Paeonol reverses promoting effect of the HOTAIR/miR‐124/Notch1 axis on renal interstitial fibrosis in a rat model

Abstract

Renal interstitial fibrosis (RIF) is a common manifestation of inflammatory and noninflammatory renal diseases, which correlates to renal excretory dysfunction. Recently, the long noncoding RNAs (lncRNAs) have been demonstrated to be involved in the development of various renal diseases. Here, we aim to determine whether paeonol (PAE) affects RIF with involvement of the lncRNA HOX transcript antisense intergenic RNA (HOTAIR)/microRNA‐124 (miR‐124)/Notch1 axis. RIF rat models were established by performing unilateral ureteral occlusion (UUO), in which interactions between HOTAIR, Notch1, and miR‐124 were determined. To identify the roles of PAE and HOTAIR in RIF, rats were injected with HOTAIR or PAE. Subsequently, to further investigate the underlying mechanism of PAE in RIF, epithelial to mesenchymal transition (EMT)‐ and migration‐related genes in NRK‐49F cells were measured. Next, rats were further treated with IMR‐1 (inhibitor of the Notch1/Jagged1 signaling pathway) to determine how PAE influences the Notch1/Jagged1 signaling pathway. HOTAIR interacted with miR‐124, and miR‐124 directly targeted Notch1, and HOTAIR was observed to be upregulated in RIF rats. PAE was found to decrease HOTAIR and Notch1 expression but to increase the miR‐124 expression in RIF rats. PAE inhibited EMT and migration of NRK‐49F cells facilitated by HOTAIR. HOTAIR activated the Notch1/Jagged1 signaling pathway by downregulating miR‐124, while PAE reversed these effects of HOTAIR on the Notch1/Jagged1 signaling pathway. Overall, our study demonstrates the contributory effect of lncRNA HOTAIR on RIF by activating the Notch1/Jagged1 signaling pathway via inhibition of miR‐124, whereas administration of PAE can alleviate the effects of HOTAIR on RIF.

Our study demonstrates the contributory effect of long noncoding RNA HOTAIR on RIF by activating the Notch1/Jagged1 signaling pathway via inhibition of miR‐124, whereas administration of PAE can alleviate the effects of HOTAIR on renal interstitial fibrosis.

1. INTRODUCTION

Renal interstitial fibrosis (RIF) is a common pathological process initiated by the early onset of renal inflammation of chronic kidney illness, and can inevitably result in renal function deterioration (G. H. Zheng, Wang, et al., 2018). RIF is characterized by the activation of myofibroblasts along with accumulation of matrix proteins like collagen types I (Col I) and type III (Col III; H. Xiao et al., 2013). RIF often occurs as a subsequent consequence of chronic kidney disease (CKD) and is also considered as a precursor and a common channel leading to progression of end‐stage renal failure (Tang, Jiang, Zhou, Xia, & Dai, 2015). RIF may appear at diverse stages of intrinsic renal cell apoptosis, causing severe complications such as tubular atrophy and chronic renal functional insufficiency, which are indicated in the later stages (Ruan et al., 2013). Due to the complexity of the underlying pathology of RIF including extracellular and intercellular mechanisms, a majority of cells and cytokines are implicated (J. Xia, He, & Su, 2016). Recent evidence has supported the hypothesis that upregulated long noncoding RNAs (lncRNAs) in RIF and inhibition of LINC00963 could suppress RIF (W. Chen et al., 2018). Therefore, analysis of lncRNAs may serve to broaden our understanding about the complex molecular mechanisms of lncRNAs in RIF, providing impetus for identifying new therapeutic targets.

LncRNA HOX transcript antisense intergenic RNA (lncRNA HOTAIR), a 2,158 bp lncRNA situated at a boundary in the HOXC gene cluster, is speculated to be correlated with various types of malignancies such as liver cancer, breast cancer, and colon cancer (Kim et al., 2013). Moreover, a current study even suggested that the inhibition of lncRNA HOTAIR is probable to have a suppressive effect on the renal cell carcinoma (RCC) cell growth and metastasis as well as the proliferation and invasion (Y. Wu et al., 2014). Furthermore, a bioinformatics website (https://cm.jefferson.edu/rna22/Interactive/) predicted an interaction of lncRNA HOTAIR with microRNA‐124 (miR‐124). Existing studies have revealed an association between miRs and progression of kidney diseases like RIF (Fang et al., 2013). It has been elucidated that miR‐124 has a decisive and regulatory role in the epithelial phenotype and epithelial to mesenchymal transition (EMT) of breast cancer cells (Liang et al., 2013). In addition, a study revealed that miR‐124 was downregulated in RCC (Long, Du, Liu, Li, & He, 2015). Also, another study demonstrated that miR‐124 overexpression alleviated renal injury of septic rats (Li, Zhang, Xu, Li, & Li, 2018). Recently, miR‐124 has been confirmed to function as a negative regulator of the Notch1 signaling pathway via JAG1 (Jiang et al., 2016). In addition, an existing study observed the involvement of the Notch signaling pathway in fibrosis development, and blockade of the Notch signaling pathway may serve as a therapeutic strategy to decrease fibrosis and decelerate the development of end‐stage renal disease (Bielesz et al., 2010). Paeonol (PAE, 2′‐hydroxy‐4′‐methoxyacetophenone) is the main component of Moutan Cortex, possessing extensive pharmacological activities such as antioxidation, anti‐inflammation, antiapoptosis, and antiaggregation (Gong et al., 2017). A recent research demonstrated the functioning of the protective abilities of PAE in kidney injury induced by endotoxin (Fan et al., 2016). Based on the aforementioned literature, we hypothesized that lncRNA HOTAIR may facilitate RIF through regulation of miR‐124 and the Notch1 signaling pathway, whereas PAE is capable to alleviate this change. Therefore, the present study aims to explore the role of PAE in RIF with involvement of the HOTAIR/miR‐124/Notch1 axis.

2. MATERIALS AND METHODS

2.1. Ethics statement

The study was conducted in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was performed with the approval of the Institutional Animal Care and Use Committee of Fuzhou General Hospital.

