BMMs were treated with varying concentrations of BLA for 5 days and then subjected to TRAP staining. (e and f) The numbers and areas of osteoclasts from (d) were measured. (g) BMMs were treated with or without 5 µM BLA followed by 30 ng/ml M‐CSF and 50 ng/ml RANKL for 3, 5, and 7 days and BMMs were subjected to TRAP staining. (h and i) The numbers and areas of osteoclasts from (g) were measured. (** p < 0.01)

To investigate the effect of BLA on osteoclast formation, we stimulated BMMs by RANKL with 0, 2.5, 5, or 10 µM BLA. After 5 days incubation, characteristic multinucleated osteoclasts (more than three nuclei and TRAP‐positive) were formed from BMMs in the control group. However, in the groups with BLA treatments, the number of osteoclasts decreased from 274.33 ± 12.01/well (BLA 0 µM) to 9.00 ± 2.00/well (BLA 10 µM), and the total area of osteoclasts dropped from 87.27 ± 2.46% (BLA 0 µM) to 2.53 ± 0.55% (BLA 10 µM) (Figure 1d–f). Subsequently, BMMs were cultured under RANKL treatment with 0 or 5 µM of BLA for 3, 5, 7 days, respectively. Osteoclast formation was significantly inhibited by 5 µM BLA after 3 days (Figure 1g–i). The inhibitory effect of BLA on RANKL‐induced osteoclastogenesis was both in dose‐ and time‐dependent manner.

3.2. BLA suppressed RANKL‐induced osteoclast‐specific gene expression in vitro

To further elucidate the inhibitory effects of BLA on osteoclast formation, we explored its effect on the expression of the osteoclast‐related marker genes. Under BLA treatment, the expressions of osteoclast‐specific genes including cathepsin K (CTSK), calcitonin receptor (CTR), V‐ATPase‐a3, TRAP, and dendritic cell‐specific transmembrane protein (DC‐STAMP), were suppressed dose‐dependently (Figure 2a–e).

Figure 2.

Figure 2

Open in a new tab

BLA suppressed RANKL‐induced osteoclast‐specific gene expression and bone resorption. (a–e) BMMs were cultured for 5 days until mature osteoclasts formed with 0, 2.5, 5, and 10 µM BLA, 30 ng/ml M‐CSF, and 50 ng/ml RANKL, then the osteoclast‐specific gene expression was measured using RT‐PCR. (f) BMMs were treated by 30 ng/ml M‐CSF, 50 ng/ml RANKL for 3 days. Then the The cells were gently harvested using cell dissociation solution, seeded onto bovine bone slices in triplicate with 0, 2.5, and 10 µM BLA and maintained for additional 3 days. The imagines of bone resorption pits were shown by scanning electron microscope (SEM). (g) Resorption pit areas were measured. (h–l) BMMs were treated by 30 ng/ml M‐CSF, 50 ng/ml RANKL for 3 days. When the osteoclast began to form, the cells were treated with 0, 2.5, and 10 µM BLA and maintained for additional 3 days, then the bone resorption‐related genes expressions were measured using qRT‐PCR. (* p < 0.05, ** p < 0.01)

3.3. BLA inhibited osteoclastic bone resorption in vitro

As BLA suppressed osteoclastogenesis and RANKL‐induced osteoclastic marker gene expression, we examined whether BLA could inhibit bone resorption in vitro. Large bone resorptions were formed in the control group, but the number and area of bone resorption in the group treated with 2.5 µM BLA decreased nearly 85% compared to the control group. Bone resorption was almost completely abrogated by BLA at 10 µM (Figures 2f and 2g). These results suggested that BLA suppressed bone resorption in vitro concentration‐dependently. Besides, though osteoclast began to form after RANKL stimulation for 3 days, BLA suppressed bone resorption‐related genes including CTSK, TRAP, V‐ATPase‐d2, NFATc1, and c‐FOS expression which is consistent with the bone resorption assay (Figure 2h–l).

3.4. BLA inhibited RANKL‐stimulated activation of NF‐κB signal pathway

To identify which signal pathway was impacted by BLA during osteoclastogenesis, we examined whether BLA was capable of suppressing RANKL‐induced NF‐κB activation. BMMs were pre‐treated with 0 or 10 µM BLA for 2 hr, then stimulated with 50 ng/ml RANKL for 0, 5, 10, 20, 30, and 60 min. The results showed that BLA suppressed phosphorylation and degradation of IκBα significantly at 10 µM compared to the control group (Figure 3a–d).

