Skip to main content
NCBI home page
Wiley Open Access Collection logoLink to Wiley Open Access Collection
. 2019 Jan 11;234(8):13951–13958. doi: 10.1002/jcp.28078

Efficient osteogenic differentiation of the dental pulp stem cells on β‐glycerophosphate loaded polycaprolactone/polyethylene oxide blend nanofibers

Fatemeh Sadat Hosseini 1, Seyedeh Elnaz Enderami 2, Ali Hadian 1, Mohammad Foad Abazari 3, Abdolreza Ardeshirylajimi 4, Ehsan Saburi 5, Fatemeh Soleimanifar 6,✉, Bahareh Nazemisalman 7,✉
PMCID: PMC13482995  PMID: 30633333

Abstract

Hard tissue lesion treatment in oral and maxillofacial has been challenging because of tissue complexities. This study aimed to investigate novel biopolymeric construct effects on the osteogenic differentiation potential of the dental pulp stem cells (DPSCs) for introducing a cell copolymer bioimplant. A blended polycaprolactone (PCL)‐polyethylene oxide (PEO) was fabricated using electrospinning, simultaneously filled by β‐glycerophosphate (β‐GP). After that biocompatibility and release kinetics of the PCL‐PEO+β‐GP was evaluated and compared with PCL‐PEO and then the osteogenic differentiation potential of the DPSCs was examined while being cultured on the scaffolds and compared with those cultured on the culture plate. The results demonstrated that scaffolds have not any cytotoxicity and β‐GP can release in a long‐term manner. Alkaline phosphatase activity and calcium content were significantly increased in DPSCs while being cultured on the PCL‐PEO+β‐GP compared with the other groups. Runt‐related transcription factor 2, collagen type‐I, osteonectin, and osteocalcin (OSC) genes expression was upregulated in DPSCs cultured on the PCL‐PEO+β‐GP and was significantly higher than those cultured on the PCL‐PEO. Immunocytochemistry result also confirmed the positive effects of PCL‐PEO+β‐GP on the osteogenic differentiation of the DPSCs by presenting a higher OSC protein expression. According to the results, incorporation of the β‐GP in PCL‐PEO makes a better construct for osteogenic induction into the stem cells and it could be also considered as a great promising candidate for bone, oral, and maxillofacial tissue engineering applications.

Keywords: dental pulp stem cells, dental tissue engineering, polycaprolactone, polyethylene oxide, β‐glycerophosphate

A blended polycaprolactone (PCL)‐polyethylene oxide (PEO) was fabricated using electrospinning, simultaneously filled by β‐glycerophosphate (β‐GP). After biocompatibility and release kinetics characterization of the PCL‐PEO and PCL‐PEO+β‐GP, then osteogenic differentiation potential of the dental pulp stem cells was evaluated while being cultured on scaffolds. Results demonstrated that incorporating of the β‐GP in PCL‐PEO made it a better construct for osteogenic induction and it could be considered as a great promising potential for use in bone, oral, and maxillofacial tissue engineering.

graphic file with name JCP-234-13951-g003.jpg

1. INTRODUCTION

There are several diseases pertaining to the oral cavity that cause bone defects in the jaws of the patients (Neville, Damm, Chi, & Allen, 2015). Nowadays, there are various implants (commercially available) for the treatment of the bone defects in the jaws. However, due to the prevalence and complexity of these diseases, the lack of complete restoration after the use of traditional implants, and the long duration of jaw tissue repair many studies have been done to introduce more appropriate implants (Paknejad, Jafari, Nazeman, Rad, & Khojasteh, 2017; Shan, Chen, Liang, Huang, & Cai, 2015). In recent decades, tissue engineering has tried introducing dental bioimplants using a set of techniques. Bioimplants that include polymeric scaffolds, stem cells, and growth‐promoting factors for bone repair (Salehi‐Nik, Rad, Nazeman, & Khojasteh, 2017). Polymeric scaffolds that can fill the cavity in the bony region and also play the role of extracellular matrix (ECM); stem cells that can differentiate into bone cells; and factors that can accelerate this differentiation process (Reilly & Engler, 2010). Scaffolds should be biocompatible and biodegradable with high mechanical strength depending on the bone structure of the jaws (Moradi, Golchin, Hajishafieeha, Khani, & Ardeshirylajimi, 2018). One of the most widely used polymers in the bone tissue engineering is the polycaprolactone (PCL), which has high mechanical and thermal strength and is also biodegradable (Hosseini, Soleimanifar, Khojasteh, & Ardeshirylajimi, 2018; Labet & Thielemans, 2009). But given that PCL scaffold has a relatively slow degradability rate, the release of incorporated growth factors will also be very slow. The polymer also has hydrophobic properties that can reduce the binding of cells on it. Several studies have been carried out to modify these disadvantages by combining these polymers with other hydrophilic polymers, which have a faster degradation rate (Abazari et al., 2018). Moreover, the use of plasma treatment is to induce functional groups, such as OH, COO, and NH2 on its surfaces and then proteins covering or grafting can be done on its surfaces (Kweon et al., 2003; Ma, Mao, & Gao, 2007; Soleimanifar et al., 2018; Yoo, Kim, & Park, 2009). Stem cells, as the other component of these tissue engineered constructs, can be isolated from various tissues, including skin, bone marrow, fat, umbilical cord blood, hair follicles, dental muscles, dental pulp, and periodontal fibers. Each of them has its own advantages and disadvantages (Seong et al., 2010). One of the best sources for the extraction of the stem cells is the dental pulp tissue in which the cells are distributed throughout the porcelain and central area of ​​the pulp and often occupies the vascular area (Liu, Gronthos, & Shi, 2006). These cells have differentiation potential to a wide range of the cells, such as odontoblast, osteoblast, adipocyte, chondroblast, skeletal, and smooth muscle cells (Gronthos et al., 2002). In this study, the electrospinning method was applied to fabricate nanofibrous scaffold from PCL blended with polyethylene oxide (PEO). PEO is highly hydrophilic with a high degradability rate (Deitzel, Kleinmeyer, Hirvonen, & Tan, 2001; Li et al., 2015). Meanwhile, this scaffold was filled by β‐glycerophosphate (β‐GP) growth factor as the main osteogenic differentiation‐inducing factor (Chung, Golub, Forbes, Tokuoka, & Shapiro, 1992). The dental pulp stem cells (DPSCs) were expanded and characterized and then cultured on the surface of the fabricated PCL‐PEO + β‐GP, PCL‐PEO scaffolds, and tissue culture polystyrene (TCPS). Its osteogenic differentiation potential was studied and evaluated using the common osteogenic markers.