2.2. Study subjects

Fifty specific‐pathogen‐free (SPF) male and healthy Sprague–Dawley (SD) rats (aged 6 weeks; weighing 180–200 g) provided by Shanghai SLAC Laboratory Animal Co., Ltd. (Shanghai, China) were selected for this experiment. All rats were housed under conditions of temperature at 25°C, relative humidity (60%), and 12‐hr light periods daily with free access to standard feed and water.

2.3. Cell culture

Normal rat kidney interstitial fibroblast (NRK‐49F) cells were purchased from American Type Culture Collection (ATCC, Manassas, VA). After resuscitation, the cells were cultured in Dulbecco's modified Eagle medium (DMEM; GIBCO BRL, Grand Island, NY) containing 10% fetal bovine serum (FBS; Gibco BRL) and 100 U/ml mycillin in a 5% CO₂ incubator (Thermo Fisher Scientific, Waltham, MA) at 37°C. When the cell confluence reached 70–80%, the cells were detached with 0.25% trypsin, and then subcultured at a proportion of 1:3. Trans‐differentiation of NRK‐49F cells was induced by 10 μg/L of transforming growth factor β1 (TGF‐β1; Sigma‐Aldrich, St. Louis, MO).

2.4. Establishment of RIF rat model

Fifty SD rats were randomly grouped into the sham, RIF, HOTAIR, HOTAIR + PAE, and RIF + PAE groups. RIF rat model was established using the unilateral ureteral occlusion (UUO): the left renal ureter of the rats was ligated. Rats in the sham group were treated with normal saline gavage every day. The rats in the RIF group were injected 100 μl of lentivirus vector (LV)‐negative control (NC) via the tail vein and treated with normal saline gavage simultaneously. RIF rats in the HOTAIR group were injected with 100 μl of LV‐HOTAIR via the tail vein whereas the RIF rats in the HOTAIR + PAE group were injected with 100 μl of LV‐HOTAIR via the tail vein and treated with 50 mg/kg PAE gavage every day. RIF rats in the RIF + PAE group were treated with PAE (50 mg/kg). After 7 days, the rats were euthanized for collection of the left renal tissue. Parts of the tissues were stored at −80°C, and the remaining tissues were embedded into paraffin for the following experiments.

2.5. Hematoxylin‐eosin (HE) staining

The sections were dewaxed with xylene, and dehydrated with different concentrations of gradient ethanol of 100% I, 100% II, 95%, 85% and 75%, for 3 min in each concentration. The sections were stained with hematoxylin for 5 min, washed under running water for 1 min to scour the floating color, and immersed in 1% hydrochloric acid ethanol for 30 s. After a 1‐min wash under running water, the sections were stained with 0.5% eosin for 3 min, washed under running water for 1 min, and hydrated with different concentrations of gradient ethanol of 75%, 85%, 95%, 100% II, and 100% I (3 min for each concentration). The sections were cleared with xylene, and mounted with neutral balsam.

2.6. Masson trichrome staining

After being dewaxed in xylene, the sections were dehydrated in gradient ethanol of 100% I, 100% II, 95%, 85%, and 75% (3 min for each concentration), stained with Masson solution for 5 min, washed under running water for 2 min, and treated with 0.2% acid ethanol I for 1 min and 0.2% acid ethanol II for 2 min. After a wash under running water, the sections were immersed in 1% phosphotungstic acid for 5 min, then washed again under running water and stained with bright green staining solution for 15 min. Subsequently, the sections were treated with 0.2% acid ethanol I for 1 min and 0.2% acid ethanol II for 2 min, washed under running water, hydrated with gradient ethanol of 75%, 85%, 95%, 100% II and 100% I (3 min for each concentration). The sections were cleared with xylene, and mounted with neutral balsam. After the staining, the collagen was green and the cells were red. In addition, evaluation standards of RIF (B. Zhou et al., 2017) are shown in Table 1.

Table 1.

Evaluation standards of RIF

Grades	Standards	Scores
0	Interstitial fibrosis less than 0%–5% in the cortex	0
I	Interstitial fibrosis accounting for 5%–25% in the cortex	1
II	Interstitial fibrosis accounting for 25%–50% in the cortex	2
III	Interstitial fibrosis more than 50%–75% in the cortex	3
IV	Interstitial fibrosis more than 75%–100% in the cortex	4

Note. RIF: renal interstitial fibrosis.

2.7. Immunohistochemistry

After being dewaxed in xylene, the sections were dehydrated in different concentrations of gradient ethanol of 100% I, 100% II, 95%, 85%, and 75% (3 min for each concentration), and washed three times with phosphate‐buffered saline (PBS). Then the sections were added with antigen repair solution and incubated in a 97°C electric incubator for 5 min, washed with PBS, immersed in 3% hydrogen peroxide (H₂O₂) deionized water for 20 min, and then finally washed with PBS. Subsequently, the sections were blocked with goat serum for 15 min, and added with rabbit anti‐rat antibody to Notch1 (1:200; ab52301; Abcam Inc., Cambridge, MA) overnight at 4°C. After being rinsed by PBS, the sections were added with goat antirabbit immunoglobulin G (IgG; 1:5000; ab6721; Abcam Inc.) and incubated at room temperature for 30 min. Next, the sections were rinsed with PBS, added with horse radish peroxidase (HRP)‐labeled streptavidin, and incubated at room temperature for 30 min. The sections were rinsed with PBS, stained with diaminobenzidine (DAB) chromogen, and observed under a microscope. Lastly, after a wash under running water, the nucleus was counterstained with hematoxylin, and the sections were washed under running water. The sections were hydrated with different concentrations of gradient ethanol of 75%, 85%, 95%, 100% II, 100% I (3 min for each concentration), cleared with xylene, and mounted with neutral balsam.

2.8. Construction of lentivirus vector

The sequence of HOTAIR (Sigma‐Aldrich) was derived from the National Center for Biotechnology Information (NCBI) database (https://www.ncbi.nlm.nih.gov/). HOTAIR was provided by Sigma‐Aldrich. The target sequences were separately connected to the PLKO.1‐Puro vector (Sigma‐Aldrich). After sequencing, the plasmids were, respectively, cotransfected with psPAX2 and pMD2.G (Addgene, Cambridge, MA) into 293T cells. After 48 hr, the fluorescence activated cell sorting (FACS) was used to determine the titer of the lentivirus (3 × 10⁸ PFU/ml). NRK‐49F cells were infected with lentivirus (multiplicity of infection [MOI] = 30) to obtain NRK‐49F‐HOTAIR stable strains.

