Abstract
Osteoporosis (OP) is a metabolic disease caused by multiple factors, which is characterized by a reduction of bone mass per unit volume and destruction of bone microstructure. Aberrant osteoclast function is the main cause of OP, therefore, regulating the differentiation and function of osteoclast is one of the treatment strategies for OP. Pectolinarigenin (PEC) is a medicinal implant isolated from Fragrant Eupatorium. Our experimental data showed that PEC was able to inhibit receptor activator of nuclear factor‐κB ligand (RANKL)‐induced osteoclastogenesis in vitro, by tartrate‐resistant acid phosphatase (TRAcP) staining, Fibrous actin ring formation, and hydroxyapatite resorption assays. In terms of mechanism, PEC inhibited the expression of the osteoclastogenesis‐related gene, including cathepsin K (Ctsk), matrix metalloproteinase 9 (Mmp9), and TRAcP (Acp5). Western blot analysis demonstrated that PEC could significantly block the activation of RANKL‐induced mitogen‐activated protein kinase signaling cascades and was able to suppress the protein expression of nuclear factor of activated T‐cells and c‐Fos. Meanwhile, the intracellular reactive oxygen species levels were also reduced by PEC in a concentration‐dependent manner. Further, PEC could prevent the ovariectomy‐induced bone loss in vivo. Summarizing all, our data suggested that PEC inhibits osteoclast formation and function and RANKL signaling pathways, and thus could potentially be used in the treatment the osteoclast‐related bone loss diseases.
Keywords: MAPK, osteoclast, osteoporosis, pectolinarigenin
Pectolinarigenin (PEC) is a medicinal implant isolated from the Fragrant Eupatorium herb. It was demonstrated that PEC significantly inhibited receptor activator of nuclear factor‐κB ligand‐induced osteoclast differentiation and function in vitro and also could prevent the ovariectomy‐induced bone loss in vivo. Taken together, PEC can be potentially used in the development of a novel drug for osteoclast‐related bone diseases.

1. INTRODUCTION
In mature bones, bone remodeling gradually replaces old and damaged bone tissue with new tissue, which provides a source of calcium and phosphorus and maintains bone health. To adapt mechanical loading and growth, bone tissue is constantly self‐reshaping to maintain mineral salt metabolism balance (Seeman, 2009). Remodeling of bone tissue involves two actions, including osteoblast‐mediated osteogenesis and osteoclast‐mediated bone destruction. Abnormal bone resorption or bone formation can lead to steady‐state disorders of the skeletal system, such as Paget's disease and loosening around the prosthesis resulting from joint replacement (AbuAmer, Darwech, & Clohisy, 2007; Lewis et al., 1993). Fracture is the most common complication of osteoporosis. Once the fracture happens to the patients, life quality sharply declines, and the risk of secondary fracture is significantly increased.
Osteoclasts are multinucleated macrophages originated from the hematopoietic stem cell (He et al., 2018). Macrophage colony‐stimulating factor (M‐CSF) and receptor activator of nuclear factor‐κB ligand (RANKL) are required for the differentiation of osteoclasts (Arai et al., 1999; Novack, 2011). Binding of RANKL to the receptor activator of nuclear factor‐κB (RANK) recruits the tumor necrosis factor receptor‐associated factor 6 (TRAF6), which initiates downstream multiple signaling cascades, including nuclear factor‐κB (NF‐κB) and mitogen‐activated protein kinase (MAPK) pathways (Kikuta & Ishii, 2013; Takayanagi, 2007aa). Following activation, nuclear factor of activated T‐cell (NFATc1) leads to the differentiation of the bone marrow–derived precursor cells towards osteoclasts (Takayanagi et al., 2002). In addition, reactive oxygen species (ROS) are commonly associated with cytotoxicity and cell survival (Carmody & Cotter, 2001). The destitute generation of ROS was also found to be consistent with poor RANKL‐mediated osteoclast formation (Hyeon, Lee, Yang, & Jeong, 2013).
Pectolinarigenin (PEC) is a natural flavonoid compound, which was demonstrated to inhibit the growth of nasopharyngeal carcinoma cells (C. Wang et al., 2016). In addition, PEC can inhibit the growth and metastasis of osteosarcoma cells by interacting with the STAT3 pathway (Zhang et al., 2016). However, the role of PEC on the RANKL‐induced osteoclastogenesis is unknown.
In the study, we examined the in vitro effect of PEC on osteoclast formation and activation, as well as signaling mechanisms, and we also determined the therapeutic potential of PEC on the osteolytic condition in ovariectomized mice. We found that PEC inhibited RANKL‐induced osteoclast formation and function, ROS production, as well as MAPK and NFATc1 signaling pathways. Further, PEC prevented the ovariectomy‐induced bone loss in vivo, suggesting a potential therapeutic effect for osteolysis.
2. MATERIALS AND METHODS
2.1. Materials and reagents
The α‐minimum essential medium Eagle (α‐MEM) and fetal bovine serum were purchased from Gibco‐BRL (Sydney, Australia). Pectolinarigenin (Figure 1a) was purchased from Chengdu Must Bio‐Technology Co., Ltd (Chengdu, Sichuan Province, China). Tartrate‐resistant acid phosphatase (TRAcP)‐staining kit, cell counting kit‐8, cell dissociation solution and 4′,6‐diamidino‐2‐phenylindole (DAPI) were procured from Sigma‐Aldrich (St Louis, MO). All primary antibodies were both purchased from Cell Signaling Technology (Danvers, MA). R&D Systems (Minneapolis, MN) offered M‐CSF. Receptor activator of nuclear factor‐κB ligand (RANKL) was obtained as previously described (Xu et al., 2000). Beyotime (Jiangsu, China) offered ROS detection kit. Rhodamine‐conjugated phalloidin was purchased from Molecular Probes, Inc. (Eugene, OR).