2. MATERIALS AND METHODS

2.1. Scaffolds fabrication

Electrospinning was carried out according to the previous study (Ghiaee, Pournaqi, Vakilian, Mohammadi‐Sangcheshmeh, & Ardeshirylajimi, 2017). In brief, solutions were prepared by dissolving the PEO (Mv 900,000; Sigma‐Aldrich, St. Louis, MO) in Milli Q water for 15 hr with 7% (w/w) concentration with and without β‐GP (Sigma‐Aldrich) 15% (w/v) and 6% (w/w) solution of PCL. Solutions were fed into two 5 ml needle‐blunted syringes and inserted into the electrospinning device (Nano‐Model, IRAN). Electrospinning parameters included flow rate: 0.5 ml/h; voltage: 23 KV; nozzle distance with collector: 24 cm for PEO and PEO+β‐GP and 15 cm for PCL; and nozzle angle: 25° for PEO and PEO+β‐GP and 45° for PCL. The surfaces of the fabricated scaffolds were treated by a frequency of 40 kHz of oxygen plasma using a cylindrical quartz reactor (Diener Electronics, Ebhausen, Germany).

2.2. Mechanical and morphological characterization

The mechanical characteristics of the fabricated scaffolds were evaluated through a tensile test using Instron universal testing machine (Model STM‐20; SANTAM, Tehran, Iran) with a loading velocity of 50 mm/min. According to a previous study (Enderami, Soleimani, Mortazavi, Nadri, & Salimi, 2018), stem cells‐seeded scaffold was considered for morphological evaluation using a scanning electron microscopy (SEM; S‐4500; Hitachi, Tokyo, Japan). Cell seeded‐scaffolds were fixed by 2.5% glutaraldehyde solution for 2 hr at room temperature and then rinsed in a series of degraded ethanol (50° to 100°, 5 min per degree) for dehydration. Finally, samples were transferred on aluminum and coated with gold before imaging.

2.3. Wettability analysis

Wettability of the fabricated scaffolds was investigated using the contact angle method, before and after plasma treatment, through the sessile drop procedure with a G10 Kruss contact angle goniometer at room temperature. Contact angle was measured after 10 s of water droplet being transferred to the scaffold's surface.

2.4. β‐GP release

Electrospun PCL‐PEO+β‐GP scaffold was cut in 4 cm2 and then weighed and inserted in 10 ml of phosphate buffer solution. Samples were incubated at 37°C and simultaneously stirred at 50 RPM. At specified time points, 0.5 ml of supernatants were collected and the same volume of fresh phosphate buffer solution was replaced. The collected samples were read by spectroscopy at 242 nm (Model UV 1601; Shimadzu, Tokyo, Japan). The β‐GP concentration measurement was performed using a standard curve (concentrations ranging from 0.0 to 100 μg/ml).