2.9. Cell transfection

To identify the roles of PAE in HOTAIR promoted EMT of NRK‐49F cells and migration of NRK‐49F cells, the NRK‐49F cells were assigned into the NC, PAE, HOTAIR, and HOTAIR + PAE groups. The NRK‐49F cells and the NRK‐49F‐HOTAIR cells in the logarithmic growth phase were seeded in a 12‐well plate at a density of 10⁶ cells/ml, and incubated in DMEM/F12 complete medium. PAE (100 μM) used in the above procedure was provided by Sigma‐Aldrich.

Subsequently, to further determine the mechanism for how PAE affects the HOTAIR‐activated Notch1/Jagged1 pathway, the NRK‐49F cells were assigned into the NC, HOTAIR, HOTAIR + PAE, and HOTAIR + IMR‐1 groups. The NRK‐49F cells and the NRK‐49F‐HOTAIR cells in the logarithmic growth phase were seeded in a 12‐well plate at a density of 10⁶ cells/ml. PAE (100 μM) used in the above procedure was provided by Sigma‐Aldrich, and IMR‐1 (6 μM; MCM, New Haven, CT) was an inhibitor of the Notch1/Jagged1 signaling pathway.

2.10. Dual‐Luciferase reporter gene assay

The biological prediction website (https://cm.jefferson.edu/rna22/Interactive/) predicted the existence of a binding site between miR‐124 and the Notch1 3′‐untranslated region (UTR). Notch1–3′‐UTR^W and Notch1–3′‐UTR^M (Shanghai Genechem Co., Ltd., Shanghai, China) were connected to the psiCHECK2 vector (Promega, Madison, WI). The Notch1–3′‐UTR^W and Notch1–3′‐UTR^M were separately cotransfected with the miR‐124 mimic into NRK‐49F cells. Luciferase activity was measured according to the instructions of the Luciferase Assay Kit (Promega). The fluorescence was detected using a Glomax 20/20 Luminometer (Promega).

The biological prediction website (https://cm.jefferson.edu/rna22/Interactive/) predicted an interaction of miR‐124 with HOTAIR. miR‐124 (Shanghai Genechem Co., Ltd.) containing HOTAIR binding site was connected to the psiCHECK2 vector (Promega). The vector was transferred into the NRK‐49F and NRK‐49F‐HOTAIR cells. Luciferase activity was measured according to the instructions of the Luciferase Assay Kit (Promega). The fluorescence was detected using a Glomax 20/20 Luminometer (Promega).

2.11. In situ hybridization (ISH)

ISH technique was used to identify the subcellular localization of HOTAIR in NRK‐49F cells. The experiment was conducted in accordance to the instructions of the Fluorescence In Situ Hybridization (FISH) Kit (Boster, Wuhan, Hubei, China). After NRK‐49F cells adhered onto the slides, the glass slides were rinsed under PBS, and fixed in 4% polyoxymethylene containing 0.1% diethyl phosphorocyanidate (DEPC) at room temperature for 30 min. After a rinse with PBS, the slides were treated with pepsin for 30 s, rinsed by PBS, and fixed in 1% polyoxymethylene containing 0.1% DEPC at room temperature for 10 min. Next, each slide was rinsed by PBS, added with 50 μl of prehybridization solution, and incubated at 42°C for 1 hr in a wet box. Subsequently, after removal of the prehybridization solution, 50 μl of prehybridization solution containing 300 mg/ml probes was added onto each slide, and incubated in a wet box overnight at 42°C. Then, the slides were washed with standard saline citrate (SSC) solution, added with blocking buffer, and incubated at 37°C for 30 min. The slides were then incubated with biotinylated mouse‐anti digoxin (Boster) at 37°C for 1 hr. After a rinse with PBS, the slides were incubated with 50 μl of Strept‐Avidin‐Biotin‐Peroxidase Complex (SABC)‐Fluorescein Isothiocyanate (FITC) at 37°C for 30 min, and rinsed by PBS. Lastly, the nucleus was stained with 4′,6‐diamidino‐2‐phenylindole (DAPI), and the slides were sealed with glycerol sealing liquid. Five fields were chosen for observation and photography under a confocal fluorescence microscope (Olympus, Tokyo, Japan).

2.12. RNA extraction

NRK‐49F cells were treated with trypsin, added with 500 μl of precooled cell fractionation buffer, and gently shaken. After cell lysis on ice for 10 min and centrifugation at 4°C at 500g for 5 min, the supernatant (cytoplasm) was added into a Ribonuclease‐free eppendorf (EP) tube. The precipitation (nucleus) was washed with 500 μl of precooled cell fractionation buffer, and added with the same volume of cell disruption buffer to lyse nucleus. The above nucleus and cytoplasmic lysate were, respectively, added with the same volume of 2 × Lysis/Binding Solution and 100% ethanol, and mixed completely. Next, the mixture was added into spin columns, which were placed into collecting pipes. After centrifugation at 4°C at 10,000g for 1 min, the filtrate was discarded, and the samples were added with 700 μl of washing solution 1, and centrifuged at 4°C at 10,000g for 1 min. After removal of the filtrate, the samples were added with 700 μl of washing solution 2/3, and centrifuged at 4°C at 10,000g for 1 min. Subsequently, the Ribonuclease‐free EP tube was replaced, and 50 μl of elution solutions were added into the spin columns at 95°C. After centrifugation at 4°C at 10,000g for 1 min, the RNA solution was collected. The concentration of RNA was determined by a spectrophotometer.

