Abstract
Many studies have verified that microRNAs contribute a lot to neuropathic pain progression. Furthermore, nerve‐related inflammatory cytokines play vital roles in neuropathic pain progression. miR‐183 has been identified to have a common relationship with multiple pathological diseases. However, the potential effects of miR‐183 in the process of neuropathic pain remain undetermined. Therefore, we performed the current study with the purpose of finding the functions of miR‐183 in neuropathic pain progression using a chronic sciatic nerve injury (CCI) rat model. We demonstrated that miR‐183 expression levels were evidently reduced in CCI rats in contrast with the control group. Overexpression of miR‐183 produced significant relief of mechanical hyperalgesia, as well as thermal hyperalgesia in CCI rats. Furthermore, neuropathic pain‐correlated inflammatory cytokine expression levels containing interleukin‐6 (IL‐6) and interleukin‐1β (IL‐1β), cyclooxygenase‐2 (COX‐2) were obviously inhibited by upregulation of miR‐183. Meanwhile, dual‐luciferase reporter assays showed MAP3K4 was a direct downstream gene of miR‐183. The expression levels of MAP3K4 were modulated by the increased miR‐183 negatively, which lead to the downregulation of IL‐6, IL‐1β, and COX‐2, and then reduced neuropathic pain progression, respectively. Overall, our study pointed out that miR‐183 was a part of the negative regulator which could relieve neuropathic pain by targeting MAP3K4. Thus it may provide a new clinical treatment for neuropathic pain patients clinical therapy.
Keywords: inflammatory cytokine, MAP3K4, miR‐183, neuropathic pain
-
1.
miR‐183 relieved neuroinflammation and repressed neuropathic pain in vivo.
-
2.
MAP3K4 was negatively regulated by miR‐183 in vivo.
-
3.
MAP3K4 reversed the negative effects of miR‐183 on neuropathic pain in vivo

1. INTRODUCTION
Neuropathic pain is chronic pain due to the injuries or damages in the somatosensory system (Xia, Ke, & Lu, 2018). It has a prevalence between 6.9% and 10% approximately in the total population around the whole world (van Hecke, Austin, Khan, Smith, & Torrance, 2014). Neuropathic pain could be induced by many incentive causes, such as toxicity, surgery, trauma, and so on (Lema, Foley, & Hausheer, 2010; Niederberger & Geisslinger, 2008). Although many studies have made efforts for the prognosis and treatments of neuropathic pain, the molecular mechanisms of neuropathic pain were not clearly enough until now. It is certainly needed to explore more therapeutic treatments of neuropathic pain.
Inflammation‐correlated biomarkers are cytokines that play significant roles in neuropathic pain progression (Chang, Cooper, & Clark, 2013; Kiguchi, Kobayashi, & Kishioka, 2012). Enormous inflammations involved in the central nervous system were correlated with various kinds of neuropathic pain (Ellis & Bennett, 2013; Sommer, Leinders, & Üçeyler, 2018). On the one hand, these inflammations could modulate neuronal cell damage and regeneration (Beattie et al., 2004). On the other side, it can lead to neuropathic pain through neural‐immune interactions (Myers, Campana, & Shubayev, 2006). Interleukin‐6 (IL‐6), interleukin‐1β (IL‐1β), and cyclooxygenase‐2 (COX‐2) are frequently included in neuropathic pain progression.
MicroRNAs (miRNAs) are those noncoding RNAs with 21–25 nucleotides. miRNAs can bind to the 3′‐untranslated region (UTR) of target messenger RNAs (mRNAs) and then modulated its expression (Bartel, 2009). Accumulating studies have proved that miRNAs contribute a lot to neuropathic pain progression. For instance, miRNA‐155 affects neuropathic pain development via targeting SGK3 (Liu, Zhu, Sun, & Xie, 2015). miRNA‐190a‐5p is involved in neuropathic pain through the downregulation of SLC17A6 (Yang et al., 2017). miRNA‐26a‐5p oppositely affects the expression level of MAPK6 and regulates neuropathic pain (Zhang et al., 2018). miRNA‐381 acts as an inhibitor in neuropathic pain development through targeting HMGB1 and CXCR4 (Zhan et al., 2018).