2.5. Cell culture

DPSCs line was purchased from Royan Institute (IBRC C10266; Royan Institute, Tehran, Iran). DPSCs were thawed in alpha‐MEM medium supplemented with 20% fetal bovine serum (FBS) and 2 mM l‐glutamine. After reaching 80% confluency, the cells were detached enzymatically and passaged. DPSCs at passage three were used in this study after characterization via osteogenic and adipogenic differentiation. Differentiation and evaluation, two weeks after cell seeding via Alizarin red and oil red staining, respectively, were studied. Osteogenic differentiation was induced by Dulbecco's modified Eagle medium (DMEM) supplemented with 10% FBS, 3 mM βGP, 50 μg/mL ascorbic acid, and 10 to 9 M dexamethasone (all from Sigma‐Aldrich). Adipogenic differentiation was induced by DMEM supplemented with 10% FBS, 0.5 mM 3‐isobutyl‐1‐ methylxanthine, 1 mM dexamethasone, 10 mg/mL insulin, 200 µM indomethacin, 500 lM 0.05 U/mL penicillin, and 0.05 µg/mL streptomycin (all from Sigma‐Aldrich). For staining, samples were kept in paraformaldehyde (4%) for 45 min, then rinsed in phosphate buffered saline (PBS), and stained with Alizarin red and oil red for 5 to 10 min at 37°C. Finally, the cells were washed with PBS two times and visualized by light microscope.

2.6. Osteogenic differentiation on scaffolds

Before cell seeding, fabricated scaffolds were sterilized under UV irradiation for 30 min and then ethanol (70%) was added to the scaffold and stored for another 30 min at room temperature. DPSCs with a cell density of 2 × 104 were seeded on the scaffolds and experiments were performed in four groups: (a) DPSCs seeded‐PCL‐PEO under standard osteogenic medium [PCL‐PEO (basal)]; (b) DPSCs seeded‐PCL‐PEO under basal medium as control [PCL‐PEO (osteo)], (c) DPSCs seeded‐PCL‐PEO+β‐GP under standard osteogenic medium without β‐GP [PCL‐PEO+β‐GP (basal)]; and 4) DPSCs seeded‐PCL‐PEO+β‐GP under basal medium [PCL‐PEO+β‐GP (basal)].

2.7. The 3‐(4,5‐dimethylthiazol‐2‐yl)‐2,5‐diphenyltetrazolium bromide assay

Biocompatibility of the fabricated scaffold was evaluated according to the previous study (Enderami, Kehtari et al., 2018). The 3‐(4,5‐dimethylthiazol‐2‐yl)‐2,5‐diphenyltetrazolium bromide (MTT) assay was used as DPSCs were cultured with a cell density of 5 × 103 on the surfaces of the PCL‐PEO, PCL‐PEO+β‐GP, and TCPS (as a control). MTT solution with final concentration of 5 mg/ml was added to each well at days 1, 3, 5, and 7, after cell seeding, and then incubated at 37°C and 5% CO2 for 4 hr. After that, the supernatant was thrown out and the formed formazan crystals were dissolved using dimethyl sulfoxide (Sigma‐Aldrich) and their optical densities were read with a microplate reader (Bio‐Tek Instruments, Inc., Winooski, VT) at 570 nm.

2.8. Alkaline phosphatase activity and calcium content assays

Alkaline phosphatase (ALP) Kit (PARS‐AZMOON, Tehran, Iran) was used for the ALP activity measurement according to the manufacture's protocol. In brief, total protein was extracted from the differentiated cells, one and two weeks, after cell seeding using radio immunoprecipitation assay lysis buffer while being shacked on ice for 1 hr and then the samples were centrifuged at 15,000 RPM, at 4°C for 15 min. The supernatant was collected as total proteins and read by ALP‐kit reagent at 405 nm by a microplate reader (Bio‐Tek Instruments, Inc.). Finally, the ALP activity of each was calculated as IU/mg total protein per assay time.

Calcium content kit (PARS‐AZMOON) was used for calcium measurement according to the manufacture's protocol. In brief, the samples were rinsed in 0.6 N HCl (Merck, Darmstadt, Germany) followed by shacking for 1 hr. The supernatant was collected and read by kit reagent using a microplate reader (Bio‐Tek Instruments, Inc.) at 570 nm. The calcium measures were calculated through the standard curve of obtained OD from a serial dilution of calcium.

2.9. Real time reverse transcription polymerase chain reaction

Osteogenic genes evaluation was performed on four important osteogenic markers including Runt‐related transcription factor 2 (Runx2), collagen type‐I (Col‐I), osteonectin (OSN), and osteocalcin (OSC) in cultured cells of all four groups. The total RNA was isolated using a RNA extraction kit (Qiagen, Hilden, Germany) and the complementary DNA (cDNA) was synthesized using cDNA synthesize kit (Vivantis Inc., CA) according to the manufacture's protocol. Takara SYBR Premix‐Ex‐Taq Master was used for real time reverse transcription polymerase chain reaction (RT‐PCR) using Rotor Gene (6000; Corbett, Concorde, NSW, Australia). The relative expression fold changes of the targeted genes were calculated against β‐2‐microglobulin (β 2 M), which was used as an internal control. Table 1 shows the sequence of primers used in real time RT‐PCR analysis.

Table 1.

The primers sequences were used in real time RT‐PCR analysis

Gene Primer sequences Size (bp)
β‐2‐Micro globulin (β 2 M) TGGAAAGAAGATACCAAATATCGA 201
GATGATTCAGAGCTCCATAGAGCT
Collagen I TGGAGCAAGAGGCGAGAG 121
CACCAGCATCACCCTTAGC
Runx2 GCCTTCAAGGTGGTAGCCC 66
CGTTACCCGCCATGACAGTA
Osteonectin AGGTATCTGTGGGAGCTAATC 224
ATTGCTGCACACCTTCTC
Osteocalcin GCAAAGGTGCAGCCTTTGTG 80
GGCTCCCAGCCATTGATACAG
Open in a new tab

Note. RT‐PCR: reverse transcription polymerase chain reaction.

