Skip to main content
NCBI home page
Wiley Open Access Collection logoLink to Wiley Open Access Collection
. 2018 Dec 12;234(8):12771–12785. doi: 10.1002/jcp.27897

Naproxen attenuates osteoarthritis progression through inhibiting the expression of prostaglandinl‐endoperoxide synthase 1

Cuijiang Wang 1, Fei Wang 1,✉, Fen Lin 2, Xiaohong Duan 3, Binna Bi 4
PMCID: PMC13483301  PMID: 30548602

Abstract

Objective

This study aims to test the effect of naproxen treatment and the biological target of naproxen for treating osteoarthritis (OA).

Methods

Differentially expressed genes (DEGs) in OA synovial tissues and normal counterparts were analyzed by messenger RNA microarray analysis. R package (weighted gene coexpression network analysis) was used to divide DEGs into several modules and determine the hub genes in each module. The expression level of prostaglandin‐endoperoxide synthase 1 ( PTGS1) in OA synovial cells and tissues was verified by a quantitative real‐time polymerase chain reaction and western blot. Transwell assay evaluated the numbers of cell migration and invasion. Furthermore, Safranin O and fast green staining and hematoxylin and eosin staining were performed on joints from anterior cruciate ligament transection mice.

Results

Microarray analysis determined PTGS1 was the hub gene in the black module, which was overexpressed in OA synovial cells and tissues compared with normal synovial cells. OA synovial cells transfected with sh‐PTGS1 showed downregulation of PTGS1. After treatment with naproxen, the expression of PTGS1 sharply decreased in the OA group. The migration and invasion of OA synovial cells increased, whereas the cell apoptosis rate decreased when PTGS1 was overexpressed. However, the cell migration and invasion decreased, whereas cells apoptosis increased when it was treated with naproxen. Naproxen could also influence the expression level of six OA‐related genes: LUBRICIN, matrix metalloproteinase 13 (MMP‐13), cyclooxygenase‐2 (COX‐2), ACAN, COL2A1, and COL1A1.

Conclusion

We validated that naproxen could suppress the expression of PTGS1 in synovial cells. Moreover, naproxen could inhibit the migration/invasion ability of OA synoviocytes and promote the apoptosis rate OA synoviocytes.

Keywords: naproxen, osteoarthritis (OA), prostaglandin‐endoperoxide synthase 1 ( PTGS1), weighted gene coexpression network analysis (WGCNA)

  • 1.

    Our data demonstrate that naproxen targets the expression of prostaglandin‐endoperoxide synthase 1 (PTGS1) and promotes the apoptosis rate of osteoarthritis (OA) synovial cells.

  • 2.

    Our study suggests that PTGS1 might be explored as a novel therapeutic strategy for the treatment of OA.

graphic file with name JCP-234-12771-g003.jpg

1. INTRODUCTION

Osteoarthritis (OA) is a chronic musculoskeletal disease with high prevalence and affects the elderly around the world (Koog, Lee, & Wi, 2014). It is characterized by the progressive degeneration of articular cartilage, synovial joint structure, and sclerosis of the subchondral bone (Litwic, Edwards, Dennison, & Cooper, 2013). Approximately 15% of individuals older than 60 suffer from symptomatic OA, which makes up a large percentage of locomotor disability population among nonfatal diseases (Ekman et al., 2014). Over 40% of patients with OA are found with substantial knee symptoms frequently and 50% of them have inadequate pain relief (Holt, Fort, Grahn, Kent, & Bello, 2015). There are multiple risk factors that are related to the occurrence of OA, such as obesity, joint injury, advanced age, genetics, and hormone disorder (Litwic et al., 2013). Among obese individuals, women are more likely to be affected (Palazzo, Nguyen, Lefevre‐Colau, Rannou, & Poiraudeau, 2016). The location of the disease also varies; knee, hip, hand, spine, and lower limb are all vulnerable to OA (Waller et al., 2014). Considering the high incidence rate and the serious consequences of the disease, the current studies aim to develop OA treatment strategies for alleviating joint pain, limiting the progression and reducing physical disability (Ji et al., 2018; Zhang et al., 2008). As for the treatment of OA, although evidence‐based pharmacologic treatment guidelines are inadequate, nonsteroidal anti‐inflammatory drugs (NSAIDs) are the most effective and well‐established approach for treating the signs and symptoms of OA (Holt et al., 2015). Naproxen is an established and one of the most effective NSAIDs. It is commonly used for the treatment of knee OA as a prescribed therapeutic agent (Sanders et al., 2015). However, several adverse effects of NSAIDs as therapeutic agents have been reported. Some studies found that NSAIDs (e.g., rofecoxib [Vioxx]) could increase the risk of stroke and heart attack and could even elevate cardiovascular risks (McGettigan & Henry, 2013). Naproxen has been shown to have much fewer cardiovascular risks than other NSAIDs, such as indometacin and meloxicam (McGettigan & Henry, 2011). Naproxen is recommended as a first line or second line pharmacologic agent for the treatment of knee OA (Bruyere et al., 2014). In addition, some guidelines recommend naproxen for relieving the pain in OA patients with increased cardiovascular risk (Bruyere et al., 2014).