Figure 1.

The chemical structure and cytotoxic effect of PEC. (a) The chemical structure of PEC. (b) BMMs were treated with a serial of concentrations of PEC (0, 1.25, 2.5, 5, 10, and 20 μM) for 48 hr. Cell viability was then measured using CCK‐8 assay (n = 3). BMM: bone marrow macrophage; CCK‐8: cell counting kit‐8; PEC: pectolinarigenin
2.2. Cell culture and in vitro osteoclastogenesis assay
Bone marrow macrophages (BMMs) used in this study was obtained by flushing the bone marrow from the femur and tibia of 6‐week‐old C57/BL6 mice. BMMs (6 × 103) were seeded in each well of 96‐well culture plates. After the cells were cultured overnight to adhere, BMMs were stimulated with complete medium supplemented with M‐CSF (50 ng/ml) and RANKL (100 ng/ml), in the presence or absence of PEC (0, 1.25, 2.5, 5, and 10 μM). After 5 days, mature osteoclasts were formed. After the cells were fixed and washed, the cells were stained using TRAcP staining kit, TRAcP‐positive multinucleated cells were counted as osteoclasts. Besides, we also explored the effects of PEC in osteoclast differentiation at a different stage. Cells were plated into 96‐well culture plates with M‐CSF (50 ng/ml) and RANKL (100 ng/ml), and PEC was added on Days 1, 3, and 5, respectively, or whole treatment period (Days 1–5). Finally, the number of osteoclasts in every well was analyzed using ImageJ software (NIH, Bethesda, MD).
2.3. CCK‐8 cell proliferation and cytotoxicity assay
BMMs were plated in 96‐well plates at a density of 6 × 103 cells/well and cultured with M‐CSF (50 ng/ml) overnight. The following day, cells were treated with different concentrations of PEC (1.25, 2.5, 5, 10, and 20 μM) for 48 hr. And then cell counting kit‐8 (CCK‐8) solution (10 μl/well) was added into each well and incubated at 37°C with 5% CO2 for 2 hr. After incubation, the absorbance was measured at 450 nm using a microplate reader (Multiskan Spectrum; Thermo LabSystems, Chantilly, VA).
2.4. Fibrous actin (F‐actin) rings formation assay
BMMs were seeded in six‐well culture plates with M‐CSF (50 ng/ml) overnight to adhere. Mature osteoclasts were induced by M‐CSF (50 ng/ml) and RANKL (100 ng/ml), with or without varying doses of PEC (5 and 10 μM). After this, the plates were fixed in 4% paraformaldehyde, and 0.1% Triton X‐100–phosphate‐buffered saline (PBS) were used to permeabilize osteoclast, followed by being blocked with 3% bovine serum albumin (BSA) in PBS for 2 hr. The F‐actin belt was stained by rhodamine‐conjugated phalloidin in the dark for 1 hr, and the osteoclasts were subsequently washed with PBS for three times before the staining of DAPI for nuclei. Finally, images were captured under a fluorescent microscope.
2.5. Hydroxyapatite resorption pit formation assay
Osteoclast activities were also examined via hydroxyapatite resorption assay. BMMs were plated into six‐well culture plates at a density of 1 × 105 and stimulated in the presence of 50 ng/ml M‐CSF and 100 ng/ml RANKL. The osteoclasts were collected by cell dissociation solution at the early stage of osteoclast differentiation and translocated into hydroxyapatite‐coated plates (Corning, Inc., Corning, NY). The cells were incubated with M‐CSF and RANKL in the presence or absence of PEC (5 and 10 μM) until mature osteoclasts were formed, followed by being removed using sodium hypochlorite solution. The areas of hydroxyapatite resorption pit were measured under the microscope (Nikon Corporation, Tokyo, Japan) and the areas of resorption were analyzed by ImageJ software.
2.6. Intracellular ROS generation assay
BMMs were cultured with RANKL and M‐CSF, with varying concentrations of PEC (5 and 10 μM) for 48 hr. And then the dichloro‐dihydro‐fluorescein diacetate (DCFH‐DA) diluted in pure α‐MEM (without serum) (1:1,000), was added into each well for 1 ml. The cells were incubated for 30 min at the conditions of 37℃ with 5% CO2 followed by ROS assay using ROS detection kit. Subsequently, dichlorofluorescein (DCF) fluorescence was detected by fluorescence microscope at an excitation wavelength of 488 nm and at an emission wavelength of 525 nm. The average fluorescence intensity was analyzed using ImageJ software.
2.7. Western blot analysis
BMMs were plated into six‐well culture plates evenly. After adherence, the cells were incubated in serum‐free medium for 3 hr and then pretreated with or without 10 μM PEC for 1 hr. The cells were lysed using radioimmunoprecipitation assay buffer to collect the total protein after stimulated with RANKL (100 ng/ml) for 0, 5, 10, 20, 30, and 60 min. To explore the PEC‐treated long‐term effects on osteoclastogenesis BMMs (1 × 105 cells/well) were cultured in complete medium containing M‐CSF (50 ng/ml) and RANKL (100 ng/ml), simultaneously stimulated in the presence or absence of PEC (10 μM) for stated time (0, 1, 3, and 5 days). Protein was separated on sodium dodecyl sulfate polyacrylamide gel and transferred to nitrocellulose membranes. The NC membranes were blocked in 5% BSA for 1 hr to interdict nonspecific bindings and then incubate with different primary antibodies (1:1,000) at 4°C for 12 hr. The next day, these NC membranes were washed and incubated with horseradish peroxidase–conjugated secondary antibodies in the dark for 1.5 hr. After the membranes were washed with a mixture of Tris‐buffered saline (TBS) and Tween 20 for three times, the antibody reactivity was probed with ImageQuant LAS 4000 (GE Healthcare, Silverwater, Australia) and the gray values were analyzed in ImageJ software.