Currently, miR‐183 has been authenticated that it has a place in neuropathic pain development (Peng et al., 2017). Furthermore, our study was performed to find more functions of miR‐183 in neuropathic pain progression. Overall, we found that miR‐183 expression levels were decreased obviously in chronic sciatic nerve injury (CCI) rats. What's more, the upregulation of miR‐183 relieved neuropathic pain by downregulating inflammation‐correlated biomarkers. Moreover, we supposed that the increased miR‐183 relieved neuropathic pain through inhibition of MAP3K4.
2. MATERIALS AND METHODS
2.1. Animal studies
Twenty‐four Sprague–Dawley adult rats, which were female and weighed 180–210 g were achieved from Shanghai Animal Laboratory Center. All rats were raised up under a constant environment at 25℃ and were separated at random into two groups after raised for 1 week. The two groups were normal control group and CCI group, respectively. After rats in the CCI group were injured in the nerve system, the spinal cord tissues were taken out for the following research. All experimental procedures in our study were strictly performed according to the claims of the Guide for Care and Use of Laboratory Animals of the National Institutes of Health.
2.2. Cell culture
Rat microglial cells and human embryonic kidney HEK‐293T cells were purchased from the American Type Culture Collection (Manassas, VA). Cells were obtained in Dulbecco's modified Eagle medium (Yuanpei, Shanghai, China). Ten percent heat‐inactivated fetal bovine serum (Invitrogen, Carlsbad, CA) and 1% penicillin/streptomycin (Sigma, St. Louis, MO) were both supplemented into the above culture medium. The incubating environment including 5% CO2 and 37℃ was prepared for the cells.
2.3. Neuropathic pain animal model
CCI method was employed to set up the neuropathic pain animal model in rats (Li et al., 2013). First, 40 mg/kg sodium pentobarbital was used to anesthetize the rats. Then the sciatic nerves on both sides were exposed, separated, and with (the control group) or without ligation (the CCI group). On Day 0, 3, 7, 14, and 21, we harvested the spinal cords of L4‐L6 for the following experiments.
2.4. Intrathecal injection
First, paralysis of bilateral hind limbs was performed in all rats, with whose cisterna magna was injected by lidocaine. The PE‐10 ployethylene catheter was used to transfer lidocaine. 72 hr before the CCI surgery, the following recombinant lentivirus, including LV‐miR‐183, LV‐miR‐183 + LV‐MAP3K4, and their negative control (LV‐NC) were injected via an intrathecal catheter into the rats using a microinjection syringe.
2.5. Quantitative reverse transcription‐polymerase chain reaction (qRT‐PCR)
We used the RNAiso Plus (Takara Biotechnology, Dalian, China) to obtain all RNAs. And the Prime Script RT Master Mix was used to reverse transcribe RNA. We used SYBR Premix Ex Taq II (Takara Biotechnology) to perform quantitative PCR (qPCR). Total primers used in our study were the following: glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) forward, 5′‐GACTCATGACCACAGTCCATGC‐3′ and reverse, 5′‐AGAGGCAGGGATGATGTTCTG‐3′; MAP3K4 forward, 5′‐CTCGACAGATGAAACGCATGT‐3′ and reverse, 5′‐CCAGTGTCTTTATGTGGAGGC‐3′. miR‐183 expression levels were evaluated with the help of All‐in‐One™ miRNA qRT‐PCR Detection Kit (GeneCopoeia, Rockville, MD). Finally, real‐time qPCR was performed on the Applied Biosystems 7900 RealTime PCR System (Applied Biosystem, Foster City, CA).
2.6. Pain threshold assessment
The mechanical allodynia of neuropathic pain was assessed by the paw withdrawal threshold. More concretely, the plantar surface of each hind paw was exposed to the pressure. Then we recorded the time of paw withdrawal responding to the pressure. Thermal hyperalgesia was assessed by paw withdrawal latency through radiant heat. A thermal paw stimulation system was employed in this process. The time of duration between the stimuli start over and paw withdrawal was counted.