2.10. Immunocytochemistry

OSC protein was evaluated in differentiated stem cells cultured on PCL‐PEO and PCL‐PEO+β‐GP three weeks after cell seeding. Samples were fixed with paraformaldehyde 4% for 45 min at room temperature and then blocking was carried out by 3% bovine serum albumin for 1 hr at 4°C. After that, anti‐OSC antibody (1:50 OPN, SPP1 antibody; Proteintech, Herford, Germany) was added and incubated overnight at 4°C. Then, PE‐conjugated goat‐antimouse IgG (1:200; Sigma‐Aldrich) was added to the samples for 1 hr at room temperature and then the samples were washed with PBS. DAPI (4′,6‐diamidino‐2‐phenylindole; 1:1,000) was also added to the samples for 30 s for nuclear staining.

2.11. Statistics

All experiments were carried out independently for three times. The REST2009 software (Qiagen) was used to analyze the acquired data from real time RT‐PCR. Data were reported as mean ± standard deviation (SD). The SPSS software (Version 19, Chicago, IL) was used for doing a simple one‐way analysis of variance for comparing the results among different groups at each time point. p values less than 0.05 were considered as significant.

3. RESULTS

3.1. Scaffold characterization

PCL‐PEO and PCL‐PEO+β‐GP nanofibrous scaffolds were characterized morphologically using SEM. The results showed that scaffolds were smooth and bead‐free with nanofibers in nanometer‐scale (Figure 1a,b, respectively). In addition, SEM images showed that morphology and fiber size was almost the same when β‐GP was incorporated in them.

Figure 1.

Figure 1

Open in a new tab

SEM images of PCL‐PEO (a) and PCL‐PEO+β‐GP (b) nanofibrous scaffolds. PCL: polycaprolactone; PEO: polyethylene oxide; SEM: scanning electron microscopy; β‐GP: β‐glycerophosphate [Color figure can be viewed at wileyonlinelibrary.com]

As shown in Table 2, the mechanical properties of the fabricated scaffolds were investigated according to its importance and role in the differentiation process. The results demonstrated that the tensile strength of PCL‐PEO was 1.86 MPa but it decreased to 1.51 MPa in PCL‐PEO+β‐GP. Elongation at break was 17.04% in PCL‐PEO whereas it decreased to 15.4% in PCL‐PEO+β‐GP. The elastic modulus of PCL‐PEO was 78.50 MPa but it increased to 88.06 MPa in PCL‐PEO+β‐GP.

Table 2.

Different mechanical parameters, such as ultimate tensile strength, strain at break, and elastic modulus of PCL‐PEO and PCL‐PEO+β‐GP

Group Ultimate tensile strength (MPa) Strain at break (%) Elastic modulus (MPa)
PCL‐PEO 1.86 ± 0.4 17.04 ± 0.9 78.50 ± 2.2
PCL‐PEO+β‐GP 1.51 ± 0.3 15.4 ± 1.1 88.06 ± 2.46
Open in a new tab

Note. PCL: polycaprolactone; PEO: polyethylene oxide; β‐GP: β‐glycerophosphate.

The contact angle technique was applied for wettability evaluation of the fabricated scaffolds and the results showed that PCL‐PEO and PCL‐PEO+β‐GP contact angels were 85° and 53° whereas it significantly decreased, in both the scaffolds, after plasma treatment to 25° and 12°, respectively.

The release profile of the β‐GP from PCL‐PEO nanofibrous structure was investigated and the result showed that the release kinetics of the β‐GP increased almost linearly up to 168 hr but then its release was steady till the end of the study (Figure 2).

Figure 2.

Figure 2

Open in a new tab

In vitro release profile of β‐GP filled in PCL‐PEO nanofibers incubated in a phosphate buffer solution at 37°C on a rotary shaker at 50 rpm. PCL: polycaprolactone; PEO: polyethylene oxide; β‐GP: β‐glycerophosphate

Biocompatibility of the PCL‐PEO and PCL‐PEO+β‐GP nanofibrous scaffolds was characterized qualitatively by SEM imaging after cell seeding and quantitatively analyzed by MTT after several days of cell seeding. The SEM images showed that DPSCs (Figure 3a) proliferated and expanded on the surfaces of the PCL‐PEO (Figure 3b) and PCL‐PEO+β‐GP (Figure 3c) scaffolds during one week after cell seeding, which confirmed their biocompatibility and nontoxicity.

Figure 3.