2.13. RNA pull‐down assay

RNA pull‐down assay was conducted using the Magnetic RNA pull‐down kit (Pierce, Rockford, IL). A total of 1 μg of biotin‐labeled RNA was added in an EP tube, added with 500 μl of structure buffer, water‐bathed at 95°C for 2 min, and ice‐bathed for 3 min. The magnetic beads were suspended, and 50 μl of magnetic bead‐based suspensions were added into the EP tube and incubated overnight at 4°C. The suspension was centrifuged at 1,610g for 3 min with the supernatant discarded, washed three times with 500 μl of RNA‐binding protein immunoprecipitation (RIP) washing buffer, added with 10 μl of cell lysis buffer, and allowed to react at room temperature for 1 hr. Next, the magnetic beads‐RNA‐protein mixture was centrifuged at a low speed to collect the supernatant. The samples were washed three times with 500 μl of RIP washing buffer; 10 μl of cell lysis was used as protein input. The protein concentration was determined, and the protein level was determined by western blot analysis.

2.14. RIP

The RIP kit (Millipore, Billerica, MA) was used to detect the binding of HOTAIR and Argonaute 2 (AGO2) protein. NRK‐49F cells were treated with 0.25% trypsin, and centrifuged after which the precipitate was collected. The precipitation was added with radioimmunoprecipitation assay (RIPA) lysis buffer, ice‐bathed for 5 min, centrifuged at 4°C at 35,068g for 10 min and the supernatant was obtained. The cell extracts were equally divided into multiple proportions from which one proportion was taken as input and stored at −80°C. A volume of 50 μl of magnetic bead was washed with 500 μl of RIP wash buffer, added with 100 μl of RIP wash buffer and 5 μg of antibodies, incubated for 30 min, and washed again two times with 500 μl of RIP washing buffer. The magnetic beads were incubated with 900 μl of RIP wash buffer and 100 μl of cell extract overnight at 4°C, washed five times with 500 μl of RIP wash buffer, incubated with 150 μl of proteinase K buffer solution at 55°C for 30 min to completely eliminate the protein. Chloroform was used to extract the purified RNA. After determination of the RNA concentration, the RNA was used for subsequent experimentation. The samples were incubated at room temperature for 30 min with the rabbit anti‐rat antibody to AGO2 (1:100; ab3238; Abcam Inc.). The goat anti‐rabbit antibody to IgG (1:5,000; ab6721; Abcam Inc.) was used as NC.

2.15. Immunofluorescence

Upon adherence of the NRK‐49F cells on the slides, the cells were rinsed three times with PBS, fixed by 4% polyformic acid at room temperature for 15 min, and rinsed three times with PBS again. NRK‐49F cells were treated with 0.1% Triton X‐100 at room temperature for 20 min, rinsed three times with PBS, and blocked by 10% goat serum for 30 min after which the serum was discarded. Next, the NRK‐49F cells were incubated overnight at 4°C with primary antibodies, rabbit anti‐rat antibodies to E‐cadherin (1:5,000; ab181296; Abcam Inc.) and vimentin (1:100; ab45939; Abcam Inc.). Subsequently, secondary antibody, HRP‐labeled goat anti‐rabbit antibody to IgG (1:5,000; ab6721; Abcam Inc.) was added. NRK‐49F cells were stained with 5 μg/ml DAPI solution for 2 min and incubated at 37°C for 1 hr under conditions devoid of light. NRK‐49F cells were rinsed with PBS, mounted by antifluorescence quenching liquid and observed under a fluorescence microscope.

2.16. Western blot analysis

NRK‐49F cells were lysed by RIPA lysis buffer (Beyotime Institute of Biotechnology, Shanghai, China), and centrifuged at 35,068g at 4°C after which the supernatant was collected. The protein was extracted and stored at −80°C. The protein concentration was determined using the bicinchoninic acid (BCA; Pierce) assay. The 4% separation gel and 10% concentrated gel were prepared for electrophoresis. The protein on the gel was transferred onto a membrane, blocked with 5% bovine serum albumin (BSA) and incubated overnight with diluted primary antibodies, rabbit anti‐rat antibodies to activated Notch1 (1:5,000; ab52301), Jagged1 (1:5,000; ab7771), E‐cadherin (1:5,000; ab181296), α‐smooth muscle actin (α‐SMA; 1:5,000; ab108424), vimentin (1:100; ab45939), matrix metalloproteinase (MMP‐2; 1:5,000; ab37150), MMP‐9 (1:5,000; ab38898), and glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH; 1:5,000; ab9485). All of the aforementioned antibodies were purchased from Abcam Inc. After washing, the membranes were incubated with secondary antibody, HRP‐labeled goat antirabbit antibody to IgG (1:5,000; ab6721; Abcam Inc.) at room temperature for 2 hr. About 1 ml of enhanced chemiluminescence (ECL) working solution was prepared by the SuperSignal West Dura Extended Duration Substrate following the instructions for transfer into the membrane for incubation at room temperature for 1 min. Then the superfluous ECL working solution was eliminated, and the membrane was sealed with preservative films. Subsequently, the images were obtained and fixed after exposure for 5–10 min with X‐ray films in a dark room. The experiment was performed in triplicates.

2.17. Reverse‐transcription quantitative polymerase chain reaction (RT‐qPCR)

The rat peritoneal tissues were ground in liquid nitrogen, and total RNA was extracted using the TRIzol Kit (Invitrogen, Carlsbad, CA). The concentration of RNA was determined by a spectrophotometer. Subsequently, the RNA was reversely transcribed into complementary DNA (cDNA) using oligo‐dT (SO131; Thermo Fisher Scientific, New York, NY). RT‐qPCR reaction was performed according to the SYBR green method. The reaction system was 20 μl, including 1.0 μl of cDNA, 10 μl of 2 × SYBR Green Mix, 0.5 μl forward primers (10 μM), 0.5 μl reverse primers (10 μM), and 8.0 μl RNase‐free water. The reaction conditions were as follows: predenaturation at 95°C for 30 min, 40 cycles of denaturation at 95°C for 15 s, annealing at 60°C for 30 s and extension at 72°C for 20 s, and final extension at 72°C for 5 min. Primers (Table 2) were synthesized by the Beijing Genomics Institute (BGI, Beijing, China). The reliability of PCR results was evaluated by the dissolution curve, and the relative quantitative method was used for calculation. The $2^{-\mathrm{\Delta }\mathrm{\Delta }{C}_{\mathrm{t}}}$ method was used to calculate the relative messenger RNA (mRNA) levels of the target genes. Experiments were performed in triplicates to obtain the mean value.

Table 2.