2.8. Quantitative reverse‐transcription polymerase chain reaction (RT‐PCR) assay
For real‐time PCR, BMMs (1 × 105 cells/well) were cultured in six‐well plates with RANKL and M‐CSF for 5 days, with varying doses of PEC (5 and 10 μM). Total RNA was obtained using TRIzol reagent and we used RevertAid First Strand cDNA Synthesis Kit to synthesize the complementary DNA (cDNA). The cDNA was then used to carry out the qPCR (RT‐PCR), based on SYBR Green PCR MasterMix, and the expression levels of osteoclast‐related messenger RNA were normalized to glyceraldehyde 3‐phosphate dehydrogenase expression and calculated by comparative Ct (ΔCt) method. The specific primers sequences were shown in Table 1.
Table 1.
Primer sequences for q‐PCR
| Genes | Primer sequences | |
|---|---|---|
| Cathepsin K (Ctsk) | Forward | 5′‐GGGAGAAAAACCTGAAGC‐3′ |
| Reverse | 5′‐ATTCTGGGGACTCAGAGC‐3′ | |
| MMP9 (Mmp9) | Forward | 5′‐CGTGTCTGGAGATTCGACTTGA‐3′ |
| Reverse | 5′‐TTGGAAACTCACACGCCAGA‐3′ | |
| TRAcP (Acp5) | Forward | 5′‐TGTGGCCATCTTTATGCT‐3′ |
| Reverse | 5′‐GTCATTTCTTTGGGGCTT‐3′ | |
| Atp6v0d2 | Forward | 5′‐GTGAGACCTTGGAAGACCTGAA‐3′ |
| Reverse | 5′‐GAGAAATGTGCTCAGGGGCT‐3′ | |
| GAPDH | Forward | 5′‐ACCACAGTCCATGCCATCAC‐3′ |
| Reverse | 5′‐TCCACCACCCTGTTGCTGTA‐3′ | |
Note. GAPDH: glyceraldehyde 3‐phosphate dehydrogenase; MMP9: matrix metalloproteinase 9; TRAcP: tartrate‐resistant acid phosphatase
2.9. Animal model construction and effect verification in vivo
All experimental procedures were performed in accordance with the guidelines of the Animal Care Committee of Guangxi Medical University. Ten‐week‐old female C57/BL6 mice were divided into four groups (n = 6) randomly, including ovariectomized (OVX) group (OVX mice injection with normal saline), sham group (sham‐operated control and injection with normal saline), low‐dose group (OVX mice treatment with 5 mg/kg PEC), and high‐dose group (OVX mice treatment with 10 mg/kg PEC). These mice were anesthetized with 10% chloral hydrate after fasting for 6 hr and then the abdominal cavity was cut through the midline incision of the waist and back to remove bilateral ovaries and partial oviducts. After the operation, the mice were put into a cage to move freely and eat disinfectant pellets and purified water to recover for 7 days. Then, 5 mg·kg and 10 mg·kg PEC or saline were administered every two days over a 6‐week‐treatment period and the administration route was a peritoneal injection. At the end of the experiment, 10% chloral hydrate was used to anesthetize the OVX mice before killed and the tibia was achieved.
The tibia separated from mice was fixed with 4% paraformaldehyde for micro‐computed tomography (CT) scanning to obtain two‐ and three‐dimensional (3D) bone microstructure images. Histomorphometric parameters of region of interest (ROI) at the growth plate were determined by CTAn software (Bruker micro‐CT, Kontich, Belgium), including bone volume/total volume (BV/TV), bone surface area/total volume (BS/TV), and trabecular number (Tb. N). For histopathology, the fixed tibias were soaked in 12% ethylenediaminetetraacetic acid (pH 7.4) for 2 weeks to decalcify and then embedded in paraffin to stain for the TRAcP activity. After staining, images enlarged at the magnifications of 40 and 100 times were taken by a microscope. TRAcP‐positive cell number was analyzed using ImageJ software.
2.10. Statistical analysis
All results are representative of three independent experiments and are presented as mean ± SD. One‐way analysis of variance test and Student's t test were used to examine the significance of differences among the results, with p < 0.05 being considered as significant (95% confidence intervals).
3. RESULTS
3.1. PEC attenuated RANKL‐induced osteoclast formation and function in vitro
The chemical structure of PEC is presented in Figure 1a. First, using CCK‐8 cell proliferation and cytotoxicity assay, we found that PEC did not induce cell death in osteoclatic precursor cells at a concentration up to 20 μM (Figure 1b). Next, to determine the effects of PEC on osteoclast differentiation, we performed two experiments including dose‐dependent osteoclastogenesis assay and time‐dependent osteoclastogenesis assay. As a result, PEC impaired RANKL‐induced osteoclastogenesis in a concentration‐dependent manner, especially at the doses of 10 μM (Figure 2a–c). The numbers and areas of TRAcP‐positive cells were decreased obviously by the treatment of PEC (10 μM) at the early stage of osteoclast differentiation (Day 1; Figure 2d–f). To further investigate whether the osteoclast functions were affected by PEC, we performed the F‐actin formation assay and hydroxyapatite resorption assay. It was revealed that well‐defined F‐actin belts were observed after RANKL stimulation, whereas the average number of nuclei per cell and the areas of F‐actin belts each well were abolished substantially in the groups treated with PEC at the concentrations of 5 and 10 μM (Figure 3a–c). The results of the hydroxyapatite resorption assay were consistent with the degree of F‐actin formation and we used hydroxyapatite‐coated plates to evaluate the ability of bone resorption after treated with PEC. We found that PEC could prevent the hydroxyapatite resorption pit formation (Figure 3d,e). Hence, PEC attenuates RANKL‐induced osteoclast formation and function in vitro without any overt cytotoxicity.