Figure 3

Open in a new tab

Photographs of dental pulp stem cells (DPSCs) under an inverted microscope (a), SEM images of cultured DPSCs on PCL‐PEO (b) and PCL‐PEO+β‐GP (c) nanofibrous scaffolds for one week under basal medium. PCL: polycaprolactone; PEO: polyethylene oxide; β‐GP: β‐glycerophosphate [Color figure can be viewed at wileyonlinelibrary.com]

The MTT assay was carried out for DPSCs cultured on the PCL‐PEO and PCL‐PEO+β‐GP in comparison with those cells cultured on the TCPS as control under the basal medium (Figure 4) during a week after cell seeding. MTT results indicated that the proliferation rate of the DPSCs increased during a week in all groups but no significant differences were observed until Day 3 in various groups. After that, its proliferation rate increased significantly in PCL‐PEO+β‐GP compared with those of PCL‐PEO and TCPS on Day 5. On Day 7, a highest proliferation rate was detected in the PCL‐PEO+β‐GP group compared with th other groups. On this day, the proliferation rate in the PCL‐PEO group was also significantly higher than the TCPS group.

Figure 4.

Figure 4

Open in a new tab

The MTT assay of cultured DPSCs on PCL‐PEO and PCL‐PEO+β‐GP nanofibrous scaffolds and tissue culture polystyrene (TCPS) as control during one week under the basal medium. The significant differences (p < 0.05) between groups are indicated with a star sign. DPSCs: dental pulp stem cells; MTT: 3‐(4,5‐dimethylthiazol‐2‐yl)‐2,5‐diphenyltetrazolium bromide; PCL: polycaprolactone; PEO: polyethylene oxide; β‐GP: β‐glycerophosphate

3.2. Alkaline phosphatase activity and calcium content

Results showed that the obtained patterns of ALP activity and calcium content measurements were almost similar to each other (Figure 5). Highest ALP activity and calcium content of the DPSCs was detected in the PCL‐PEO+β‐GP (osteo) group among other groups at Day 7 whereas measures also significantly increased in DPSCs cultured on PCL‐PEO (osteo) and PCL‐PEO+β‐GP (basal) compared with those cultured on PCL‐PEO (basal). At Day 14, highest ALP activity and calcium content were detected in DPSCs cultured on PCL‐PEO+β‐GP (osteo) in comparison with others. These measures in the PCL‐PEO (osteo) group were also significantly increased compared with the PCL‐PEO (basal) and PCL‐PEO+β‐GP (basal) groups. However, ALP activity and calcium content of the DPSCs cultured on PCL‐PEO+β‐GP (basal) increased compared with those cultured on the PCL‐PEO (basal) group significantly.

Figure 5.

Figure 5

Open in a new tab

ALP activity and calcium content assays of cultured DPSCs on PCL‐PEO under basal and osteogenic medium and on PCL‐PEO+β‐GP under basal and osteogenic medium at days 7 and 14. The significant differences (p < 0.05) between groups are indicated with a star sign. ALP: alkaline phosphatase; DPSCs: dental pulp stem cells; PCL: polycaprolactone; PEO: polyethylene oxide; β‐GP: β‐glycerophosphate

3.3. Gene expression

Important osteogenic genes expression was evaluated in DPSCs cultured on PCL‐PEO (basal), PCL‐PEO (osteo), PCL‐PEO+β‐GP (basal), and PCL‐PEO+β‐GP (osteo) groups at days 7 and 14 after cell seeding (Figure 6). The highest Runx‐2 expression level was detected in DPSCs cultured on PCL‐PEO+β‐GP (osteo), whereas its expression also increased in PCL‐PEO (osteo) and PCL‐PEO+β‐GP (basal) groups compared with the PCL‐PEO (basal) group on both Day 7 and 14. The expression patterns of Col‐I, OSN, and OSC genes in DPSCs were also similar on both Day 7 and 14. The highest expression level of these genes was observed in DPSCs cultured on PCL‐PEO+β‐GP (osteo) in comparison with the other three substrates. These genes expressed in DPSCs cultured on PCL‐PEO (osteo) were significantly higher than those cultured on PCL‐PEO (basal) and PCL‐PEO+β‐GP (basal), respectively. In addition, the expression levels of these genes in DPSCs cultured on PCL‐PEO+β‐GP (basal) also significantly increased in comparison with those cultured on PCL‐PEO (basal).

Figure 6.

Figure 6

Open in a new tab

Expression fold changes of Runt‐related transcription factor 2 (Runx2), collagen type‐I, osteonectin (OSN), and osteocalcin (OSC) in cultured DPSCs on PCL‐PEO under basal and osteogenic medium and on PCL‐PEO+β‐GP under basal and osteogenic medium at days 7 and 14. The significant differences (p < 0.05) between groups are indicated with a star sign. DPSCs: dental pulp stem cells; PCL: polycaprolactone; PEO: polyethylene oxide; β‐GP: β‐glycerophosphate

3.4. Protein staining

Two best groups among all osteogenic evaluations, to date, in this study were DPSCs seeded‐PCL‐PEO (osteo) and PCL‐PEO+β‐GP (osteo), which were selected for OSC protein evaluation using ICC on Day 21 after cell seeding. As observed by DAPI staining, the number of cells in PCL‐PEO+β‐GP (osteo) group (Figure 7c) were higher than PCL‐PEO (osteo) group (Figure 7b) on Day 21. In addition, the rate of OSC protein expression increased significantly in DPSCs cultured on the PCL‐PEO+β‐GP (osteo; Figure 7b) in comparison with those cultured on the PCL‐PEO (osteo; Figure 7b).