Primer sequences for RT‐qPCR

Genes	Primer sequences
HOTAIR	F: 5′‐GTTAACATGACCAGCGATCTGA‐3′
	R: 5′‐AATTAATTAGTGCCTCCCAGTCC‐3′
miR‐124	F: 5′‐TCGTTAAGGCACGCGGTG‐3′
	R: 5′‐GTGCAGGGTCCGAGGT‐3′
Notch1	F: 5′‐ACGCTGCTGTTGTGCTCCT‐3′
	R: 5′‐GGCAATCGGTCCATGTGAT‐3′
U6	F: 5′‐CTCGCTTCGCAGCACA‐3′
	R: 5′‐AACGCTTCACGAATTTGCGT‐3′
GAPDH	F: 5′‐TGGTGAAGGTCGGTGTGAAC‐3′
	R: 5′‐GGTGGTGAAGACGCCAGTAG‐3′
Hes1	F: 5′‐TCAAAGCCTATCATGGAGAAGAG‐3′
	R: 5′‐GAATGCCGGGAGCTATCTTT‐3′
Hey1	F: 5′‐CTGCAGGAGGGAAAGGTTATT‐3′
	R: 5′‐CTCAGATAACGGGCAACTTCA‐3′

Note. F: forward; GAPDH: glyceraldehyde‐3‐phosphate dehydrogenase; HOTAIR: HOX transcript antisense intergenic RNA; miR‐124: microRNA‐124; R: reverse; RT‐qPCR: reverse‐transcription quantitative polymerase chain reaction.

2.18. Scratch test

Cells in the logarithmic growth phase were seeded into a six‐well plate (1 × 10⁶ cells/well). The back of the six‐well plate was marked using a marker pen as a location for photographing. Upon coverage of the entire surface of the plate by cells, the original culture medium was changed by 1% FBS cell culture medium, and the cells were starved for 12 hr. A 200 μl pipette tip was used to draw lines vertically on the six‐well plate using a ruler. The plate was washed three times with 2 ml of PBS to remove the scratched cell debris. Cells were treated according to the grouping in the above experiments. The cells were photographed at the 0th and 24th h. The experiments were performed in triplicates. A total of 15 straight lines were drawn in each scratch picture. The width of the scratches of the 15 lines was measured and the average width of the scratches was calculated. Cell migration rate (%) = (1 − scratch width/initial scratch width) × 100%.

2.19. Statistical analysis

Statistical analyses were conducted using the SPSS 21.0 software (IBM Corp., Armonk, NY). The mean value and standard error of mean were calculated. All cell experiments were performed in triplicates. Normal distribution and variance homogeneity were tested for the entire data before performing further statistical comparison tests. The comparisons between two groups were analyzed using an independent t test, whereas the data comparison within groups were conducted using paired t test, whereas comparisons among multiple groups were performed using one‐way analysis of variance. Turkey was performed by post‐hoc test and rank sum test was performed if data did not conform to normal distribution or homogeneity of variance. A probability value of p < 0.05 was indicative of a statistically significant difference.

3. RESULTS

3.1. PAE inhibits the promoting effect of HOTAIR on RIF rats

The HE staining and Masson trichrome staining were used to detect the degree of RIF. RT‐qPCR and western blot analysis were used to determine the levels of HOTAIR, α‐SMA, vimentin, MMP‐2, E‐cadherin, and MMP‐9. In comparison with the sham group, the kidneys of rats in the other four groups had different degrees of RIF along with an increased expression of HOTAIR. HE staining revealed that in comparison to the RIF group, severe inflammation and necrosis, and swelled tubules were observed in the kidneys of rats in the HOTAIR group, whereas the addition of PAE relieved these symptoms (Figure 1a). Masson trichrome staining demonstrated that in comparison to the RIF group, the collagen deposition was evident in the kidneys of rats in the HOTAIR group, suggesting the manifestation of severe RIF, whereas the addition of PAE improved these symptoms (Figure 1b). Concurrently, the renal tissue staining of the PAE + RIF group showed that PAE could relieve symptoms of RIF rats (Supporting Information Figure 1). On comparison with the RIF group, it was observed that the renal interstitial fibrotic score was significantly elevated and the expression of HOTAIR was enhanced in the HOTAIR group, whereas addition of PAE reduced these levels (Figure 1c,d). In comparison to the RIF group, the expression of α‐SMA, vimentin, MMP‐2, and MMP‐9 was elevated, whereas the expression of E‐cadherin had descended in the kidneys of rats in the HOTAIR group, and the addition of PAE decelerated the above changes (Figure 1e,f). All data indicated that HOTAIR could stimulate RIF whereas PAE could reverse the promoting effects of HOTAIR on RIF rats.

Figure 1.

PAE reduces the stimulative effect of HOTAIR on RIF rats. (a,b) Pathological observation of kidney tissues in rats after treatment by HE staining and Masson trichrome staining, respectively (×200). (c) Renal interstitial fibrotic scores of renal tissues in rats after treatment. (d) HOTAIR levels in rats after treatment determined by RT‐qPCR. (e) Protein levels of α‐SMA, vimentin, MMP‐2, E‐cadherin, and MMP‐9 in rats after treatment determined by western blot analysis. (f) Quantitative analysis of migration‐ and EMT‐related proteins in renal tissues of rats assessed by western blot analysis. *p < 0.05 and **p < 0.01 vs. the sham group; ^# p < 0.05 vs. the RIF group. Measurement data were expressed as mean ± standard error of mean; comparisons between two groups were analyzed using t test (n = 10); the experiment was conducted in triplicates. α‐SMA: α‐smooth muscle actin; HE: hematoxylin‐eosin; MMP: matrix metalloproteinase; PAE: paeonol; RIF: unilateral ureteral obstruction; RT‐qPCR: reverse‐transcription quantitative polymerase chain reaction [Color figure can be viewed at wileyonlinelibrary.com]

3.2. HOTAIR upregulates Notch1 by negatively regulating miR‐124

The biological prediction website (https://cm.jefferson.edu/rna22/Interactive/) predicted the presence of a binding site between miR‐124 and Notch1 3′‐UTR along with an interaction of miR‐124 with HOTAIR. The dual‐Luciferase reporter gene assay was used to identify the relationship between miR‐124 and Notch1 as well as the interaction between miR‐124 and HOTAIR. In comparison with the miR‐124 mimic + Notch1 ‐3′‐UTR group, the luciferase activity of cells in the miR‐124 mimic + Notch1–3′‐UTR^W group had decreased (Figure 2a). In comparison with the NC + miR‐124 group, the luciferase activity of cells in the HOTAIR + miR‐124 group was obviously reduced (Figure 2b). Compared with the NC group, an overexpression of HOTAIR increased the expression of HOTAIR and Notch1 but decreased the expression of miR‐124 (Figure 2c). All these results showed that HOTAIR could upregulate Notch1 by negatively regulating miR‐124.