Figure 3.

Figure 3

Open in a new tab

BLA inhibited RANKL‐stimulated activation of NF‐κB signal pathway. (a and b) BMMs were pretreated with 10 µM BLA for 2 hr, then stimulated with RANKL (100 ng/ml) for 0, 5, 10, 20, 30, and 60 min, then the proteins were extracted for Western blot analyses using antibodies against GAPDH, IκBα, and p‐ IκBα antibodies. (c and d) The relative densitometry units of IκBα and p‐IκBα in (a and b) were quantified and normalized to GAPDH using ImageJ. (e) BMMs were stimulated by RANKL (100 ng/ml) with 0, 2.5, 5, and 10 µM BLA for 3 days, then the proteins were extracted for Western blot analyses using antibodies against GAPDH, IκBα, p‐IκBα, p65, and p‐p65 antibodies. (f and h) The relative densitometry units of IκBα, p‐IκBα, and p‐p65/p65 in (e) were quantified and normalized to GAPDH using ImageJ. (i) After transfected with pGL4.32 vector and pRL‐SV40 vector, BMMs were pre‐treated with 0, 2.5, 5, 10 µM BLA for 2 hr, followed by 100 ng/ml RANKL stimulation for 8 hr. The cell lysate was then mixed with luciferase assay substrate to measure luciferase activity. (j–l) BMMs were cultured until mature osteoclasts formed with 0, 2.5, 5, and 10 µM BLA, 30 ng/ml M‐CSF, and 50 ng/ml RANKL, then the NF‐κB signal pathway downstream related‐gene expression was measured using RT‐PCR. (m) BMMs were treated by 0 or 100 ng/mL RANKL with 0 or 10 µM BLA for 3 days, then the proteins were extracted for Western blot analyses using antibodies against GAPDH and NFATc1antibodies. (n) The relative densitometry units of NFATc1 in (l) were quantified and normalized to GAPDH using Image J. (* p < 0.05, ** p < 0.01)

To further confirm the inhibitory effect of BLA on NF‐κB signal pathway, BMMs were stimulated by RANKL with 0 or 10 µM BLA for 3 days. As shown in Figure 3e, RANKL stimulation led to significant phosphorylation and degradation of IκBα with following phosphorylation of p65 in the control cells. However, this process was greatly suppressed by BLA treatment. These results were confirmed by further quantitative analysis (Figure 3f–h). Besides, NF‐κB luciferase reporter assay showed that treatment with BLA prior to RANKL stimulation resulted in a significant reduction in NF‐κB luciferase activity(Figure 3i).

Due to the important role of NFATc1 for initiating osteoclast differentiation and known as a pathway downstream component of NF‐κB signal pathway, we detected the expression of NFATc1 under BLA treatment. BMMs were treated under RANKL with 0 or 10 µM BLA, the expressions of NFATc1 both in mRNA level and protein level were detected after 3 days. As expected, the expression of NFATc1 genes and related genes including c‐Fos and V‐ATPase‐d2 were significantly reduced following BLA treatment (Figure 3j–l). Consistent with RT‐PCR results, Western blotting further confirmed the inhibitory effect of BLA on NFATc1 expression under RANKL stimulation (Figures 3m and 3n). Taken together, all these results confirmed that BLA suppressed the NF‐κB signal pathway and downstream NFATc1 expression.

3.5. BLA promoted osteoblast differentiation and osteoblastic‐specific genes expression

The growth, development and metabolism of normal skeletal structure are collaboration between osteoclast‐mediated bone resorption and osteoblast‐mediated bone formation. The above results had suggested that BLA inhibited osteoclast formation and function effectively via blocking NF‐κB signal pathway, and this signal pathway had an inhibitory effect in osteoblasts differentiation and mineralization, so we further investigated whether BLA could promote osteoblast differentiation. BMSCs were isolated for the proliferation assay and osteoblast differentiation experiments. MTT assay showed that BLA promoted BMSCs proliferation at the doses more than 5 µM (Figure 4a–c). ALP staining after 7 days osteoinductive culture and alizarin red staining after 14 days osteoinductive culture showed significant difference between control and BLA treated groups (Figure 4d–g). The mRNA expressions of osteoblast differentiation markers including RUNX 2, ALP1, OCN, and OPN were explored, and showed promotive effect of BLA on osteoblast‐associated genes expression (Figure 4h). Besides, the effect of BLA on NF‐κB signal pathway during osteoblast differentiation was investigated. Western blot showed that BLA hindered phosphorylation and degradation of IκBα and following phosphorylation of p65, and NF‐κB luciferase reporter assay further confirmed the inhibitory effect of BLA on NF‐κB activities. Based on these data, BLA promoted osteoblast differentiation and osteoblastic‐specific genes expression via hindering NF‐κB signal pathway.