Figure 7.

Figure 7

Open in a new tab

Immunocytochemistry staining of Osteocalcin protein as an important osteogenic‐related protein in cultured DPSCs on PCL‐PEO (b) and PCL‐PEO+β‐GP (d) 21 days after cell seeding under osteogenic medium. Cells nuclear stained with DAPI (a,c) [Color figure can be viewed at wileyonlinelibrary.com]

4. DISCUSSION

In the present study, a nanofibrous composite scaffold fabricated from blended PCL and PEO, filled by β‐GP as a critical factor during the osteogenic differentiation process, was reported to be used in dental and bone tissue engineering . Scaffolds or implants that can play ECM role at the injured tissues also induce differentiation to stem cells, in situ. Releasing of the growth factors has attracted much attention among surgeons and researchers in the field of tissue engineering (Beiki, Zeynali, Taghiabadi, Seyedjafari, & Kehtari, 2018; Gattazzo, Urciuolo, & Bonaldo, 2014). It is well known that β‐GP plays a great role in mineralization of the bone cells, which is a critical characteristic of these cells, although its role in mineralization induction essentially depended on the ALP enzymes that can cut organic phosphates and concentrate them (Chung et al., 1992; Coelho & Fernandes, 2000). PEO was selected as its water solubility (Desai & Hubbell, 1991), which can help to release of the β‐GP and increase the PCL wettability as cells need to attach by its membrane proteins to the hydrophilic surfaces (Okano, Yamada, Okuhara, Sakai, & Sakurai, 1995). Scaffolds characterization demonstrated that morphology and size of the nanofibers were not significantly different in nanofibers with and without β‐GP. Kinetics of β‐GP release from the composite scaffold was also appropriate and stable during the period of the study. The SEM and MTT results confirmed scaffolds biocompatibility and β‐GP positive effects on the proliferation rate of the DPSCs, a week after cell seeding. Previously, we also reported that PCL‐PEO has a great potential to release the dexamethasone and has positive effects on the proliferation rate of the adipose‐derived mesenchymal stem cells (Ghiaee et al., 2017). ALP activity of the DPSCs cultured on β‐GP content scaffolds was significantly increased and because of this calcium deposition and mineralization were also enhanced as a critical characteristic of the osteogenic differentiation process. ALP enzyme plays a crucial role in initializing osteogenesis and mineralization process and inhibition of this enzyme may stop the same (Fortuna, Anderson, Carty, & Sajdera, 1980; Tenenbaum, 1987). Owing to more detailed evaluation of the β‐GP effects on DPSCs differentiation process, expression fold change of the four important osteogenic gene markers was evaluated and the results demonstrated Runx2 expression level as a critical primary gene of the differentiation process (Komori, 2010), which was significantly affected by release of the β‐GP with higher distance of the other genes that could be related to the role of this gene on the promoting the ALP activity. In addition, the highest expression level of the other genes was also observed in the DPSCs cultured on the PCL‐PEO+β‐GP scaffold. To determine whether this increase in expression at the gene level continues to increase expression at the protein level, the OSC protein expression was evaluated by ICC in DPSCs cultured on two best groups based on gene expression level including PCL‐PEO (osteo) and PCL‐PEO+β‐GP (osteo). ICC results also showed that OSC protein was expressed higher in DPSCs cultured on PCL‐PEO+β‐GP compared with those cultured on PCL‐PEO (osteo). Several studies showed that in the mandibular defect the use of growth factors, such as BMP2 could be beneficial in promoting ossifications, although this may not have the same osteogenic effects at the in vitro level (Herford & Boyne, 2008; Jiang et al., 2009). However, based on the result of this study β‐GP effects on in vitro osteogenic differentiation was approved using evaluation of the several osteogenic markers and it could be considered as a candidate to get incorporated in any form of the biopolymeric implants, such as nanofibers, nanospheres, 3D printed, and hydrogels that can be used in the dental, oral, and maxillofacial tissue engineering.

5. CONCLUSION

It can be concluded that scaffolds content β‐GP has great osteoinductive potential even when other osteogenic factors are absent. In addition, DPSCs cultured on PCL‐PEO+β‐GP demonstrated a great osteogenic differentiation potential according to the several osteogenic markers evaluation using ALP activity, calcium content, and gene and protein expression assays. Finally, the results showed that PCL‐PEO+β‐GP has a promising potential to be used as oral maxillofacial implants in dental tissue engineering.

Contributor Information

Fatemeh Soleimanifar, Email: maryamsoleimani03@gmail.com.

Bahareh Nazemisalman, Email: drnazemi@zums.ac.ir.