Prostaglandin‐endoperoxide synthase 1 (PTGS1), also known as cyclooxygenase‐1 (COX‐1), is one of the key enzymes in the synthesis of prostaglandin (the isoform of it is COX‐2; Knorth et al., 2004). PTGS1 is a constitutive enzyme and regarded as a “housekeeping” isoform due to its unique functions, which include the regulation of renal, gastrointestinal, and platelet functions (Nagao, Sato, & Yamauchi, 2013). It is expressed in the joints of patients with OA, accompanied with a highest expression in the lining cells and followed by blood vessels and the sublining layer (Knorth et al., 2004). It has been reported that NSAIDs possess chemopreventive properties against cancer cells through targeting COX‐1 and COX‐2 (Mandal et al., 2018). What is more, naproxen has been shown to be a highly effective and long‐lasting (about 8 hr) COX‐1 inhibitor, which shows its antiplatelet efficacy (Tuleja, Mejza, Cmiel, & Szczeklik, 2003). Apart from PTGS1, the expressions of six OA‐related genes have also been analyzed in this study, which include LUBRINCIN, matrix metalloproteinase 13 (MMP‐13), COX‐2, ACAN, COL2A1, and COL1A1. The release of MMP‐13 could cause degradation of collagen matrix and lead to the degeneration of articular cartilage (Xia et al., 2014). Lubricin is known as a main chondroprotective agent for the prevention of synovial cells adhesion and proliferation. The expression of Lubricin has been reported to be downregulated in mice models (Cui, Xu, Li, Song, & Yu, 2015). COX‐2 was demonstrated to be highly expressed in patients with OA and rheumatoid arthritis, which could provide novel drug targets for treating arthritis (Fan, Liu, Zhao, Li, & Yang, 2015). ACAN, COL2A1, and COL1A1 could serve as markers for OA clinical management, and their expression could significantly increase in the progression of attenuating OA (Li et al., 2016; Ma, Liu, Hu, Wen, & Tang, 2017; Shui et al., 2017; Smith, Russell, Schiavinato, & Little, 2013).

Our understanding of OA comes from both clinical and preclinical studies, which have contributed to characterizing the development of OA. Furthermore, the existing clinical studies on humans have several limitations: the significant variability of the rate of OA progression and the chronic nature of OA in human subjects make it difficult to study the disease (Kuyinu, Narayanan, Nair, & Laurencin, 2016). To study the pathogenesis of the disease and the positive therapeutic efficacy of naproxen, an experiment using an animal model was developed in this study to further verify the study on human subjects.

2. MATERIALS AND METHODS

2.1. Patients and tissue samples

Twenty pairs of synovial tissues were obtained surgically from patients with OA with unsuccessful conservative treatment and healthy volunteers with trauma knee surgery after car accidents, respectively. The average age of the experimental subjects was 68, ranging from 55 to 76 years. Informed consents from all patients were obtained before surgery. At the time of surgery, patients had not been treated with any NSAID for at least two weeks and without glucocorticoid therapy for more than 4 weeks. There was no patient who had received intra‐articular therapy with hyaluronic acid previously. The clinical diagnosis met the revised standards of the American College of Rheumatology. The experiment protocol was approved by the Clinical Research Ethics Committee of the Linyi People's Hospital. The collected synovial tissues were cut into small pieces of about 2 mm3 without fat, bone, cartilage, and fibrous tissues. Each tissue in 300 mg was placed into a 12‐well plate and frozen in liquid nitrogen under the temperature of −270°C.