Figure 4.

Figure 4

Open in a new tab

BLA promoted osteoblast differentiation and osteoblastic‐specific genes expression. (a–c) Viability of BLA‐treated BMSCs tested by MTT at 48, 96, and 144 h. (d and e) BMSCs were cultured in differentiation medium with 0 or 10 µM BLA for 7 days and subjected to alkaline phosphatase (ALP) staining. (f and g) BMSCs were cultured in differentiation medium with 0 or 10 µM BLA for 14 days and subjected to alizarin red staining. (h) BMSCs were cultured in differentiation medium with 0 or 10 µM BLA for 7 days, then the osteoblast‐specific gene expression was analyzed by RT‐PCR. (i) BMSCs were treated with osteogenic media and 0, 5, 10 µM BLA for 3 days and then the proteins were extracted for Western blot analyses using antibodies against GAPDH, IκBα, p‐IκBα, p65, and p‐p65 antibodies. (j) The relative densitometry units of IκBα, p‐IκBα, and p‐p65/p65 in (i) were quantified and normalized to GAPDH using ImageJ. (k) After transfected with pGL4.32 vector and pRL‐SV40 vector, BMSCs were treated with 0, 2.5, 5, 10 µM BLA for 18 hr. The cell lysate was then mixed with luciferase assay substrate to measure luciferase activity. (*p < 0.05, **p < 0.01)

3.6. BLA suppressed Ti particle‐induced murine calvarial osteolysis in vivo

According to the above results, BLA suppressed osteoclast formation and function with stimulative effect in osteoblast differentiation and mineralization in vitro, we developed a Ti particle‐induced osteolysis model to identify the preventive effect of BLA on osteolysis in vivo. The mice in BLA‐treated group were injected with 0.15 mg/kg or 0.3 mg/kg BLA every other day for 2 weeks. Compared to the sham group, the vehicle group observed severe bone resorption by using micro‐CT scans and 3D reconstruction, while BLA prevented Ti particle‐induced osteolysis notably (Figure 5a). Quantification of bone parameters including BV/TV and porosity percentage exemplified that the bone loss in the vehicle group (BV/TV: 0.373 ± 0.042%) was significantly reduced by treatment of 0.15 mg/kg BLA (BV/TV: 0.497 ± 0.021%) and 0.3 mg/kg BLA (BV/TV: 0.541 ± 0.032%) (Figures 5b and 5c). Histological examination further confirmed that BLA suppressed osteolysis induced by Ti particles. H&E staining showed that bone resorption had clearly appeared in vehicle group, while BLA treatment reduce bone loss significantly (Figure 5d). In accordance with H&E staining and micro‐CT results, TRAP staining showed that osteoclasts in sections were reduced under BLA treatment compared to the vehicle group (Figure 5e). In addition, osteoclast surface/bone surface (Oc.S/BS) and TRAP positive cell number were decreased in BLA‐treated groups as compared with the vehicle group (Figures 5f and 5g).

Figure 5.

Figure 5

Open in a new tab

BLA suppressed Ti particle‐induced murine calvarial osteolysis. (a) Micro‐CT 3D reconstructed images were obtained for each group. (b and c) The BV/TV and porosity percentage of each group was measured. (d and e) After fixed, decalcified, dehydrated and sectioned, the calvarial sections were stained with H&E and TRAP. (f and g) The Oc.S/BS and TRAP positive number of tissue were analysed. (h–k) Total RNA was extracted from skull and then reverse‐transcribed into cDNA. The expressions of osteoclast and osteoblast‐related genes were measured by qRT‐PCR. (*p < 0.05, **p < 0.01)

Meanwhile, we investigated the expressions of osteoclast and osteoblast related genes in mRNA levels in skulls. The qRT‐PCR results showed that BLA inhibited osteoclast‐related CTR and CTSK genes expressions, promoted osteoblast‐related RUNX2 and OCN genes expression (Figure 5h–k).