Figure 2.

PEC inhibited RANKL‐induced osteoclast differentiation. (a) Representative images of TRAcP staining. BMMs were cultured in the presence of M‐CSF (50 ng/ml) and RANKL (100 ng/ml) with indicated concentrations of PEC for 5 days. (b,c) Quantification of TRAcP‐positive osteoclasts. Cells with more than three nuclei were identified as osteoclasts. PEC notably inhibited RANKL‐induced osteoclastogenesis at an early stage. (d) Osteoclast formation was induced by RANKL (50 ng/ml), and the cells were treated by 10 μM PEC for the indicated period of time. (e) The time periods of the treatment of PEC. (f) TRACP‐positive multinucleated cells (nuclei, ≥3) with the treatment of PEC were counted (n = 3). *p < 0.05, **p < 0.01, and ***p < 0.001, relative to RANKL‐induced control group. Scale bar, 200 μm. BMM: bone marrow macrophage; M‐CSF: macrophage colony–stimulating factor; PEC: pectolinarigenin; RANKL: receptor activator of nuclear factor‐κB ligand; TRAcP: tartrate‐resistant acid phosphatase [Color figure can be viewed at wileyonlinelibrary.com]
Figure 3.

The effects of PEC on osteoclast F‐actin belt formation and bone resorption. (a) Representative images of mature osteoclasts stained for F‐actin belt and nuclei using Rhodamine Phalloidin and DAPI respectively; (b) The average number of nuclei per osteoclast. (c) The average of F‐actin belt area per field was analyzed (n = 3). (d) Representative images of hydroxyapatite resorption. (e) Quantification of resorbed hydroxyapatite surface area (n = 3). (f) Quantification of DCF fluorescence intensity averaged in cells (n = 3). *p < 0.05, **p < 0.01, and ***p < 0.001, relative to RANKL‐induced control group. Scale bar, 200 μm. (g) Cells were stimulated with RANKL and with or without the addition of PEC. Intracellular ROS generation was detected by the cell permeant, oxidation‐sensitive dye H2DCFHDA using confocal microscopy. DCF: dichlorofluorescein; F‐actin: fibrous actin; RANKL: receptor activator of nuclear factor‐κB ligand; PEC: pectolinarigenin; ROS: reactive oxygen species [Color figure can be viewed at wileyonlinelibrary.com]
3.2. PEC depresses intracellular ROS level
As for detecting the intracellular ROS level, we used fluorescent probe DCFH‐DA to examine whether PEC had any effect on RANKL‐induced ROS generation. As demonstrated in Figure 3, the ROS production and the intensity of DCF fluorescence per positive cell in PEC‐treated groups significantly decreased compared with the RANKL‐stimulated group (Figure 3f,g). Thus, the data indicated that PEC suppressed RANKL‐induced ROS production.
3.3. PEC suppressed osteoclast formation via MAPK‐signaling pathway
To expound the molecular mechanisms by which PEC inhibited RANKL‐induced osteogenesis, we performed western blot analyses. The results of western blot showed that RANKL stimulation for 5 and 10 min markedly increased phosphorylation of p38, whereas this change was repressed in the PEC‐treated group (Figure 4a,b). In addition, phosphorylation of Jun N‐terminal kinase (JNK) was significantly inhibited at all time points by PEC (Figure 4a,b). The effect of PEC on extracellular signal‐regulated kinase (ERK) phosphorylation was obscure (Figure 4a,b) as well as NF‐κB signaling, the inconspicuous upgradation of IκBα and the anti‐phosphorylation of p65 were observed (Figure 4c,d). These data indicated that PEC inhibited the activation of the MAPK pathway especially by suppressing the activity of p38 and JNK but it has little effect on NF‐κB signaling.
Figure 4.

The role of PEC on RANKL‐induced signaling pathways. (a) Representative western blot images of the effects of PEC on JNK and p38 phosphorylation induced by RANKL. BMMs were treated with RANKL for the indicated time points with or without the addition of 10 μM PEC. (b) Quantification of the ratios of band intensity of phosphorylated p38, ERK, and JNK relative to total p38, ERK, and JNK (n = 3). (c) Representative western blot images of the effects of PEC on p65 phosphorylation and IκBα degradation. (d) Quantification of the ratios of band intensity of phosphorylated p65 and IκBα relative to total p65 and β‐actin respectively (n = 3). (e) Representative western blot images of the effects of PEC on the protein expression of NFATc1 and c‐Fos. (f) Quantification of the ratios of band intensity of NFATc1 and c‐Fos relative to β‐actin (n = 3). (g–j) mRNA expression levels of osteoclastogenesis‐related marker genes including Ctsk, Atp6v0d2, Acp5, and Mmp9 (n = 3). *p < 0.05, **p < 0.01, and ***p < 0.001, relative to RANKL‐induced control group. ERK: extracellular signal‐regulated kinases; JNK: Jun N‐terminal kinase; mRNA: messenger RNA; NFATc1: nuclear factor of activated T‐cell; PEC: pectolinarigenin; RANKL: receptor activator of nuclear factor‐κB ligand
3.4. PEC abrogated RANKL‐induced activation of NFATc1, c‐Fos, and expression of NFATc1‐targeted gene
We next investigated the effect of PEC on NFATc1 and c‐Fos activation, which were downstream of MAPK‐signaling pathway. Under the interference by PEC, the NFATc1, and c‐Fos proteins dramatically declined after stimulating with RANKL for three days (Figure 4e,f). Following these results, we conjectured that PEC could reduce the expression of various osteoclast marker genes. As demonstrated in RT‐PCR, the expression level of NFATc1‐target genes such as Ctsk, Atp6v0d2, Acp5, and Mmp9 were downregulated by PEC in a dose‐dependent manner (Figure 4g–j). Thus, these results revealed that PEC was able to inhibit NFATc1, c‐Fos protein expression, and relevant osteoclast‐specific gene expression regulated by NFATc1.