2.7. Transfection
HEK‐293T cells in our study were transfected with miR‐183 mimics (mimic‐miR‐183) or negative control (mimic‐NC) separately. And rat microglial cells were transfected with LV‐NC, LV‐miR‐183, or LV‐miR‐183 + LV‐MAP3K4 separately. We obtained the above Lentiviruses from GenePharma (Shanghai, China).
2.8. Luciferase activity assay
MAP3K4 3′‐UTRWT or MAP3K4 3′‐UTRMUT binding miR‐183 was subcloned into PGL3 basic vector which containing the luciferase reporter gene. Mimic‐miR‐183 or mimic‐NC was cotransfected with 10 μg of WT‐MAP3K4 or MUT‐MAP3K4 vector solution into HEK‐293T cells.
2.9. Enzyme‐linked immunosorbent assay
ELISA kits (R&D Systems, Minneapolis, MN) were carried out to measure the protein expression levels of IL‐6, IL‐1β, and COX‐2.
2.10. Western blot analysis
Total proteins harvested from tissues or cells were run on 8% sodium dodecyl sulfate‐polyacrylamide gels. Separated proteins were then transferred by the polyvinylidene difluoride membrane. The membrane was followed by 1 hr blocking in 5% defatted milk. We then added the primary antibodies into membranes and incubated the membranes overnight at 4℃. After three times washing by TBST, the membranes were then incubated with the secondary antibodies for 1 hr. The anti‐MAP3K4 and anti‐GAPDH were purchased from Sigma.
2.11. Statistical analysis
The SPSS 19.0 was utilized for this analysis. Data were the average of three independent experiments and were represented as the mean ± standard deviation. We used Student's t test and one‐way analysis of variance analysis to compare between different groups. The p < .05 was considered to be significant statistically.
3. RESULTS
3.1. miR‐183 was repressed in CCI rats
To identify whether miR‐183 was expressed abnormally in neuropathic pain progression, the expression levels of miR‐183 in the spinal cord L4‐L6 of rats were measured using qRT‐PCR. miR‐183 in CCI rats was decreased evidently comparing with the control group (Figure 1a). And then, we upregulated miR‐183 by injecting LV‐miR‐183 into rats. miR‐183 was significantly overexpressed in the CCI group with the infection of LV‐miR‐183 in contrast to the CCI group with the infection of LV‐NC (Figure 1b). In addition, we found increased miR‐183 suppressed both mechanical allodynia and thermal hyperalgesia in CCI rat models (Figure 2a,b). The findings elucidated that miR‐183 might conduct as a negative regulator in neuropathic pain development in vivo.
Figure 1.

miR‐183 expression levels in CCI rats. (a) Expression of miR‐183 in the L4‐L6 dorsal spinal cord of rats. RT‐qPCR was conducted on Days 0, 3, 7, 14, and 21. (b) Expression levels of miR‐183 in CCI rats infected with LV‐miR‐183 or LV‐NC on Day 7 and U6 acted as an internal control. N = 6 for each group. Error bars represent the mean ± standard deviation of triplicate experiments. *p < .05. CCI, chronic sciatic nerve injury
Figure 2.

Increased miR‐183 repressed neuropathic pain progression. (a) The mechanical allodynia was measured by PWT on Days 0, 3, 7, 14, and 21. (b) The thermal hyperalgesia was measured by PWL on Days 0, 3, 7, 14, and 21. N = 6 for each group. Error bars represent the mean ± standard deviation of triplicate experiments. *p < .05. PWL, paw withdrawal latency
3.2. Upregulation of miR‐183 retrained neuroinflammation
To confirm the relationship between inflammatory cytokines and miR‐183, we measured the concentration of IL‐6, IL‐1β, and COX‐2 which were associated with neuropathic pain progression. ELASA tests showed miR‐183 overexpression obviously decreased the concentration of IL‐6, IL‐1β, and COX‐2 in CCI rat models (Figure 3a,b,c). We concluded miR‐183 overexpression restrained the expression of IL‐6, IL‐1β, and COX‐2. These demonstrated that miR‐183 was related to neuropathic pain through inhibiting neuroinflammation in CCI rats.
Figure 3.