4. DISCUSSION

Excessive osteoclast‐induced bone resorption is critical for both periprosthetic osteolysis and osteoporosis, and osteoclast is the major target for these diseases (Langdahl, Ferrari, & Dempster, 2016; Teitelbaum, 2000). Indeed, specific agents that target formation and function of osteoclasts provide effective therapeutic means for the treatment of these diseases. For example, bisphosphonates are effective for the prevention and treatment of osteoporosis, as well as periprosthetic osteolysis (Verron & Bouler, 2014). Recently, a humanized monoclonal antibody against RANKL, Denosumab, has been proved to be a safe and efficient treatment of osteoporosis and tumor associated bone metastasis (Miyazaki, Tokimura, & Tanaka, 2014). Due to the limitations of these synthesized compounds or humanized antibodies, screening and identifying of natural compounds that contain abilities to inhibit bone resorption and induct bone formation are of great interests. As described above, pilose antler peptide and oridonin are identified as drugs that treat overactive bone resorption‐related diseases through blocking the p65 nuclear translocation of NF‐κB pathway, which leads to impediment of osteoclastogenesis and promotion of osteoblastogenesis. Therefore, as alternative therapeutic strategies, natural compounds targeting NF‐κB pathway are needed.

Here in our study, we demonstrated for the first time that plant‐derived BLA can effectively inhibit osteoclast differentiation and function, evidenced by decreased TRAP‐postive osteoclast formation, reduced osteoclast specific gene expression, and impaired osteoclast bone resorptiopn in vitro. Based on the results of TRAP staining, qRT‐PCR and bone resorption assay, BLA affected osteoclast maturation process on early, mid and late differentiation stages equally, which means the commitment, differentiation and fusion steps of osteoclast can be hindered by BLA. In addition, we found promotive effect of BLA on osteoblast differentitation and mineralization in vitro. These findings indicated BLA is a potential candidate for the treatment of osteolytic diseases, which not only suppresses osteoclast function but also promotes osteoblast differentiation. Indeed, in our Ti particle‐induced murine calvarial osteolysis model, we observed less Ti particle‐induced bone loss after BLA treatment. Together, our in vitro and in vivo data suggested that BLA is a promising anti‐osteoclast compounds for the treatment of osteolytic diseases.

The underlying mechanisms of how BLA affect osteoclast formation was further explored. By western bolt and dual NF‐κB luciferase reporter assay in this experiment, we demonstrated an inhibitory effect of BLA on NF‐κB activation via blocking IκBα phosphorylation and degradation in osteoclast differentiation, which subsequently affects p65 phosphorylation and downstream gene expression including NFATc1, c‐fos, and V‐ATPase d2 (Feng et al., 2009). Interestingly, the activation of NF‐κB in osteoblasts was reported to suppress osteoblast differentition and mineralization (Liu et al., 2011). After performing western blot and NF‐κB luciferase reporter assay in osteoblast mineralization, the role of BLA in osteoblast differentition was also identified. Therefore, inhibition of BLA on NF‐κB signal pathway was regarded to have add‐on effect by inhibiting osteoclast function but enhancing osteoblast function. Admittedly, the effects of BLA on other signaling pathways including MAPK, p38, JNK, and sodium channels need further exploration.