3.5. Antiosteoclast activity of PEC in ovariectomized mice
Finally, we used an animal model to further investigate the anti‐osteoclast activity of PEC in vivo. The ovariectomized mice were generated and treated with PEC for 6 weeks, and the 3D reconstruction images of the proximal tibia in PEC‐treated group revealed that PEC markedly prevents OVX‐induced osteolysis. In contrast, the samples isolated from OVX group and sham‐operation group exhibited loss of bone trabecular (Figure 5a). The change of bone histomorphometric parameters also demonstrated that PEC inhibited OVX‐induced bone loss. Notably, the bone surface area/total volume (BS/TV), the trabecular bone volume percentage (BV/TV), as well as the trabecular number (Tb. N) were increased in PEC‐treated group sample (Figure 5b–d). And the conclusion that PEC could prevent OVX‐induced osteoclastogenesis in vivo was also confirmed in histopathology assay. Consistent with the above results, our data showed that TRAcP‐positive cells were obviously reduced in PEC‐treated group (Figure 5e–g) compared with the OVX group and sham‐operation group. In brief, our findings indicated that PEC has an inhibitory effect against the overactivation of osteoclasts in ovariectomized mice.
Figure 5.

PEC prevented bone loss in OVX mice. (a) Representative micro‐CT images of the longitudinal section of the tibias and reconstructed trabecular structure of the ROI. (b–d) Quantitative micro‐CT analysis of trabecular bone volume fraction (BV/TV), bone surface area/total volume (BS/TV) and trabecular number (Tb. N) of each group. (e) Representative images of tibias stained with TRAcP from each group. Black arrows indicated TRAcP‐positive cells. (f‐g) Quantification of TRAcP‐positive cell number and TRAcP‐positive cell no/BS. (n = 3). Data were presented as mean ± SD. Scale bars, 200 μM in ×40 and 100 μM in ×100 magnification. *p < 0.05, **p < 0.01, and ***p < 0.001, relative to the vehicle. CT: computed tomography; OVX: ovariectomized; PEC: pectolinarigenin; ROI: region of interest; TRAcP: tartrate‐resistant acid phosphatase [Color figure can be viewed at wileyonlinelibrary.com]
4. DISCUSSION
Bone metabolism is a dynamic process, and with the changes of mechanical stress, hormones, and cytokines, dynamic reconstruction is maintained by bone formation and bone destruction. By this way, the bone tissue has normal shape and functions (Amirhosseini et al., 2018). Osteoporosis (OP) is a metabolic disorder associated with systemic bone degeneration (Bar‐Shavit, 2010). The exorbitant bone resorption was caused by overactivation of osteoclasts, and increased osteoclastogenesis and function is one of the key causes of OP (Zhou et al., 2016). In the treatment of osteoporosis, inhibition of osteoclast formation is still remaining as the potential target. Current treatments are clinically challenged with side‐effects, including osteonecrosis with bisphosphonate and increased risk of breast cancer (Perazella & Markowitz, 2008; Rachner, Khosla, & Hofbauer, 2011). Of note, a large number of studies have shown that isoflavones have significant anti‐OP effects (Vitale, Piazza, Melilli, Drago, & Salomone, 2013; T. Wang et al., 2017), such as flavonoids isolated from soybeans are phytoestrogen‐like compounds that were previously used as estrogen receptor modulators (Juma et al., 2012). Pectolinarigenin, a flavonoid, has inhibitory activities on melanogenesis (S. Lee et al., 2017). In this study, we demonstrated the anti‐osteoclast activity of PEC in vitro and prevented bone loss in ovariectomized mice. Based on the structure of PEC (Figure 1a), it is possible to further develop different ramifications to treat osteoporosis.
As for the molecular mechanisms of RANKL‐induced osteoclastogenesis, multiple pathways, such as NF‐κB, AKT, and MAPK, were all significant (Dejardin, 2006). TRAF6 is a necessary upstream effector in RANKL‐signaling pathway and is recruited by primers formed by the binding of RANK and RANKL, leading to subsequent phosphorylation of the IκB kinase (IKK). Following activation of IKK, IκB‐α was degraded and NF‐κB dimers, such as NF‐κB p65, were released and then translocated to the nucleus, modulating osteoclastogenesis gene transcription (Soysa & Alles, 2009). In our study, PEC had little effect on RANKL‐induced NF‐κB‐signaling pathway, as it failed to inhibit the degradation of IκB‐α and the phosphorylation of p65.
MAPK‐signaling cascade was also important for the regulation of osteoclast formation, including ERK, JNK, and p38 pathways (Hagemann & Blank, 2001). In this pathway, phosphorylation of JNK induces the activation of AP‐1 to target the AP‐1 regions of DNA and initiates the transcription of osteoclast marker genes such as MMPs and TRAcP, thus stimulating the differentiation of osteoclast (Vaira et al., 2008). Significantly, the p38 pathway is also a vital pathway in osteoclast differentiation (Matsumoto, Sudo, Saito, Osada, & Tsujimoto, 2000). Inhibition of the p38‐signaling pathway attenuates osteoclast differentiation and local bone resorption (Choi, Son, Yun, & Kim, 2012). We found that PEC markedly depressed the MAPK‐signaling cascade, specifically on the phosphorylation of JNK and p38, whereas it had no significant effect of ERK‐signaling pathway.