miR‐183 suppressed neuroinflammation in CCI rats. The protein levels of IL‐6 (a), IL‐1β (b), and COX‐2 (c) in the L4‐L6 dorsal spinal cord of rats on Day 7. N = 6 for each group. Error bars represent the mean ± standard deviation of triplicate experiments. *p < .05. CCI, chronic sciatic nerve injury; COX, cyclooxygenase; IL, interleukin
3.3. MAP3K4 was targeted directly by miR‐183 in vitro
To find out the downstream gene of miR‐183 in neuropathic pain, TargetScan was performed to predict the target gene. Furthermore, we observed that position 198–228 of MAP3K4 3′‐UTR could bind with miR‐183 (Figure 4a). We then measured luciferase activity between miR‐183 and MAP3K4. The MAP3K4 3′‐UTRWT or MAP3K4 3′‐UTRMUT was transfected into the PGL3 basic vector. The luciferase activity of HEK‐293T cells cotransfected with the above luciferase vector containing MAP3K4 3′‐UTR and miR‐183 mimics was reduced obviously (Figure 4b). However, cotransfection with mimic‐miR‐183 and the luciferase vector containing MUT‐MAP3K4 3′‐UTR had the same luciferase activity compared with mimic negative control (Figure 4c). These demonstrated that miR‐183 directly targeted MAP3K4.
Figure 4.

miR‐183 targeted MAP3K4 in vitro. (a) The sequence of miR‐183 and the position of MAP3K4 3′‐UTR. (b) Dual‐luciferase reporter assay of miR‐183 and MAP3K4 3′‐UTR. miR‐183 mimics were cotransfected with the dual‐luciferase vector containing MAP3K4 3′‐UTR into HEK‐293T cells. (c) Dual‐luciferase reporter assay of miR‐183 and MAP3K4 3′‐UTRMut. miR‐183 mimics were cotransfected with the dual‐luciferase vector containing MAP3K4 3′‐UTRMut into HEK‐293T cells. Error bars represent the mean ± standard deviation of triplicate experiments. *p < .05. UTR, untranslated region
3.4. Upregulation of miR‐183 suppressed MAP3K4 expression
To identify the functional effect of miR‐183 on MAP3K4 in neuropathic pain, we measured MAP3K4 mRNA and protein expression levels. miR‐183 overexpression had apparently reduced MAP3K4 expression in CCI rats compared with negative control (Figure 5a,b,c). These results exhibited that overexpression of miR‐183 suppressed MAP3K4 expression in vivo.
Figure 5.

miR‐183 regulated MAP3K4 expression negatively. (a) mRNA expression of MAP3K4 in the L4‐L6 dorsal spinal cord of rats infected with LV‐miR‐183 or LV‐NC on Day 7 using qRT‐PCR. (b,c) Effect of miR‐183 on MAP3K4 protein levels. N = 6 for each group. Error bars represent the mean ± standard deviation of triplicate experiments. *p < .05. mRNA, messenger RNA
3.5. Overexpression of MAP3K4 reversed the negative effects of miR‐183 on neuropathic pain in vivo
To identify whether MAP3K4 could directly contribute to neuropathic pain or not, MAP3K4 was overexpressed in CCI rats through LV‐MAP3K4 infection. MAP3K4 mRNA and protein expression were both upregulated evidently by LV‐MAP3K4 (Figure 6a,b,c). Moreover, overexpression of MAP3K4 raised up the protein expression levels of IL‐6, IL‐1β, and COX‐2 in CCI rats (Figure 6d,e,f). The above findings implied that overexpression of MAP3K4 reversed the negative effect of miR‐183 on neuropathic pain in vivo.
Figure 6.