2.2. Microarray analysis

The gene chip GSE55457 from gene expression omnibus (GEO) datasets (https://www.ncbi.nlm.nih.gov/geo/) was analyzed through the platform GPL96, which contained the synovial membrane of 10 healthy controls (HC) as well as nine patients with OA after processing. Total extracted RNA was analyzed via Arraystar Human RNA microarray V2.0 (Affymetrix Inc., Santa Clara, CA). R package (https://www.r‐project.org/) was applied for analyzing HC and OA cells, |Fold Change| > 1.5 and p‐value < 0.05 was used to screen out differentially expressed messenger RNAs (mRNAs).

2.3. Cell culture

The synovial tissues that were collected before were minced and digested by collagenase (1.5 mg/ml) in Dulbecco's modified Eagle medium (DMEM) medium for 90 min under the temperature of 37°C. Then, 0.5% trypsin was added into the medium for subsequent incubation (30 min). Cells were centrifuged at 1,000 r/s for 5 min and washed four times with phosphate‐buffered saline (PBS)/DMEM. Then, the cells were resuspended and maintained with the addition of 10% fetal bovine serum (FBS), 1% penicillin, and 1% sodium dioxide pyruvate under 37°C with 95% concentration of air (5% carbon dioxide).

2.4. Cell transfection

The sh‐control and sh‐PTGS1 were designed and provided by GenePharma (Shanghai, China). In addition, we transfected cells with pcDNA3.1‐PTGS1 provided by Youbo Biological Technology Co., Ltd. (Beijing, China) to overexpress PTGS1. Cell transfection was performed under the protocol of Lipofectamine2000 (Invitrogen, Carlsbad, CA). Except one group that was treated with naproxen (100 μg/ml naproxen was added into the cultivation environment before the transfection process), the transfected cells were divided into six groups: (a) negative control (NC) group: cells without treatment; (b) sh‐control: cells transfected with sh‐control sequence; (c) sh‐PTGS1 group: cells transfected with sh‐PTGS1 sequence; (d) pcDNA3.1 group: cells transfected with pcDNA3.1 vector; (e) PTGS1 group: cells transfected with PTGS1 sequence to overexpress PTGS1 protein (the sequence of sh‐PTGS1 shown in Table 1); (f) PTGS1+naproxen group: cells transfected with PTGS1 and treated with naproxen therapy. After transfection, the cells were harvested for detecting transfection efficiency using quantitative real‐time polymerase chain reaction (qRT‐PCR) and western blot.

Table 1.

siRNA sequence of PTGS1

Genes Sequences
sh‐PTGS1 Top strand: 5′‐CACCGGAGTACAGCTACGAGCAGTTCGAAAACTGCTCGTAGCTGTACTCC‐3′
Bottom strand: 5′‐AAAAGGAGTACAGCTACGAGCAGTTTTCGAACTGCTCGTAGCTGTACTCC‐3′
sh‐control Top strand:5′‐CACCGGCCCGAAGTGCAATCGCTCGAAAGCGATTGCACTTCGGGCC‐3′
Bottom strand: 5′‐AAAAGGCCCGAAGTGCAATCGCTTTCGAGCGATTGCACTTCGGGCC‐3′
Open in a new tab

Note. PTGS1: prostaglandin‐endoperoxide synthase 1; siRNA: small interfering RNA.

2.5. Experiment on animal model

All the surgical procedures associated with the animal model were approved by local institution's Animal Care and Ethics Committee, with an effort to minimize discomfort and pain caused by surgery. C57BL/6J is a kind of inbred mouse with characteristics of good comparability and consistent stress, and it is the most commonly used rodent in OA study. The maturity of C57BL/6J mice is 10 weeks, and to rule out the effect of estrogen on OA progression, 3‐month‐old C57BL/6 male mice were purchased from Vital River. Animal feeding environment: temperature 22–25°C, light–dark cycle 12 hr, relative humidity 60%, all mice free to drink water. The average body weight of the mice was approximately 25 g. Animals were kept at a 12‐hr light‐dark cycle condition with a relative humanity of 60% under 22–25°C. All mice had free access to food and water. Only mice with free activities and good mental appetite were selected and divided into seven groups for the following experiments (n = 10 per group). To generate a destabilized OA mice model, anterior cruciate ligament transection (ACLT) of the right knee was performed.