References

REFERENCES

  1. Abazari, M. F. , Soleimanifar, F. , Nouri aleagha, M. , Torabinejad, S. , Nasiri, N. , Khamisipour, G. , … Kehtari, M. (2018). PCL/PVA nanofibrous scaffold improve insulin‐producing cells generation from human induced pluripotent stem cells. Gene, 671, 50–57. [DOI] [PubMed] [Google Scholar]
  2. Beiki, B. , Zeynali, B. , Taghiabadi, E. , Seyedjafari, E. , & Kehtari, M. (2018). Osteogenic differentiation of Wharton's jelly‐derived mesenchymal stem cells cultured on WJ‐scaffold through conventional signalling mechanism. Artificial Cells, Nanomedicine, and Biotechnology, 1–11. 10.1080/21691401.2018.1528981 [DOI] [PubMed] [Google Scholar]
  3. Chung, C.‐H. , Golub, E. E. , Forbes, E. , Tokuoka, T. , & Shapiro, I. M. (1992). Mechanism of action of β‐glycerophosphate on bone cell mineralization. Calcified Tissue International, 51(4), 305–311. [DOI] [PubMed] [Google Scholar]
  4. Coelho, M. J. , & Fernandes, M. H. (2000). Human bone cell cultures in biocompatibility testing. Part II: Effect of ascorbic acid, β‐glycerophosphate and dexamethasone on osteoblastic differentiation. Biomaterials, 21(11), 1095–1102. [DOI] [PubMed] [Google Scholar]
  5. Deitzel, J. M. , Kleinmeyer, J. D. , Hirvonen, J. K. , & Tan, N. C. B. (2001). Controlled deposition of electrospun poly (ethylene oxide) fibers. Polymer, 42(19), 8163–8170. [Google Scholar]
  6. Desai, N. P. , & Hubbell, J. A. (1991). Solution technique to incorporate polyethylene oxide and other water‐soluble polymers into surfaces of polymeric biomaterials. Biomaterials, 12(2), 144–153. [DOI] [PubMed] [Google Scholar]
  7. Enderami, S. E. , Kehtari, M. , Abazari, M. F. , Ghoraeian, P. , Nouri Aleagha, M. , Soleimanifar, F. , … Mostafavi, H. (2018). Generation of insulin‐producing cells from human induced pluripotent stem cells on PLLA/PVA nanofiber scaffold. Artificial Cells, Nanomedicine, and Biotechnology, 1–8. 10.1080/21691401.2018.1443466 [DOI] [PubMed] [Google Scholar]
  8. Enderami, S. E. , Soleimani, M. , Mortazavi, Y. , Nadri, S. , & Salimi, A. (2018). Generation of insulin‐producing cells from human adipose‐derived mesenchymal stem cells on PVA scaffold by optimized differentiation protocol. Journal of Cellular Physiology, 233(5), 4327–4337. [DOI] [PubMed] [Google Scholar]
  9. Fortuna, R. , Anderson, H. C. , Carty, R. P. , & Sajdera, S. W. (1980). Enzymatic characterization of the matrix vesicle alkaline phosphatase isolated from bovine fetal epiphyseal cartilage. Calcified Tissue International, 30(1), 217–225. [DOI] [PubMed] [Google Scholar]
  10. Gattazzo, F. , Urciuolo, A. , & Bonaldo, P. (2014). Extracellular matrix: A dynamic microenvironment for stem cell niche. Biochimica et Biophysica Acta, 1840(8), 2506–2519. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Ghiaee, A. , Pournaqi, F. , Vakilian, S. , Mohammadi‐Sangcheshmeh, A. , & Ardeshirylajimi, A. (2017). Adapted dexamethasone delivery polyethylene oxide and poly (ɛ‐caprolactone) construct promote mesenchymal stem cells chondrogenesis. Artificial Cells, Nanomedicine, and Biotechnology, 45(8), 1640–1648. [DOI] [PubMed] [Google Scholar]
  12. Gronthos, S. , Brahim, J. , Li, W. , Fisher, L. W. , Cherman, N. , Boyde, A. , … Shi, S. (2002). Stem cell properties of human dental pulp stem cells. Journal of Dental Research, 81(8), 531–535. [DOI] [PubMed] [Google Scholar]
  13. Herford, A. S. , & Boyne, P. J. (2008). Reconstruction of mandibular continuity defects with bone morphogenetic protein‐2 (rhBMP‐2). Journal of Oral and Maxillofacial Surgery, 66(4), 616–624. [DOI] [PubMed] [Google Scholar]
  14. Hosseini, F. S. , Soleimanifar, F. , Khojasteh, A. , & Ardeshirylajimi, A. (2018). Promoting osteogenic differentiation of human‐induced pluripotent stem cells by releasing Wnt/β‐catenin signaling activator from the nanofibers. Journal of Cellular Biochemistry. 10.1002/jcb.27921 [DOI] [PubMed] [Google Scholar]