The upregulation of MAP3K4 reversed the negative effect of miR‐183 on neuroinflammation. MAP3K4 mRNA expression (a) and protein expression (b,c) in CCI rats. LV‐miR‐183 and LV‐MAP3K4 were coinfected into the L4‐L6 dorsal spinal cord of rats on Day 7. The protein levels of IL‐6 (d), IL‐1β (e) and COX‐2 (f) in the L4‐L6 dorsal spinal cord of rats were tested by ELISA on Day 7. LV‐miR‐183 and LV‐MAP3K4 were coinfected into the L4‐L6 dorsal spinal cord of rats on Day 7. N = 6 for each group. Error bars represent the mean ± standard deviation of triplicate experiments. *p < .05. CCI, chronic sciatic nerve injury; COX, cyclooxygenase; ELISA, enzyme‐linked immunosorbent assay; IL, interleukin; mRNA, messenger RNA
4. DISCUSSION
In recent years, many more miRNAs have been certificated to associate with neuropathic pain progression (Andersen, Duroux, & Gazerani, 2014; Guo et al., 2019). It is meaningful to find out more miRNAs for neuropathic pain clinical therapy. With regard to our study, we found the miR‐183/MAP3K4 axis was related to neuropathic pain. Primarily, miR‐183 was regulated downward obviously in CCI rats, and upregulation of miR‐183 retrained neuroinflammation through inhibition of IL‐6, IL‐1β, and COX‐2, thus suppressed neuropathic pain development. And MAP3K4 was inferred as the downstream gene of miR‐183. Furthermore, miR‐183 could modulate MAP3K4 expression in vivo and vitro negatively. Correspondingly, overexpression of MAP3K4 reversed the negative effect of miR‐183 on neuroinflammation, which, resulting in the adversity of neuropathic pain.
miR‐96, miR‐182, and miR‐183 are included in the miR‐183 cluster. And abnormal expressions of miR‐96, miR‐182, and miR‐183 may contribute to chronic neuropathic pain (Chen et al., 2014; Ichiyama & Dong, 2019). Currently, we concentrated our eyes on miR‐183, which has been proved to be critical in increasing studies (Wang, Wang, Li, Liu, & Teng, 2014; Yuan, Li, Zhu, Yan, & Dang, 2015), especially in neuropathic pain progression. For instance, miR‐183 was decreased in CCI rats using the network and pathway‐based analysis (Guo et al., 2019). Peng et al., (2017) proposed the expression of the miRNA‐183 cluster could control mechanical sensitivity by regulating auxiliary voltage‐gated calcium channel subunits. Shi et al., (2018) showed miR‐183‐5p acted as a negative regulator in CCI‐induced neuropathic pain via inhibiting TREK‐1. They manifested that modulation of the TREK‐1, a member of the 2P‐domain K+ channel (K2P) family might be involved in neuropathic pain. Xie, Ma, Xi, Zhang, and Fan (2017) found miR‐183 suppressed neuropathic pain via negatively modulating mTOR/VEGF. Their results suggested that the mTOR/VEGF pathway was activated by miR‐183 and an increase of miR‐183 attenuated symptoms of neuropathic pain. Here, we observed that miR‐183 was reduced frequently in CCI rats, as well as the upregulation of miR‐183 has the ability to repress neuropathic pain progression via decreasing the levels of inflammation‐correlated biomarkers, such as IL‐6, IL‐1β, and COX‐2.
MAP3K4 belongs to the family of Ser/Thr protein kinase (Coulombe & Meloche, 2007). Many studies have reported that MAPKs family produces marked effects on cell growth and apoptosis in the pathological process (Low & Zhang, 2016; Zou et al., 2016). A recent study had shown that MAP3K4 participant in the pathobiology mechanism. For instance, MAP3K4 played a role in the process of trophoblast stem cell epithelial‐to‐mesenchymal transition (Mobley et al., 2017). A novel variant was highlighted by GWS analysis in MAP3K4 in the pathogenesis of endometriosis (Uimari et al., 2017). MAP3K4 haploinsufficiency could lead to T‐associated sex reversal (Warr et al., 2014). MAP3K4 deficiency in intrahepatic cholangiocarcinoma is the cause of invasive growth (Yang et al., 2015). In our study, MAP3K4 was assumed as the downstream gene of miR‐183, and then miR‐183 suppressed MAP3K4 expression negatively. Moreover, upregulated MAP3K4 relieved the negative effect of miR‐183 on neuroinflammation. It indicated that perhaps there was much more MAPKs family involved in neuropathic pain, which worth further studies.
miRNAs have been validated to be concerned with many diseases, especially in cancers (Chen et al., 2019; Liu et al., 2019) and neuropathic pain (Hu et al., 2019; Zhang, Mou, Wang, Liu, & Hu, 2019). miRNAs are potential targets for therapeutic approaches of neuropathic pain sufferers. Neuroinflammation cytokines also play a crucial role in the proceed of neuropathic pain, for example, COX‐2, IL‐6, tumor necrosis factor‐α and IL‐1β (Moalem & Tracey, 2006). In the current study, we revealed miR‐183 was regulated downward in CCI rats, which increased the protein expression levels of IL‐6, IL‐1β, and COX‐2. What's more, miR‐183 negatively modulated MAP3K4 expression and MAP3K4 could relieve the negative effect of miR‐183 on neuroinflammation. These findings implied miR‐183 participated in the development of neuropathic pain and it may provide miR‐183/MAP3K4 as a potential target for the disease.