ACLT model is a commonly used surgical model in OA research, because the ACL injury can cause joint destabilization and subsequently cause posttraumatic OA (Lampropoulou‐Adamidou et al., 2014). Except one group, which was treated with naproxen (40 mg/kg), the mice in the OA group were randomized into six groups: (a) NC group: without treatment; (b) sh‐control: cells transfected with sh‐control sequence were injected into right knee of OA mice model; (c) sh‐PTGS1 group: cells transfected with sh‐PTGS1 sequence were injected into right knee of OA mice model; (d) pcDNA3.1 group: cells transfected with pcDNA3.1 vector were injected into the right knee of OA mice model; (e) PTGS1 group: cells transfected with PTGS1 sequence were injected into the right knee of the OA mice model; (f) PTGS1+naproxen group: cells transfected with PTGS1 and treated with naproxen therapy. The naproxen treatment group was created by feeding naproxen in diet for 5 days, the transfection treatment was obtained by injecting trasnfected cells (described as in the part of cell transfection) in the right knee of the OA mice model. After this, five mice were killed at 30d, 60d after operation. The mice in each group were anesthetized by the use of xylazine (5 mg/kg) accompanied with ketamine (40 mg/kg) through intraperitoneal injection. During the surgery, it was necessary to avoid injuring the cartilage beneath the medical meniscus.

2.6. Weighted gene coexpression network analysis

Weighted gene coexpression network analysis (WGCNA) is a well‐established method and has been widely used for defining candidate genes in human diseases (Langfelder & Horvath, 2008). All the differentially expressed genes (DEGs) in synovial tissues were analyzed with WGCNA, an R package for determining clusters (modules) of highly correlated genes. The hierarchical clustering was obtained by iteratively dividing individual clusters into hub‐clusters to form a tree with branches representing coexpression modules. Then, modules could be defined by cutting the branches at certain heights. WGCNA assumes that all nodes are associated with each other and the strength of their connections is different; hub genes are more likely relevant to the functionality of networks than other nodes. The highly connected genes could be divided into the same module with hub gene as the most highly connected one within the module. Package WGCNA_3.4.1 was used in this study to screen the hub gene in each gene module and validate the high expression of PTGS1 in the synovial tissues of patients with OA. Zsummary was used to judge modules and the module with weak preservation and significant differentiation was selected for further study.

2.7. Quantitative real‐time polymerase chain reaction

RNA was extracted with TRIzol reagent (Invitrogen). Reverse transcription of isolated RNA was performed on a reverse transcriptase kit (Takara, Dalian, China) with primer sequences listed in Table 2. For quantification of PTGS1 transcripts, β‐actin was chosen as the housekeeping gene (cell cultured with or without naproxen proved to cause no change in β‐actin expression) and applied as a control group to normalize the expression levels of LUBRICIN, MMP‐13, COX‐2, ACAN, COL2A1, and COL1A1 mRNAs. Real‐time quantitative PCR was carried out with SYBR Green MasterMix (Vazyme Biotech Co., Ltd.) with SYBR Green PCR kit (Takara). The 2−∆∆Ct method was used to measure the relative expression levels of each group. The assay was developed in triplicate for high accuracy.

Table 2.

Primers for qRT‐PCR

Genes Sequences
PTGS1 F: 5′‐ TCTTGCTGTTCCTGCTCCTG‐3′
R: 5′‐ GTCACACTGGTAGCGGTCAA‐3′
LUBRICIN F: 5′‐ TCAAGCTGTGCAGGGAGATG ‐3′
R: 5′‐ TACAGGAAAGCTCCGCAGTG ‐3′
MMP‐13 F: 5′‐ CCCCAGGCATCACCATTCAA ‐3′
R: 5′‐ CAGGTAGCGCTCTGCAAACT ‐3′
COX‐2 F: 5′‐ CAAATTGCTGGCAGGGTTGC‐3′
R: 5′‐ AGGGCTTCAGCATAAAGCGT‐3′
ACAN F: 5′‐ CAGTGAGACGTCCGCCTATC‐3′
R: 5′‐ CGTTTGTAGGTGGTGGCTGT‐3′
COL2A1 F: 5′‐ CTTCCCCCTCCTGCTCCAAG‐3′
R: 5′‐ CTGGGCAGCAAAGTTTCCAC3′
COL1A1 F: 5′‐ GGGCCAGTCGTCGGAG‐3′
R: 5′‐ CAATCCTCGAGCACCCTGAG‐3′
β‐actin F: 5′‐GGACTTCGAGCAAGAGATGG‐3′
R: 5′‐AGCACTGTGTTGGCGTACAG‐3′
Open in a new tab

Note. COX‐2: cyclooxygenase‐2; MMP‐13: matrix metalloproteinase 13; PTGS1: prostaglandin‐endoperoxide synthase 1; qRT‐PCR: quantitative real‐time polymerase chain reaction.