It's worth noting that NF‐κB signal pathway is vital both in osteoclastogenesis and osteoblastogenesis. In osteoclasts and their precursors, RANKL induced significant activation both in classical and alternative NF‐κB signal pathway (Novack, 2011). In classical NF‐κB signal pathway, activation of NF‐κB is caused by releasing RelA(p65)/p50 heterodimer to translocate into the nucleus following phosphorylation of IKK and degradation of IκBα. Deletions of IKK2 and p52/p50 result in a defect of osteoclastogenesis (Franzoso et al., 1997; Ruocco et al., 2005). As to the alternative NF‐κB pathway, IKKα activates following NF‐κB‐inducing kinase (NIK) is stabilized caused by RANKL stimulation, which leads to generation of p52 from p100 and then formation of RelB/p52 heterodimer (Sun, 2011). Though the status of NF‐κB pathway activation has been well defined in osteoclast differentiation, there is a still debate of NF‐κB activation in osteoblast differentiation. Inhibition of NF‐κB signal pathway caused increased trabecular bone mass and bone mineral density in young mice or prevented bone loss after ovariectomy in adult mice (Chang et al., 2009). However, the role of NF‐κB activation caused by extracellular stimulation such as TNF‐α in osteoblast differentiation is still in debate. In the TNF‐α or TNF‐α receptor 1‐deficient mice, bone formation, bone mass increased and bone resorption was not changed. In BMSCs or MC3T3‐E1 cells, 10 ng/ml TNF‐α significantly inhibited osteoblast differentiation via suppressing Runx2 expression (Li et al., 2007). However, other studies showed quite different results that BMP2 and Runx2 expression elevated under 20 ng/ml TNF‐α treatment during osteogenic differentiation (Hess, Ushmorov, Fiedler, Brenner, & Wirth, 2009). And osteoblast differentiation in human adipose tissue‐derived stem cells was also enhanced by TNF‐α, LPS, or peptidoglycan which are extracellular NF‐κB stimulators (Croes et al., 2015). Our study showed that BLA promoted osteogenic differentiation in BMSCs under osteogenic media without any extracellular NF‐κB stimulators, and this controversial finding in these reports could be caused by the exposure time and dose of NF‐κB stimulators, cell types, or other unclear mechanism involving NF‐κB stimulators. Besides, many articles had showed Chinese medicine monomer including pilose antler peptide and oridonin potentiate could potentiate osteoblast differentiation and inhibit osteoclastogenesis via manipulating the NF‐κB pathway (Liu et al., 2017; Xie et al., 2017).

In conclusion, our data suggest BLA, a tranditional compound used for analgesia, has a new potential therapeutic effect against osteoclast‐related dieases. Combining with its antinociceptive effect, BLA can be specially suitable for preventing bone loss in the patients with the need for pain relief.

ACKNOWLEDGMENTS

This study is supported by Natural Science Foundation of Zhejiang Province (LY17H160068, LY16H070008), Experimental Animal Science Project of Zhejiang Province (2018C37123), Medical and Health Technology Development Program of Zhejiang Province (2016KYB324, 2015KYB443) and the “151 Talent Project“ of Zhejiang Province.

Contributor Information

Zhenghua Hong, Email: 0001hzh@163.com.

Dun Hong, Email: hongdun@aliyun.com.