Overall, our study proved miR‐183 plays a crucial role in the progression of neuropathic pain. And miR‐183 relieved neuropathic pain in CCI rat models through targeting MAP3K4. miR‐183 and MAPA3K4 modulated neuroinflammation of neuropathic pain in the opposite direction. These results illustrated that miR‐183 could be a novel orientation for neuropathic pain clinical diagnosis and treatment.
CONFLICT OF INTERESTS
The authors declare that there are no conflict of interests.
AUTHOR CONTRIBUTIONS
L. W. supervised the experiment. L. L. H. carried out the experiment. L. L. H. and L. W. analyzed and discussed the experimental results. Finally, L. W. wrote the manuscript. All authors approved the final manuscript.
DATA AVAILIABILITY STATEMENT
The data sets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
References
REFERENCES
- Andersen, H. H. , Duroux, M. , & Gazerani, P. (2014). MicroRNAs as modulators and biomarkers of inflammatory and neuropathic pain conditions. Neurobiology of Disease, 71, 159–168. [DOI] [PubMed] [Google Scholar]
- Bartel, D. P. (2009). MicroRNAs: Target recognition and regulatory functions. Cell, 136(2), 215–233. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Beattie, M. S. , Inflammation and apoptosis . (2004). Inflammation and apoptosis: Linked therapeutic targets in spinal cord injury. Trends in Molecular Medicine, 10(12), 580–583. [DOI] [PubMed] [Google Scholar]
- Chang, L. , Cooper, M. S. , & Clark, V. P. (2013). Imaging biomarkers and the role of neuroinflammation in neuropathic pain. Journal of Neuroimmune Pharmacology, 8(3), 448–451. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chen, H. P. , Zhou, W. , Kang, L. M. , Yan, H. , Zhang, L. , Xu, B. H. , & Cai, W. H. (2014). Intrathecal miR‐96 inhibits Nav1.3 expression and alleviates neuropathic pain in rat following chronic construction injury. Neurochemical Research, 39(1), 76–83. [DOI] [PubMed] [Google Scholar]
- Chen, S. , Chen, J. Z. , Zhang, J. Q. , Chen, H. X. , Qiu, F. N. , Yan, M. L. , … Wang, Y. D. (2019). Silencing of long noncoding RNA LINC00958 prevents tumor initiation of pancreatic cancer by acting as a sponge of microRNA‐330‐5p to down‐regulate PAX8. Cancer Letters, 446, 49–61. [DOI] [PubMed] [Google Scholar]
- Coulombe, P. , & Meloche, S. (2007). Atypical mitogen‐activated protein kinases: Structure, regulation and functions. Biochimica et Biophysica Acta (BBA) ‐ Molecular Cell Research, 1773(8), 1376–1387. [DOI] [PubMed] [Google Scholar]
- Ellis, A. , & Bennett, D. L. H. (2013). Neuroinflammation and the generation of neuropathic pain. British Journal of Anaesthesia, 111(1), 26–37. [DOI] [PubMed] [Google Scholar]
- Guo, J. B. , Zhu, Y. , Chen, B. L. , Song, G. , Peng, M. S. , Hu, H. Y. , … Wang, X. Q. (2019). Network and pathway‐based analysis of microRNA role in neuropathic pain in rat models. Journal of Cellular and Molecular Medicine, 23, 4534–4544. [DOI] [PMC free article] [PubMed] [Google Scholar]
- van Hecke, O. , Austin, S. K. , Khan, R. A. , Smith, B. H. , & Torrance, N. (2014). Neuropathic pain in the general population: A systematic review of epidemiological studies. Pain, 155(4), 654–662. [DOI] [PubMed] [Google Scholar]