Figure 2.

HOTAIR regulates Notch1 by interacting with miR‐124. (a) Luciferase activity of Notch1–3′‐UTR^W and Notch1–3′‐UTR^M after transfection. (b) Luciferase activity of miR‐124 after transfection with NC + miR‐124 and HOTAIR + miR‐124. (c) Expression of miR‐124 and Notch1 after upregulation of HOTAIR detected by RT‐qPCR. *p < 0.05 vs. the NC group. Measurement data were expressed as mean ± standard error of mean; comparisons between two groups were analyzed using t test. The experiment was conducted in triplicates. 3′‐UTR: 3′‐untranslated region; miR‐124: microRNA‐124; NC: negative control; RT‐qPCR: reverse‐transcription quantitative polymerase chain reaction

3.3. HOTAIR binds to AGO2 protein

Subsequently, ISH was used to identify the subcellular localization of HOTAIR in NRK‐49F cells. RIP and RNA pull‐down assay were used to detect if HOTAIR could bind to the AGO2 protein. The results showed that HOTAIR was mainly distributed in the cytoplasm (Figure 3a). RT‐qPCR demonstrated that HOTAIR was highly expressed in the cytoplasm of NRK‐49F cells (Figure 3b). HOTAIR could tightly bind to the AGO2 protein (Figure 3c,d). All these data suggested that HOTAIR bound to the AGO2 protein.

Figure 3.

HOTAIR binds to AGO2 protein. (a) Location of HOTAIR in NRK‐49F cells by ISH (×400). (b) Expression of HOTAIR in the cytoplasm and nucleus of NRK‐49F cells by RT‐qPCR. (c,d) HOTAIR can bind with the AGO2 protein by RIP and RNA pull‐down assay. *p < 0.05 vs. cytoplasm or NC or IgG; measurement data were expressed as mean ± standard error of mean; comparisons between two groups were analyzed using t test, whereas comparisons among multiple groups were performed using one‐way ANOVA. The experiment was conducted in triplicates. AGO2: Argonaute 2; ANOVA: analysis of variance; IgG: immunoglobulin G; ISH: in situ hybridization; NC: negative control; NRK‐49F: normal rat kidney interstitial fibroblast; RIP: RNA‐binding protein immunoprecipitation; RT‐qPCR: reverse‐transcription quantitative polymerase chain reaction [Color figure can be viewed at wileyonlinelibrary.com]

3.4. PAE inhibits the promoting effect of HOTAIR on EMT of NRK‐49F cells

HOTAIR, miR‐124, and Notch1 expression was determined using RT‐qPCR (Figure 4a), while the E‐cadherin, vimentin, and α‐SMA levels were detected by western blot analysis (Figure 4b). The fluorescence intensity of E‐cadherin and vimentin was determined by immunofluorescence (Figure 4c). In comparison with the NC group, the expression of HOTAIR and Notch1 in the PAE group had decreased and the expression of miR‐124 had increased, while the HOTAIR and HOTAIR + PAE groups revealed opposite trends. In comparison to the HOTAIR group, the addition of PAE reduced the expression of HOTAIR and Notch1, and elevated the expression of miR‐124. On comparing with the NC group, it was observed that the expression of E‐cadherin in the PAE group was enhanced and the expression of vimentin and α‐SMA was diminished, while it was opposite in the HOTAIR and HOTAIR + PAE groups. In comparison with the HOTAIR group, the addition of PAE increased the expression of E‐cadherin but decreased the expression of vimentin and α‐SMA. In comparison to the NC group, the PAE group showed enhanced E‐cadherin fluorescence intensity and reduced vimentin fluorescence intensity, while the HOTAIR and HOTAIR + PAE groups exhibited opposite trends. A comparison to the HOTAIR group highlighted that the addition of PAE increased the fluorescence intensity of E‐cadherin and decreased the fluorescence intensity of vimentin (Figure 4c). These results indicated that HOTAIR facilitated the EMT of NRK‐49F cells, and PAE could suppress the stimulative effect of HOTAIR on EMT.

Figure 4.

PAE reverses the promoting effect of HOTAIR on EMT of NRK‐49F cells. (a) Expression of HOTAIR, miR‐124 and Notch1 in NRK‐49F cells by RT‐qPCR. (b) Protein levels of E‐cadherin, vimentin, and α‐SMA by Western blot analysis. (c) Fluorescence intensity of E‐cadherin and vimentin by immunofluorescence (×400); *p < 0.05 and ***p < 0.001 vs. the NC group; ^# p < 0.05 vs. the HOTAIR group. Measurement data were expressed as mean ± standard error of mean; comparisons between two groups were analyzed using t test. The experiment was conducted in triplicates. EMT: epithelial to mesenchymal transition; NRK‐49F: normal rat kidney interstitial fibroblast; miR‐124: microRNA‐124; NC: negative control; PAE: paeonol; RT‐qPCR: reverse‐transcription quantitative polymerase chain reaction [Color figure can be viewed at wileyonlinelibrary.com]

3.5. PAE inhibits the facilitating effect of HOTAIR on the migration of NRK‐49F cells

The cell migration rate was detected by Scratch test (Figure 5a), and the expression of MMP‐2 and MMP‐9 was measured by Western blot analysis (Figure 5b). In comparison with the NC group, the cell migration rate was decreased in the PAE group, while it was elevated in the HOTAIR group. In comparison to the HOTAIR group, the addition of PAE reduced the cell migration rate. On comparing compared to the NC group, decreased levels of MMP‐2 and MMP‐9 were observed in the PAE group, along with elevated levels of MMP‐2 and MMP‐9 in the HOTAIR and HOTAIR + PAE groups. Compared with the HOTAIR group, levels of MMP‐2 and MMP‐9 were reduced after being added with PAE. These results showed that HOTAIR enhanced the migration of NRK‐49F cells, and PAE could suppress the enhanced effect of HOTAIR on migration.