2.8. Western blot

Cells were lysed by radio immunoprecipitation assay (RIPA) lysate buffer containing phenylmethanesulfonyl fluoride (PMSF) (Calbiochem) for 1 hr. The isolated proteins were electrophoresed on 10% sodium dodecyl sulfate‐polyacrylamide gel electrophoresis and transferred to five nitrocellulose membranes over 2 hr. Membranes were blocked in 5% bovine serum albumin at room temperature for 30 min and incubated at 4°C with five primary antibodies overnight: anti‐MMP13 antibody (Rabbit polyclonal to MMP13, 1:5,000 dilution, ab39012; Abcam), anti‐LUBRICIN antibody (Rabbit polyclonal to LUBRICIN, with a concentration of 2 µg/ml, ab28484; Abcam), anti‐COX‐2 antibody (Rabbit polyclonal to COX‐2, 1:200 dilution, ab15191; Abcam), anti‐β actin antibody (Rabbit polyclonal to β‐actin, 1:3,000 dilution, ab8227; Abcam), anti‐PTGS1 antibody (Rabbit polyclonal to PTGS1, use a concentration of 2 µg/ml, ab695; Abcam), anti‐ACAN antibody (Mouse polyclonal to ACAN, 1:100 dilution, ab3778; Abcam), anti‐COL2A1 antibody (Rabbit polyclonal to COL2A1, 1:5,000 dilution, ab34712; Abcam), anti‐COL1A1 antibody (Rabbit polyclonal to COL1A1, 1:1,000 dilution, ab34710; Abcam). The polyvinylidene fluoride (PVDF) membranes fixed with primary antibodies were washed by tris‐HCl buffer saline (TBS) for three times and then incubated with goat anti‐Rabbit IgG H&L (horseradish peroxidase (HRP); 1:5,000 dilution, ab6721; Abcam) or goat anti‐Mouse IgG H&L (HRP; 1:2,000 dilution, ab6789; Abcam) for 4 hr. Immunoreactive bands were visualized using enhanced chemiluminescence reagents electro chemi luminescence (ECL)‐plus (Amersham Pharmacia Biotech, Buckinghamshire, UK) and analyzed using ImageJ software.

2.9. Cell invasion assay

The cell invasion assay was performed with matrigel invasion assay (BD Bioscience, MA). About 2 × 105 cells were suspended in 200 µl DMEM, without FBS, and placed in the cell culture that was precoated with 1 µg/ml Matrigel. The transfected cells (5 × 104/well) were seeded into the culture containing 1% FBS and added in the upper chamber of the transwell filter. The cells were incubated at 37°C in 95% air for half a day and then fixed in 4% paraformaldehyde. The staining process was achieved with 0.1% crystal violet (Sigma‐Aldrich, Nanjing, China). The degree of cell invasion could be observed using an optical microscope (NiKon, Japan).

2.10. Cell migration assay

After the treatment of 10 mg/ml Mitomycin C (Sigma, Nanjing, China) for 2 hr, a confluent monolayer was formed by cells that were cultured in a six‐well plate within 24 hr. The monolayer was then scratched with a sterile pipette tip, and the cells were washed with PBS for two times. The washed cells were then incubated in DMEM, without FBS, and the wound areas were photographed using a microscope (10×, Olympus). The migrated cells were counted using an optical microscope (NiKon).