NFATc1 and c‐Fos activated by MAPK are important downstream regulators of osteoclast formation (Nishikawa et al., 2010). As described above, AP‐1 is activated by phosphorylation of JNK, whereas c‐Fos is a crucial component of AP‐1. Mutagenesis of c‐Fos prevented osteoclast formation and leads to osteopetrosis (Grigoriadis et al., 1994). In addition, NFATc1 serves as a primary regulator of gene expression of terminal RANKL‐induced osteoclastogenesis. Previous studies found that NFATc1‐deficient embryonic stem cells failed to form mature osteoclast (Takayanagi, 2007bb), and mice lacing NFATc1 developed osteopetrosis (Takayanagi et al., 2002). In the current study, we demonstrated that PEC inhibited the protein levels of NFATc1 and c‐Fos. Notably, NFATc1 plays a key role in the regulation of the osteoclast markers gene expressions such as Ctsk, Atp6v0d2, MMP9, and Acp5 (Feng et al., 2009; Kim, Lee, Kim, Choi, & Kim, 2008; Matsuo et al., 2004). Consistent with the RANKL‐induced activation of NFATc1 was depressed, the expression of these NFATc1‐targeted genes was also inhibited by treatment of PEC, resulting in obstruction of osteoclast formation. Furthermore, the F‐actin also plays an essential role in osteoclast function (Garbe et al., 2012; Teitelbaum, 2000). We found that PEC was effective on suppressing F‐actin ring formation and osteoclast bone resorption in a concentration‐dependent manner.
Currently, growing evidence has suggested that RANKL‐induced intracellular ROS levels are associated with osteoclast formation (Kim, Lee, Kim, Lee, & Kim, 2017; N. Lee et al., 2005; Yip et al., 2005). Osteoclast differentiation is promoted in the Nrf2‐deficient mice, as RANKL‐induced ROS was increased (Hyeon et al., 2013). After stimulation of hydrogen molecules, RANKL‐induced osteoclastogenesis was attenuated via downregulation of intracellular ROS generation (Li, Zhang, Dong, Li, & Ma, 2014). Besides, ormeloxifene inhibited osteoclast formation by repressing the production of RANKL‐induced ROS (Kharkwal, Chandra, Fatima, & Dwivedi, 2012). Thus, we investigated the effect of PEC on intracellular ROS and found that the accumulations of ROS were dramatically decreased by PEC treatment in a dose‐dependent manner.
PEC had antiosteoclast activity in vitro, following which, we examined the effects of PEC in vivo. Our data suggested that PEC protected against bone loss in OVX mice. As consequences of animal experiment, the reduction of TRAcP‐positive osteoclast cell number and the improved quantity of bone trabecula, suggesting that PEC protected against bone loss in OVX mice. Collectively, although the PEC interrupted the osteoclastogenesis by inhibiting the activation of MAPK‐signaling cascade and NFATc1 in vitro, the effects of PEC on osteoclast formation and function is yet to be determined, which is necessary for future studies. Our study indicated that PEC could act as a potent restrainer of RANKL‐induced osteoclastogenesis against diseases caused by overactivation of osteoclast such as osteoporosis.
ACKNOWLEDGMENTS
This study was supported in part by National Natural Science Foundation of China (81501910), the Natural Science Foundation of Guangxi Province (2015GXNSFCA414001, 2015GXNSFDA139019, and 2017GXNSFBA198061), the Guangxi Collaborative Innovation Center for Biomedicine Talent Cultivation (GCICB‐TC‐2017001). This study was also supported in part by grants from the Australian Health and Medical Research Council (NHMRC; APP1107828, APP1027932, and APP1163933).
Contributor Information
Qian Liu, Email: luoboqian@hotmail.com.
Jiake Xu, Email: jiake.xu@uwa.edu.au.