Figure 5.

PAE suppresses the promoting effect of HOTAIR on the migration of NRK‐49F cells. (a) Cell migration rate of NRK‐49F cells after transfection by Scratch test. (b) Protein levels of MMP‐2 and MMP‐9 in NRK‐49F cells after transfection by Western blot analysis. *p < 0.05 vs. the NC group; ^# p < 0.05 vs. the HOTAIR group. Measurement data (scratch test) were expressed as mean ± standard error of mean; comparisons among multiple groups were performed using one‐way ANOVA. The experiment was conducted in triplicates. ANOVA: analysis of variance; miR‐124: microRNA‐124; MMP: matrix metalloproteinase; NC: negative control; NRK‐49F: normal rat kidney interstitial fibroblast; PAE: paeonol [Color figure can be viewed at wileyonlinelibrary.com]

3.6. PAE reverses the activating effect of HOTAIR on the Notch1/Jagged1 signaling pathway

The expression of HOTAIR, miR‐124, Notch1, and Jagged1 was measured by RT‐qPCR, western blot analysis, and immunohistochemistry. In comparison with the NC group, the expression of HOTAIR in the HOTAIR and HOTAIR + IMR‐1 groups had increased whereas the expression of miR‐124 had decreased. In comparison to the HOTAIR group, the HOTAIR + IMR‐1 group showed reduced Notch1 level (Figure 6a). Compared with the NC group, the expression of activated Notch1 and Jagged1 in the HOTAIR group was elevated. A comparison with the HOTAIR group highlighted the observation of decreased levels of activated Notch1 and Jagged1 in the HOTAIR + PAE and HOTAIR + IMR‐1 groups (Figure 6b). Synchronously, our team tested the mRNA levels of HES1 and HEY1 by RT‐qPCR. The results showed that the mRNA levels of HES1 and HEY1 in the HOTAIR group were higher those that in the NC group, and the mRNA levels of HES1 and HEY1 in the HOTAIR + PAE and HOTAIR + IMR‐1 groups were lower than those in the HOTAIR group (Figure 6c). The expression of HOTAIR, miR‐124 and Notch1 in the rat renal interstitial tissues was detected by RT‐qPCR. Compared with the RIF group, the expression of miR‐124 was reduced and the expression of activated Notch1 was enhanced in the HOTAIR group, whereas the addition of PAE reversed the changes (Figure 6d). The results of immunohistochemistry showed that in comparison to the RIF group, the HOTAIR group showed an increased activated Notch1 expression and the addition of PAE decreased the expression of Notch1 (Figure 6e). The expression of Jagged1 and Notch1 in the rat renal interstitial tissues was evaluated by western blot analysis. In comparison with the RIF group, the protein levels of Jagged1 and activated Notch1 were increased in the HOTAIR group, whereas the addition of PAE reversed the changes (Figure 6f). Concurrently, we tested the mRNA levels of HES1 and HEY1 by RT‐qPCR. The results showed that the mRNA levels of HES1 and HEY1 in renal tissues of the HOTAIR group were higher than the levels in the RIF group, and PAE addition could alleviate the effects in the mRNA levels of HES1 and HEY1 (Figure 6g). All these data showed that the addition of PAE could inactivate the Notch1/Jagged1 signaling pathway.

Figure 6.

PAE inhibits the stimulating effect of HOTAIR on the Notch1/Jagged1 signaling pathway. (a) Expression of HOTAIR and miR‐124 in NRK‐49F cells after transfection determined by RT‐qPCR. (b) Expression of activated Notch1 and Jagged1 in NRK‐49F cells after transfection as determined by western blot analysis. (c) The mRNA levels of HES1 and HEY1 in NRK‐49F cells after transfection determined by RT‐qPCR. (d) Expression of miR‐124 and Notch1 in rat kidneys after treatment determined by RT‐qPCR. (e) Expression of Notch1 in rat kidneys after treatment determined by immunohistochemistry (×200). (f) Expression of activated Notch1 and Jagged1 in renal tissues after treatment determined by western blot analysis. (g) The mRNA levels of HES1 and HEY1 in renal tissues after treatment determined by RT‐qPCR. *p < 0.05 vs. the NC and sham groups; ^# p < 0.05 vs. the HOTAIR and RIF groups. Measurement data were expressed as mean ± standard error of mean; comparisons among multiple groups were performed using one‐way ANOVA. The experiment was conducted in triplicates. ANOVA: analysis of variance; miR‐124: microRNA‐124; NRK‐49F: normal rat kidney interstitial fibroblast; RIF: renal interstitial fibrosis; RT‐qPCR: reverse‐transcription quantitative polymerase chain reaction [Color figure can be viewed at wileyonlinelibrary.com]

3.7. Overexpression of miR‐124 in vitro decreases the EMT induced by HOTAIR

First, RT‐qPCR was used to test the expression of HOTAIR and miR‐124. No significant difference was observed in the expression of HOTAIR in the HOTAIR + miR‐124 mimic group compared to the expression in the HOTAIR + mimic NC group, but the expression of miR‐124 in the HOTAIR + miR‐124 mimic group was significantly higher than the expression in the HOTAIR + mimic NC group (Supporting Information Figure 2a). Furthermore, we measured the expression of EMT‐related proteins by immunofluorescence. The results showed that compared with the HOTAIR + mimic NC group, the HOTAIR + miR‐124 mimic group displayed increased E‐cadherin fluorescence intensity along with decreased vimentin fluorescence intensity (Supporting Information Figure 2b).

4. DISCUSSION

RIF is commonly regarded as the final outcome of a majority of progressive CKDs, in which fibrosis is a consequence of a gradual increase in myofibroblasts concentration in the renal interstitial space (Wang et al., 2017). In recent years, lncRNAs have been proven to critically function in the development of fibrosis of various diseases such as cardiac interstitial fibrosis and lung interstitial fibrosis (Cao et al., 2013; Liang et al., 2018). The current study aimed at clarifying whether the lncRNA HOTAIR/miR‐124/Notch1 axis can exercise a facilitating effect on RIF and whether the addition of PAE can alleviate this effect. Consequently, this study demonstrated that lncRNA HOTAIR played a stimulative role in EMT of RIF by enhancing the expression of Notch1 through competitively binding to miR‐124, and PAE could retard this effect.