REFERENCES

  1. Abu‐Amer, Y. , Darwech, I. , & Clohisy, J. C. (2007). Aseptic loosening of total joint replacements: Mechanisms underlying osteolysis and potential therapies. Arthritis Research and Therapy, 9(Suppl 1), S6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Boyce, B. F. (2013). Advances in the regulation of osteoclasts and osteoclast functions. Journal of Dental Research, 92(10), 860–867. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Chang, J. , Wang, Z. , Tang, E. , Fan, Z. , McCauley, L. , Franceschi, R. , … Wang, C. Y. (2009). Inhibition of osteoblastic bone formation by nuclear factor‐kappaB. Nature Medicine, 15(6), 682–689. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Croes, M. , Oner, F. C. , Kruyt, M. C. , Blokhuis, T. J. , Bastian, O. , Dhert, W. J. , & Alblas, J. (2015). Proinflammatory mediators enhance the osteogenesis of human mesenchymal stem cells after lineage commitment. PLoS ONE, 10(7), e0132781. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Cui, J. , Zhu, M. , Zhu, S. , Wang, G. , Xu, Y. , & Geng, D. (2014). Inhibitory effect of icariin on Ti‐induced inflammatory osteoclastogenesis. Journal of Surgical Research, 192(2), 447–453. [DOI] [PubMed] [Google Scholar]
  6. Deliloglu‐Gurhan, S. I. , Vatansever, H. S. , Ozdal‐Kurt, F. , & Tuglu, I. (2006). Characterization of osteoblasts derived from bone marrow stromal cells in a modified cell culture system. Acta Histochemica, 108(1), 49–57. [DOI] [PubMed] [Google Scholar]
  7. Feng, H. , Cheng, T. , Steer, J. H. , Joyce, D. A. , Pavlos, N. J. , Leong, C. , … Zheng, M. H. (2009). Myocyte enhancer factor 2 and microphthalmia‐associated transcription factor cooperate with NFATc1 to transactivate the V‐ATPase d2 promoter during RANKL‐induced osteoclastogenesis. Journal of Biological Chemistry, 284(21), 14667. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Franzoso, G. , Carlson, L. , Xing, L. , Poljak, L. , Shores, E. W. , Brown, K. D. , … Siebenlist, U. (1997). Requirement for NF‐κB in osteoclast and B‐celldevelopment. Genes and Development, 11(24), 3482–3496. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Hess, K. , Ushmorov, A. , Fiedler, J. , Brenner, R. E. , & Wirth, T. (2009). TNFalpha promotes osteogenic differentiation of human mesenchymal stem cells by triggering the NF‐kappaB signaling pathway. Bone, 45(2), 367. [DOI] [PubMed] [Google Scholar]
  10. Iotsova, V. , Caama, J. , Loy, J. , Yang, Y. , Lewin, A. , & Bravo, R. (1997). Osteopetrosis in mice lacking NF‐kB1 and NF‐kB2. Nature Medicine, 3(11), 1285–1289. [DOI] [PubMed] [Google Scholar]
  11. Kadoya, Y. , Kobayashi, A. , & Ohashi, H. (1998). Wear and osteolysis in total joint replacements. Acta Orthopaedica Scandinavica. Supplementum, 278, 1–16. [PubMed] [Google Scholar]
  12. Kim, J. H. , & Kim, N. (2016). Signaling pathways in osteoclast differentiation. Chonnam Medical Journal, 52(1), 12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Kim, K. , Lee, S. H. , Ha, K. J. , Choi, Y. , & Kim, N. (2008). NFATc1 induces osteoclast fusion via up‐regulation of Atp6v0d2 and the dendritic cell‐specific transmembrane protein (DC‐STAMP). Molecular Endocrinology, 22(1), 176. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Langdahl, B. , Ferrari, S. , & Dempster, D. W. (2016). Bone modeling and remodeling: Potential as therapeutic targets for the treatment of osteoporosis. Therapeutic Advances in Musculoskeletal Disease, 8(6), 225–235. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Li, Y. , Li, A. , Strait, K. , Zhang, H. , Nanes, M. S. , & Weitzmann, M. N. (2007). Endogenous TNFalpha lowers maximum peak bone mass and inhibits osteoblastic Smad activation through NF‐kappaB. Journal of Bone and Mineral Research, 22(5), 646. [DOI] [PubMed] [Google Scholar]
  16. Li, T. F. , Fan, H. , & Wang, Y. X. (2016). Aconitum‐derived bulleyaconitine a exhibits antihypersensitivity through direct stimulating dynorphin A expression in spinal microglia. The Journal of Pain, 17(5), 530–548. [DOI] [PubMed] [Google Scholar]
  17. Li, T. F. , Wu, H. Y. , Wang, Y. R. , Li, X. Y. , & Wang, Y. X. (2017). Molecular signaling underlying bulleyaconitine A (BAA)‐induced microglial expression of prodynorphin. Scientific Reports, 7, 45056. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Liu, L. , Shao, L. , Li, B. , Chen, Z. , Li, J. , Zheng, Q. , … Wang, J. (2011). Extracellular signal‐regulated kinase1/2 activated by fluid shear stress promotes osteogenic differentiation of human bone marrow‐derived mesenchymal stem cells through novel signaling pathways. International Journal of Biochemistry and Cell Biology, 43(11), 1591. [DOI] [PubMed] [Google Scholar]