References
REFERENCES
- AbuAmer, Y. , Darwech, I. , & Clohisy, J. C. (2007). Aseptic loosening of total joint replacements: Mechanisms underlying osteolysis and potential therapies. Arthritis Research & Therapy, 9(S1), 1–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Amirhosseini, M. , Madsen, R. V. , Escott, K. J. , Bostrom, M. P. , Ross, F. P. , & Fahlgren, A. (2018). GSK‐3β inhibition suppresses instability‐induced osteolysis by a dual action on osteoblast and osteoclast differentiation. Journal of Cellular Physiology, 233(3), 2398–2408. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Arai, F. , Miyamoto, T. , Ohneda, O. , Inada, T. , Sudo, T. , Brasel, K. , … Suda, T. (1999). Commitment and differentiation of osteoclast precursor cells by the sequential expression of c‐Fms and receptor activator of nuclear factor κB (RANK) receptors. Journal of Experimental Medicine, 190(12), 1741–1754. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bar‐Shavit, Z. (2010). The osteoclast: A multinucleated, hematopoietic‐origin, bone‐resorbing osteoimmune cell. Journal of Cellular Biochemistry, 102(5), 1130–1139. [DOI] [PubMed] [Google Scholar]
- Carmody, R. J. , & Cotter, T. G. (2001). Signalling apoptosis: A radical approach. Redox Report, 6(2), 77–90. [DOI] [PubMed] [Google Scholar]
- Choi, S. W. , Son, Y. J. , Yun, J. M. , & Kim, S. H. (2012). Fisetin inhibits osteoclast differentiation via downregulation of p38 and c‐Fos‐NFATc1 signaling pathways. Evidence‐Based Complementary and Alternative Medicine, 2012(6), 810563. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dejardin, E. (2006). The alternative NF‐κB pathway from biochemistry to biology: Pitfalls and promises for future drug development. Biochemical Pharmacology, 72(9), 1161–1179. [DOI] [PubMed] [Google Scholar]
- Feng, H. , Cheng, T. , Steer, J. H. , Joyce, D. A. , Pavlos, N. J. , Leong, C. , … Xu, J. (2009). Myocyte enhancer factor 2 and microphthalmia‐associated transcription factor cooperate with NFATc1 to transactivate the V‐ATPase d2 promoter during RANKL‐induced osteoclastogenesis. Journal of Biological Chemistry, 284(21), 14667–14676. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Garbe, A. I. , Roscher, A. , Schüler, C. , Lutter, A. H. , Glösmann, M. , Bernhardt, R. , … Jessberger, R. (2012). Regulation of bone mass and osteoclast function depend on the F‐actin modulator SWAP‐70. Journal of Bone & Mineral Research, 27(10), 2085–2096. [DOI] [PubMed] [Google Scholar]
- Grigoriadis, A. , Wang, Z. , Cecchini, M. , Hofstetter, W. , Felix, R. , Fleisch, H. , & Wagner, E. (1994). c‐Fos: A key regulator of osteoclast‐macrophage lineage determination and bone remodeling. Science, 266(5184), 443–448. [DOI] [PubMed] [Google Scholar]
- Hagemann, C. , & Blank, J. L. (2001). The ups and downs of MEK kinase interactions. Cellular Signalling, 13(12), 863–875. [DOI] [PubMed] [Google Scholar]
- He, Y. Q. , Yang, H. , Shen, Y. , Zhang, J. H. , Zhang, Z. G. , Liu, L. L. , … Zhang, Q. Y. (2018). Monotropein attenuates ovariectomy and LPS‐induced bone loss in mice and decreases inflammatory impairment on osteoblast through blocking activation of NF‐κB pathway. Chemico‐Biological Interactions, 291, 128–136. [DOI] [PubMed] [Google Scholar]
- Hyeon, S. , Lee, H. , Yang, Y. , & Jeong, W. (2013). Nrf2 deficiency induces oxidative stress and promotes RANKL‐induced osteoclast differentiation. Free Radical Biology & Medicine, 65(6), 789–799. [DOI] [PubMed] [Google Scholar]
- Juma, S. S. , Ezzat‐Zadeh, Z. , Khalil, D. A. , Hooshmand, S. , Akhter, M. , & Arjmandi, B. H. (2012). Soy protein with or without isoflavones failed to preserve bone density in gonadal hormone‐deficient male rat model of osteoporosis. Nutrition Research, 32(9), 694–700. [DOI] [PubMed] [Google Scholar]
- Kharkwal, G. , Chandra, V. , Fatima, I. , & Dwivedi, A. (2012). Ormeloxifene inhibits osteoclast differentiation in parallel to downregulating RANKL‐induced ROS generation and suppressing the activation of ERK and JNK in murine RAW264.7 cells. Journal of Molecular Endocrinology, 48(3), 261–270. [DOI] [PubMed] [Google Scholar]
- Kikuta, J. , & Ishii, M. (2013). Osteoclast migration, differentiation and function: Novel therapeutic targets for rheumatic diseases. Rheumatology, 52(2), 226–234. [DOI] [PubMed] [Google Scholar]
- Kim, H. , Lee, Y. D. , Kim, H. J. , Lee, Z. H. , & Kim, H. H. (2017). SOD2 and Sirt3 control osteoclastogenesis by regulating mitochondrial ROS. Journal of Bone and Mineral Research, 32(2), 397–406. [DOI] [PubMed] [Google Scholar]
- Kim, K. , Lee, S. H. , Ha kim, J. , Choi, Y. , & Kim, N. (2008). NFATc1 induces osteoclast fusion via up‐regulation of Atp6v0d2 and the dendritic cell‐specific transmembrane protein (DC‐STAMP). Molecular Endocrinology, 22(1), 176–185. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lee, N. , Choi, Y. , Baik, J. , Han, S. , Jeong, D. , Bae, Y. , … Lee, S. (2005). A crucial role for reactive oxygen species in RANKL‐induced osteoclast differentiation. Blood, 106(3), 852–859. [DOI] [PubMed] [Google Scholar]
- Lee, S. , Lee, D. H. , Kim, J. C. , Um, B. H. , Sung, S. H. , Jeong, L. S. , … Kim, S. N. (2017). Pectolinarigenin, an aglycone of pectolinarin, has more potent inhibitory activities on melanogenesis than pectolinarin. Biochemical and Biophysical Research Communications, 493(1), 765–772. [DOI] [PubMed] [Google Scholar]