- Hu, Y. , Liu, Q. , Zhang, M. , Yan, Y. , Yu, H. , & Ge, L. (2019). MicroRNA‐362‐3p attenuates motor deficit following spinal cord injury via targeting paired box gene 2. Journal of Integrative Neuroscience, 18(1), 57–64. [DOI] [PubMed] [Google Scholar]
- Ichiyama, K. , & Dong, C. (2019). The role of miR‐183 cluster in immunity. Cancer Letters, 443, 108–114. [DOI] [PubMed] [Google Scholar]
- Kiguchi, N. , Kobayashi, Y. , & Kishioka, S. (2012). Chemokines and cytokines in neuroinflammation leading to neuropathic pain. Current Opinion in Pharmacology, 12(1), 55–61. [DOI] [PubMed] [Google Scholar]
- Lema, M. J. , Foley, K. M. , & Hausheer, F. H. (2010). Types and epidemiology of cancer‐related neuropathic pain: The intersection of cancer pain and neuropathic pain. The Oncologist, 15(suppl 2), 3–8. [DOI] [PubMed] [Google Scholar]
- Li, X. , Kang, L. , Li, G. , Zeng, H. , Zhang, L. , Ling, X. , … Chen, H. (2013). Intrathecal leptin inhibits expression of the P2X2/3 receptors and alleviates neuropathic pain induced by chronic constriction sciatic nerve injury. Molecular Pain, 9, 1744‐8069‐9‐65. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liu, S. , Zhu, B. , Sun, Y. , & Xie, X. (2015). MiR‐155 modulates the progression of neuropathic pain through targeting SGK3. International Journal of Clinical and Experimental Pathology, 8(11), 14374–14382. [PMC free article] [PubMed] [Google Scholar]
- Liu, X. , Min, S. , Wu, N. , Liu, H. , Wang, T. , Li, W. , … Wang, X. (2019). miR‐193a‐3p inhibition of the Slug activator PAK4 suppresses nonsmall cell lung cancer aggressiveness via the p53/Slug/L1CAM pathway. Cancer Letters, 447, 56–65. [DOI] [PubMed] [Google Scholar]
- Low, H. B. , & Zhang, Y. (2016). Regulatory roles of MAPK phosphatases in cancer. Immune Network, 16(2), 85–98. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Moalem, G. , & Tracey, D. J. (2006). Immune and inflammatory mechanisms in neuropathic pain. Brain Research Reviews, 51(2), 240–264. [DOI] [PubMed] [Google Scholar]
- Mobley, R. J. , Raghu, D. , Duke, L. D. , Abell‐Hart, K. , Zawistowski, J. S. , Lutz, K. , … Johnson, G. L. (2017). MAP3K4 Controls the chromatin modifier HDAC6 during trophoblast stem cell epithelial‐to‐mesenchymal transition. Cell Reports, 18(10), 2387–2400. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Myers, R. R. , Campana, W. M. , & Shubayev, V. I. (2006). The role of neuroinflammation in neuropathic pain: Mechanisms and therapeutic targets. Drug Discovery Today, 11(1‐2), 8–20. [DOI] [PubMed] [Google Scholar]
- Niederberger, E. , & Geisslinger, G. (2008). Proteomics in neuropathic pain research. Anesthesiology, 108(2), 314–323. [DOI] [PubMed] [Google Scholar]
- Peng, C. , Li, L. , Zhang, M. D. , Bengtsson Gonzales, C. , Parisien, M. , Belfer, I. , … Ernfors, P. (2017). miR‐183 cluster scales mechanical pain sensitivity by regulating basal and neuropathic pain genes. Science, 356(6343), 1168–1171. [DOI] [PubMed] [Google Scholar]
- Shi, D. N. , Yuan, Y. T. , Ye, D. , Kang, L. M. , Wen, J. , & Chen, H. P. (2018). MiR‐183‐5p alleviates chronic constriction injury‐induced neuropathic pain through inhibition of TREK‐1. Neurochemical Research, 43(6), 1143–1149. [DOI] [PubMed] [Google Scholar]
- Sommer, C. , Leinders, M. , & Üçeyler, N. (2018). Inflammation in the pathophysiology of neuropathic pain. Pain, 159(3), 595–602. [DOI] [PubMed] [Google Scholar]