  15. Jiang, X. , Zhao, J. , Wang, S. , Sun, X. , Zhang, X. , Chen, J. , … Zhang, Z. (2009). Mandibular repair in rats with premineralized silk scaffolds and BMP‐2‐modified bMSCs. Biomaterials, 30(27), 4522–4532. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Komori, T. (2010). Regulation of bone development and extracellular matrix protein genes by RUNX2. Cell and Tissue Research, 339(1), 189–195. [DOI] [PubMed] [Google Scholar]
  17. Kweon, H. , Yoo, M. K. , Park, I. K. , Kim, T. H. , Lee, H. C. , Lee, H.‐S. , … Cho, C.‐S. (2003). A novel degradable polycaprolactone networks for tissue engineering. Biomaterials, 24(5), 801–808. [DOI] [PubMed] [Google Scholar]
  18. Labet, M. , & Thielemans, W. (2009). Synthesis of polycaprolactone: A review. Chemical Society Reviews, 38(12), 3484–3504. [DOI] [PubMed] [Google Scholar]
  19. Li, Y.‐F. , Gregersen, H. , Nygaard, J. V. , Cheng, W. , Yu, Y. , Huang, Y. , … Chen, M. (2015). Ultraporous nanofeatured PCL–PEO microfibrous scaffolds enhance cell infiltration, colonization and myofibroblastic differentiation. Nanoscale, 7(36), 14989–14995. [DOI] [PubMed] [Google Scholar]
  20. Liu, H. , Gronthos, S. , & Shi, S. (2006). Dental pulp stem cells. Methods in enzymology, 419, 99–113. [DOI] [PubMed] [Google Scholar]
  21. Ma, Z. , Mao, Z. , & Gao, C. (2007). Surface modification and property analysis of biomedical polymers used for tissue engineering. Colloids and Surfaces B: Biointerfaces, 60(2), 137–157. [DOI] [PubMed] [Google Scholar]
  22. Moradi, S. L. , Golchin, A. , Hajishafieeha, Z. , Khani, M. M. , & Ardeshirylajimi, A. (2018). Bone tissue engineering: Adult stem cells in combination with electrospun nanofibrous scaffolds. Journal of Cellular Physiology, 233, 6509–6522. [DOI] [PubMed] [Google Scholar]
  23. Neville, B. W. , Damm, D. D. , Chi, A. C. , & Allen, C. M. (2015). Oral and maxillofacial pathology, St. Louis, Missouri: Elsevier Health Sciences; [Google Scholar]
  24. Okano, T. , Yamada, N. , Okuhara, M. , Sakai, H. , & Sakurai, Y. (1995). Mechanism of cell detachment from temperature‐modulated, hydrophilic‐hydrophobic polymer surfaces. Biomaterials, 16(4), 297–303. [DOI] [PubMed] [Google Scholar]
  25. Paknejad, Z. , Jafari, M. , Nazeman, P. , Rad, M. R. , & Khojasteh, A. (2017). Periodontal and peri‐implant hard tissue regeneration. Biomaterials for Oral and Dental Tissue Engineering, Woodhead Publishing, 405–428. 10.1016/B978-0-08-100961-1.00024-4 [DOI] [Google Scholar]
  26. Reilly, G. C. , & Engler, A. J. (2010). Intrinsic extracellular matrix properties regulate stem cell differentiation. Journal of Biomechanics, 43(1), 55–62. [DOI] [PubMed] [Google Scholar]
  27. Salehi‐Nik, N. , Rad, M. R. , Nazeman, P. , & Khojasteh, A. (2017). Polymers for oral and dental tissue engineering. Biomaterials for Oral and Dental Tissue Engineering, Woodhead Publishing, 25–46. 10.1016/B978-0-08-100961-1.00003-7 [DOI] [Google Scholar]
  28. Seong, J. M. , Kim, B.‐C. , Park, J.‐H. , Kwon, I. K. , Mantalaris, A. , & Hwang, Y.‐S. (2010). Stem cells in bone tissue engineering. Biomedical Materials, 5(6), 062001. [DOI] [PubMed] [Google Scholar]
  29. Shan, X.‐F. , Chen, H.‐M. , Liang, J. , Huang, J.‐W. , & Cai, Z.‐G. (2015). Surgical reconstruction of maxillary and mandibular defects using a printed titanium mesh. Journal of Oral and Maxillofacial Surgery, 73(7), 1437. [DOI] [PubMed] [Google Scholar]
  30. Soleimanifar, F. , Hosseini, F. S. , Atabati, H. , Behdari, A. , Kabiri, L. , Enderami, S. E. , … Saburi, E. (2018). Adipose‐derived stem cells‐conditioned medium improved osteogenic differentiation of induced pluripotent stem cells when grown on polycaprolactone nanofibers. Journal of Cellular Physiology, 10.1002/jcp.27697 [DOI] [PubMed] [Google Scholar]
  31. Tenenbaum, H. C. (1987). Levamisole and inorganic pyrophosphate inhibit beta‐glycerophosphate induced mineralization of bone formed in vitro. Bone and Mineral, 3(1), 13–26. [PubMed] [Google Scholar]
  32. Yoo, H. S. , Kim, T. G. , & Park, T. G. (2009). Surface‐functionalized electrospun nanofibers for tissue engineering and drug delivery. Advanced Drug Delivery Reviews, 61(12), 1033–1042. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Cellular Physiology are provided here courtesy of Wiley

RESOURCES