  19. Liu, G. , Ma, C. , Wang, P. , Zhang, P. , Qu, X. , Liu, S. , … Yang, H. (2017). Pilose antler peptide potentiates osteoblast differentiation and inhibits osteoclastogenesis via manipulating the NF‐κB pathway. Biochemical and Biophysical Research Communications, 491(2), 388–395. [DOI] [PubMed] [Google Scholar]
  20. Livak, K. , & Schmittgen, T. (2001). Analysis of relative gene expression data using real‐time quantitative PCR and the 2−ΔΔCT method. Methods, 25(4), 402–408. [DOI] [PubMed] [Google Scholar]
  21. Maloney, W. J. , & Smith, R. L. (1996). Periprosthetic osteolysis in total hip arthroplasty: The role of particulate wear debris. Instructional Course Lectures, 45, 171–182. [PubMed] [Google Scholar]
  22. Miyazaki, T. , Tokimura, F. , & Tanaka, S. (2014). A review of denosumab for the treatment of osteoporosis. Patient Prefer Adherence, 8, 463–471. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Novack, D. V. (2011). Role of NF‐kappaB in the skeleton. Cell Research, 21(1), 169–182. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Ruocco, M. G. , Maeda, S. , Jin, M. P. , Lawrence, T. , Hsu, L. C. , Cao, Y. , … Karin, M. (2005). IκB kinase (IKK)β, but not IKKα, is a critical mediator of osteoclast survival and is required for inflammation‐induced bone loss. Journal of Experimental Medicine, 201(10), 1677–1687. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Shen, Y. , Feng, Z. , Lin, C. , Hou, X. , Wang, X. , Wang, J. , … Sun, X. (2012). An oligodeoxynucleotide that induces differentiation of bone marrow mesenchymal stem cells to osteoblasts in vitro and reduces alveolar bone loss in rats with periodontitis. International Journal of Molecular Sciences, 13(3), 2877–2892. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Sun, S. C. (2011). Non‐canonical NF‐κB signaling pathway. Cell Research, 21(1), 71–85. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Takatsuna, H. , Asagiri, M. , Kubota, T. , Oka, K. , Osada, T. , Sugiyama, C. , … Takayanagi, H. (2005). Inhibition of RANKL‐induced osteoclastogenesis by (−)‐DHMEQ, a novel NF‐kappa B inhibitor, through downregulation of NFATc1. Journal of Bone and Mineral Research, 20(4), 653–662. [DOI] [PubMed] [Google Scholar]
  28. Teitelbaum, S. L. (2000). Bone resorption by osteoclasts. Science, 289(5484), 1504–1508. [DOI] [PubMed] [Google Scholar]
  29. Verron, E. , & Bouler, J. M. (2014). Is bisphosphonate therapy compromised by the emergence of adverse bone disorders? Drug Discovery Today, 19(3), 312–319. [DOI] [PubMed] [Google Scholar]
  30. Wang, C. F. , Gerner, P. , Wang, S. Y. , & Wang, G. K. (2007). Bulleyaconitine A isolated from aconitum plant displays long‐acting local anesthetic properties in vitro and in vivo. Anesthesiology, 107(1), 82–90. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Wang, J. , Tao, Y. , Ping, Z. , Zhang, W. , Hu, X. , Wang, Y. , … Yang, H. (2016). Icariin attenuates titanium‐particle inhibition of bone formation by activating the Wnt/β‐catenin signaling pathway in vivo and in vitro. Scientific Reports, 6, 23827. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Weng, W. , Xu, H. , Huang, J. , Wang, G. , Shen, T. , & Zhang, J. (2005). Determination of bulleyaconitine A in human plasma by liquid chromatography‐electrospray ionization tandem mass spectrometry. Journal of Chromatography B, Analytical Technologies in the Biomedical and Life Sciences, 816(1–2), 315–320. [DOI] [PubMed] [Google Scholar]
  33. Wooley, P. H. , & Schwarz, E. M. (2004). Aseptic loosening. Gene Therapy, 11(4), 402–407. [DOI] [PubMed] [Google Scholar]
  34. Xie, Z. , Yu, H. , Sun, X. , Tang, P. , Jie, Z. , Chen, S. , … Fan, S. (2017). A novel diterpenoid suppresses osteoclastogenesis and promotes osteogenesis by inhibiting Ifrd1‐ and IκBα‐mediated p65 nuclear translocation. Journal of Bone and Mineral Research. 10.1002/jbmr.3334 [DOI] [PubMed] [Google Scholar]
  35. Xiong, X. , Zhai, S. , & Yao, Z. (2014). Sensitive quantification of bulleyaconitine A in human serum by liquid chromatography‐tandem mass spectrometry. Bioscience, Biotechnology, and Biochemistry, 73(7), 1572–1577. [DOI] [PubMed] [Google Scholar]
  36. Yamashita, T. , Yao, Z. , Li, F. , Zhang, Q. , Badell, I. R. , Schwarz, E. M. , … Matsuo, K. (2007). NF‐kB p50 and p52 regulate RANKL and TNF‐induced osteoclast precursor differentiation by activating c‐Fos and NFATc1. Journal of Biological Chemistry, 282(25), 18245–18253. [DOI] [PubMed] [Google Scholar]
  37. Zhou, L. , Liu, Q. , Yang, M. , Wang, T. , Yao, J. , Cheng, J. , … Tickner, J. (2016). Dihydroartemisinin, an anti‐malaria drug, suppresses estrogen deficiency‐induced osteoporosis, osteoclast formation, and RANKL‐induced signaling pathways. Journal of Bone and Mineral Research, 31(5), 964. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Cellular Physiology are provided here courtesy of Wiley

RESOURCES