- Lewis, D. B. , Liggitt, H. D. , Effmann, E. L. , Motley, S. T. , Teitelbaum, S. L. , Jepsen, K. J. , … Perlmutter, R. M. (1993). Osteoporosis induced in mice by overproduction of interleukin 4. Proceedings of the National Academy of Sciences of the United States of America, 90(24), 11618–11622. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li, D. Z. , Zhang, Q. X. , Dong, X. X. , Li, H. D. , & Ma, X. (2014). Treatment with hydrogen molecules prevents RANKL‐induced osteoclast differentiation associated with inhibition of ROS formation and inactivation of MAPK, AKT and NF‐κB pathways in murine RAW264.7 cells. Journal of Bone & Mineral Metabolism, 32(5), 494–504. [DOI] [PubMed] [Google Scholar]
- Matsumoto, M. , Sudo, T. , Saito, T. , Osada, H. , & Tsujimoto, M. (2000). Involvement of p38 mitogen‐activated protein kinase signaling pathway in osteoclastogenesis mediated by receptor activator of NF‐κB ligand (RANKL). Journal of Biological Chemistry, 275(40), 31155–31161. [DOI] [PubMed] [Google Scholar]
- Matsuo, K. , Galson, D. L. , Zhao, C. , Peng, L. , Laplace, C. , Wang, K. Z. Q. , … Wagner, E. F. (2004). Nuclear factor of activated T‐cells (NFAT) rescues osteoclastogenesis in precursors lacking c‐Fos. Journal of Biological Chemistry, 279(25), 26475–26480. [DOI] [PubMed] [Google Scholar]
- Nishikawa, K. , Nakashima, T. , Hayashi, M. , Fukunaga, T. , Kato, S. , Kodama, T. , … Takayanagi, H. (2010). Blimp1‐mediated repression of negative regulators is required for osteoclast differentiation. Proceedings of the National Academy of Sciences of the United States of America, 107(7), 3117–3122. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Novack, D. V. (2011). Role of NF‐κB in the skeleton. Cell Research, 21(1), 169–182. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Perazella, M. A. , & Markowitz, G. S. (2008). Bisphosphonate nephrotoxicity. Kidney International, 74(11), 1385–1393. [DOI] [PubMed] [Google Scholar]
- Rachner, T. D. , Khosla, S. , & Hofbauer, L. C. (2011). Osteoporosis: Now and the future. Lancet, 377(9773), 1276–1287. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Seeman, E. (2009). Bone modeling and remodeling. Critical Reviews in Eukaryotic Gene Expression, 19(3), 219–233. [DOI] [PubMed] [Google Scholar]
- Soysa, N. S. , & Alles, N. (2009). NF‐κB functions in osteoclasts. Biochemical & Biophysical Research Communications, 378(1), 1–5. [DOI] [PubMed] [Google Scholar]
- Takayanagi, H. (2007a). Osteoclast differentiation and activation. Clinical Calcium, 17(4), 484–492. [PubMed] [Google Scholar]
- Takayanagi, H. (2007b). Osteoimmunology: Shared mechanisms and crosstalk between the immune and bone systems. Nature Reviews Immunology, 7(4), 292–304. [DOI] [PubMed] [Google Scholar]
- Takayanagi, H. , Kim, S. , Koga, T. , Nishina, H. , Isshiki, M. , Yoshida, H. , … Taniguchi, T. (2002). Induction and activation of the transcription factor NFATc1 (NFAT2) integrate RANKL signaling in terminal differentiation of osteoclasts. Developmental Cell, 3(6), 889–901. [DOI] [PubMed] [Google Scholar]
- Teitelbaum, S. L. (2000). Bone resorption by osteoclasts. Science, 289(5484), 1504–1508. [DOI] [PubMed] [Google Scholar]
- Vaira, S. , Alhawagri, M. , Anwisye, I. , Kitaura, H. , Faccio, R. , & Novack, D. V. (2008). RelA/p65 promotes osteoclast differentiation by blocking a RANKL‐induced apoptotic JNK pathway in mice. Journal of Clinical Investigation, 118(6), 2088. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Vitale, D. C. , Piazza, C. , Melilli, B. , Drago, F. , & Salomone, S. (2013). Isoflavones: Estrogenic activity, biological effect and bioavailability. European Journal of Drug Metabolism and Pharmokinetics, 38(1), 15–25. [DOI] [PubMed] [Google Scholar]
- Wang, C. , Cheng, Y. , Liu, H. , Xu, Y. , Peng, H. , Lang, J. , … Fan, J. (2016). Pectolinarigenin suppresses the tumor growth in nasopharyngeal carcinoma. Cellular Physiology and Biochemistry, 39(5), 1795–1803. [DOI] [PubMed] [Google Scholar]
- Wang, T. , Liu, Q. , Tjhioe, W. , Zhao, J. , Lu, A. , Zhang, G. , … Feng, H. T. (2017). Therapeutic potential and outlook of alternative medicine for osteoporosis. Current Drug Targets, 18(9), 1051–1068. [DOI] [PubMed] [Google Scholar]
- Xu, J. , Tan, J. W. , Huang, L. , Gao, X. H. , Laird, R. , Liu, D. , … Zheng, M. H. (2000). Cloning, sequencing, and functional characterization of the rat homologue of receptor activator of NF‐κB ligand. Journal of Bone and Mineral Research, 15(11), 2178–2186. [DOI] [PubMed] [Google Scholar]
- Yip, K. H. , Zheng, M. H. , Steer, J. H. , Giardina, T. M. , Han, R. , Lo, S. Z. , … Xu, J. (2005). Thapsigargin modulates osteoclastogenesis through the regulation of RANKL‐induced signaling pathways and reactive oxygen species production. Journal of Bone and Mineral Research, 20(8), 1462–1471. [DOI] [PubMed] [Google Scholar]
- Zhang, T. , Li, S. , Li, J. , Yin, F. , Hua, Y. , Wang, Z. , … Cai, Z. (2016). Natural product pectolinarigenin inhibits osteosarcoma growth and metastasis via SHP‐1‐mediated STAT3 signaling inhibition. Cell Death & Disease, 7(10), e2421. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- Zhou, L. , Liu, Q. , Yang, M. , Wang, T. , Yao, J. , Cheng, J. , … Xu, J. (2016). Dihydroartemisinin, an anti‐malaria drug, suppresses estrogen deficiency‐induced osteoporosis, osteoclast formation, and RANKL‐induced signaling pathways. Journal of Bone & Mineral Research, 31(5), 964–974. [DOI] [PubMed] [Google Scholar]