Initially, the data obtained from the experiments demonstrated that lncRNA HOTAIR facilitated the migration and EMT of NRK‐49F cells in RIF. Consistent with our study, a recent study has illustrated the functionality of lncRNA HOTAIR as a critical promoter of the progression of RCCs and metastasis of RCC (M. Xia et al., 2017). Besides, accumulating findings have highlighted the ability of lncRNA HOTAIR to enhance the migration of a various types of cells such as HeLa cells and breast cancer cells (Zhao, Geng, Li, Chen, & Sun, 2018; P. Zheng, Yin, et al., 2018). Existing evidence has remarked that lncRNAs could enhance EMT of idiopathic pulmonary fibrosis by regulating the expression of genes involved in EMT (Sun et al., 2016). Previous evidence has highlighted functionality of lncRNA HOTAIR as a critical regulator in promoting EMT in oral squamous cell carcinoma (Lu et al., 2017).

Furthermore, the current study found that lncRNA HOTAIR could facilitate RIF through activation of the Notch1/Jagged1 signaling pathway by inhibiting the expression of miR‐124. Besides, miR‐124 overexpression in vitro decreased the EMT promotion by HOTAIR. Before our study, recent studies had revealed the ability of lncRNAs to modulate other noncoding RNAs, like miRNAs, for instance, a current study suggested the functioning of HOTAIR as a negative regulatory competing endogenous RNA (ceRNA) in the regulation of miR‐130a (Ma et al., 2014). More important, lncRNA HOTAIR could function as a ceRNA to bind to miR‐124 and miR‐331‐3p, resulting in the upregulation of HER2, eventually facilitating the tumor cell proliferation and metastasis in gastric cancer (Liu et al., 2014). miR‐124 is observed to repress the EMT process in cervical cancer and non‐small‐cell lung cancer (J. Wu et al., 2018). Interestingly, a series of studies have demonstrated the negative regulatory role of miR‐124 in the Notch1 signaling pathway in gastric cancer (Jiang et al., 2016). Besides, a recent finding also revealed that miR‐124 acts as an inhibitor of the gastric cancer cell growth by exercising a suppressive effect on the Notch signaling pathway (H. J. Xiao et al., 2018). Furthermore, an association has been demonstrated between the Notch1 signaling pathway and the TGFβ‐induced EMT in kidney epithelia (Nyhan et al., 2010). A previous RT‐qPCR analysis showed an elevated expression of Notch target genes Hes1 and Hey1 in the kidneys with severe tubular dilatation, degeneration as well as interstitial fibrosis (Bielesz et al., 2010). Excitingly, a recent research consistent with our study illustrated that lncRNA HOTAIR enhances EMT and RIF, which was achieved via activation of the Notch1 signaling pathway through the mediation of miR‐124 (H. Zhou et al., 2018). Based on these reported results, out team concluded that lncRNA HOTAIR downregulation attenuated the progression of RIF by regulating miR‐124‐ of the Notch1 signaling pathway.

In addition, the results of current study displayed that the administration of PAE is capable of alleviating the stimulative effect of lncRNA HOTAIR on migration and EMT of NRK‐49F cells in RIF. As a traditional Chinese herb, PAE has been revealed to have antioxidative, anti‐inflammatory, and antitumor properties (Horng, Shieh, Tan, Yang, & Tang, 2014). In accordance with our results, a recent report highlighted the suppressive property of PAE on the migration and EMT of highly metastatic premalignant HaCaT cells through regulation of the ERK and TGF‐b1/Smad pathway (Yang, Xing, Wang, Yi, & Du, 2018). Besides, Ying et al. reported that PAE exercises its protective effects on renal injury in diabetic nephropathy rats (Y. Chen et al., 2016). In addition, accumulating evidence indicated that PAE upregulated several miRs, such as miR‐1 and miR‐142 (Horng et al., 2014; J. Wu et al., 2018), which is consistent with our result that PAE increased miR‐124 expression. Furthermore, our results showed that downregulated lncRNA HOTAIR inhibited RIF by downregulating Notch1 through upregulation of miR‐124. These results are conclusive of the inhibitory role of PAE on the promoting effect of lncRNA HOTAIR on RIF.

In conclusion, our data confirmed that lncRNA HOTAIR promotes RIF through stimulation of the Notch1/Jagged1 signaling pathway by modulating miR‐124 and administration of PAE can alleviate RIF in a rat model of RIF. These results provided insights on a potential target for RIF treatment in the future. However, due to the limitations of this study, further research is critical. First, due to the limited sample size, studies focusing on larger sample sizes are needed to fully substantiate the accuracy of the results. Secondly, detailed investigation of genes that comprise the lncRNA HOTAIR/miR‐124/Notch1 axis should also yield further insight into the mechanism by which lncRNA HOTAIR overexpression induces RIF. Additionally, further research based on exploring the relationship between lncRNA HOTAIR and the potential targeting miR‐124 is needed.

CONFLICTS OF INTEREST

The authors declare that there are no conflicts of interest.

AUTHOR CONTRIBUTIONS

H. Z., Z.‐Z. Q., Z.‐H. Y., L. G., J.‐M. H., Z.‐W. Z., J. Z. contributed for conception and design of this article. Z.‐H. Y., L. G., J.‐M. H. contributed for analysis and interpretation. Z.‐W. Z. and J. Z. were involved in data collection. J. Z., H. Z. were involved in statistical analysis. H. Z., Z.‐Z. Q. contributed in writing this article. H. Z., Z.‐Z. Q., Z.‐H. Y., L. G., J.‐M. H., Z.‐W. Z., J. Z. provided critical revision for this article. H. Z., Z.‐Z. Q., Z.‐H. Y., L. G., J.‐M. H., Z.‐W. Z., J. Z. gave final approval for this article.

Supporting information

Supporting information

Supporting information

Supporting information