- Uimari, O. , Rahmioglu, N. , Nyholt, D. R. , Vincent, K. , Missmer, S. A. , Becker, C. , … Zondervan, K. T. (2017). Genome‐wide genetic analyses highlight mitogen‐activated protein kinase (MAPK) signaling in the pathogenesis of endometriosis. Human Reproduction, 32(4), 780–793. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang, J. , Wang, X. , Li, Z. , Liu, H. , & Teng, Y. (2014). MicroRNA‐183 suppresses retinoblastoma cell growth, invasion, and migration by targeting LRP6. FEBS Journal, 281(5), 1355–1365. [DOI] [PubMed] [Google Scholar]
- Warr, N. , Siggers, P. , Carré, G. A. , Bogani, D. , Brixey, R. , Akiyoshi, M. , … Greenfield, A. (2014). Transgenic expression of Map3k4 rescues T‐associated sex reversal (Tas) in mice. Human Molecular Genetics, 23(11), 3035–3044. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xia, L. X. , Ke, C. , & Lu, J. M. (2018). NEAT1 contributes to neuropathic pain development through targeting miR‐381/HMGB1 axis in CCI rat models. Journal of Cellular Physiology, 233(9), 7103–7111. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xie, X. , Ma, L. , Xi, K. , Zhang, W. , & Fan, D. (2017). MicroRNA‐183 suppresses neuropathic pain and expression of AMPA receptors by targeting mTOR/VEGF signaling pathway. Cellular Physiology and Biochemistry, 41(1), 181–192. [DOI] [PubMed] [Google Scholar]
- Yang, D. , Yang, Q. , Wei, X. , Liu, Y. , Ma, D. , Li, J. , … Luo, Y. (2017). The role of miR‐190a‐5p contributes to diabetic neuropathic pain via targeting SLC17A6. Journal of Pain Research, 10, 2395–2403. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yang, L. X. , Gao, Q. , Shi, J. Y. , Wang, Z. C. , Zhang, Y. , Gao, P. T. , … Fan, J. (2015). Mitogen‐activated protein kinase kinase kinase 4 deficiency in intrahepatic cholangiocarcinoma leads to invasive growth and epithelial‐mesenchymal transition. Hepatology, 62(6), 1804–1816. [DOI] [PubMed] [Google Scholar]
- Yuan, D. , Li, K. , Zhu, K. , Yan, R. , & Dang, C. (2015). Plasma miR‐183 predicts recurrence and prognosis in patients with colorectal cancer. Cancer Biology & Therapy, 16(2), 268–275. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhan, L. Y. , Lei, S. Q. , Zhang, B. H. , Li, W. L. , Wang, H. X. , Zhao, B. , … Huang, Q. M. (2018). Overexpression of miR‐381 relieves neuropathic pain development via targeting HMGB1 and CXCR4. Biomedicine & Pharmacotherapy = Biomedecine & Pharmacotherapie, 107, 818–823. [DOI] [PubMed] [Google Scholar]
- Zhang, D. , Mou, J. Y. , Wang, F. , Liu, J. , & Hu, X. (2019). CRNDE enhances neuropathic pain via modulating miR‐136/IL6R axis in CCI rat models. Journal of Cellular Physiology, 234, 22234–22241. [DOI] [PubMed] [Google Scholar]
- Zhang, Y. , Su, Z. , Liu, H. L. , Li, L. , Wei, M. , Ge, D. J. , & Zhang, Z. J. (2018). Effects of miR‐26a‐5p on neuropathic pain development by targeting MAPK6 in in CCI rat models. Biomedicine & Pharmacotherapy = Biomedecine & Pharmacotherapie, 107, 644–649. [DOI] [PubMed] [Google Scholar]
- Zou, Y. , Deng, W. , Wang, F. , Yu, X. H. , Liu, F. Y. , Yang, B. C. , … UANG, O. P. (2016). A novel somatic MAPK1 mutation in primary ovarian mixed germ cell tumors. Oncology Reports, 35(2), 725–730. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data sets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