2.11. Cell cytometry assay

Fluorescein isothiocyanate/propidium iodide (FITC/PI)‐labeled Annexin V apoptosis detection kit (BD Biosciences) was used to analyze the apoptosis rate of cells. The cells were stained with AnnexinV‐FITC/PI, DNA was subsequently measured by using flow cytometry. After 24 hr, the OA synoviocytes were digested by ethylene diamine tetraacetic acid (EDTA)‐free trypsin (200 µl) for 5 min at 37°C, and digestion was stopped by adding 1 ml medium containing serum. The lysates were centrifuged for 10 min at 1,000 rpm/min. After the supernatant was aspirated, the cells were stained with AnnexinV‐FITC/PI, following the instructions (Invitrogen). The cells apoptosis rate was determined via flow cytometry (FACS Calibur, BD Bioscience).

2.12. Safranin‐O and fast green staining

Through the Safranin‐O/fast green staining method, the joint pathology could be demonstrated. The pathology investigated contains cartilage damage, osteophyte formation, and joint deformation. After the mice were killed, the right knee joints of mice were dissected. Then, 10% formalin buffer solution was used to fix the dissected joints for 2 days, and 10% EDTA (pH 7.4) was used to decalcify the joints for 3 weeks. The samples were embedded in paraffin. The joints were cut into 4 µm thick sections, and slides were prepared for Safranin O and fast green staining. The slides were stained with Hematoxylin QS solution for 5 min and then washed with running tap water for 5 min. After being destained quickly in Acid EtOH (2‐3 tips), the slides were washed in running water again for 2 × 1 min. Fast green (FCF) solution was prepared to stain slides for 5 min, and the left dye was rinsed quickly with 1% acetic acid solution within 10–15 s. The slides were then stained with 0.1% safranin O solution for 5 min, 95% ethyl alcohol, absolute ethyl alcohol, and xylene were used to dehydrate and clear the slides (2 × 2 min each). The cartilage and mucin are stained in red, the nuclei are shown in black, and the background is stained green. Counting was performed using a resinous medium; all stains were repeated four times independently. The Osteoarthritis Research Society International (OARSI)‐modified Mankin scores of articular cartilage at different time points after surgery were assessed as described by Pritzker et al. (2006).

2.13. Hematoxylin and eosin staining

Xylene was used to dewax the paraffin sections and then the dewaxed sections were rehydrated with ethanol solution and washed with distilled water. Harris’ hematoxylin and eosin (HE) was used to stain the sections for 5 min, washed for the second time with tap water, and followed with distilled water for 5 min. The decoloration procedure was developed with 0.5% hydrochloric acid ethanol for 10 s. After that, the sections were washed with tap water for 15 min and then with distilled water once. The second staining was achieved by 0.5% eosin solution for 40 s. Finally, sections were dehydrated with ethanol and mounted with neutral gum.

2.14. Statistical analysis

Data are expressed as the means ± standard deviation, and the statistical analysis was performed by GraphPad Prism 6.0 (GraphPad Software, Inc., San Diego, CA). The analysis of DEGs modules was achieved by limma package, and analysis of modules and hub genes was achieved by WGCNA package. One‐way analysis of variance was carried out for more than two comparisons in this study. Kolmogorov–Smirnov test was applied to test the normality of distribution. p < 0.05 was considered significantly different.

3. RESULTS

3.1. PTGS1 was highly expressed in synovial tissues of patients with OA

|Fold change| > 1.5 and p‐value < 0.05 were set as the screening criterion to screen the abnormally expressed mRNAs in OA synovial tissues compared with HC. The differentially expressed mRNAs were screened out and all the details of DEGs are demonstrated in Supporting Information Table S3. The top 10 highly expressed and the top 10 lowly expressed mRNAs are shown in the heat map (Figure 1a). Although PTGS1 was not the gene with top 10 high expression level in OA synovial tissue, it did show a significantly different expression between OA and HC groups.

Figure 1.

Figure 1

Open in a new tab

Microarray analysis and module clusters. (a) Heatmap of 20 differentially expressed genes in HC and OA groups. (b) Hierarchical cluster dendrogram derived from all the differentially expressed genes defines 19 modules. Different colors shown below the diagram represent different modules. (c) Corresponding Zsummary scores and module size of different modules reflect the preservation of modules. HC: health control; OA: osteoarthritis [Color figure can be viewed at wileyonlinelibrary.com]

3.2. WGCNA analysis

All the DEGs in synovial tissues were analyzed with WGCNA R software package. Overall, average linkage hierarchical cluster dendrogram identified 19 distinct modules of coexpressed mRNAs in this study (Figure 1b). The branches of the dendrogram represent groups of genes. Dynamic tree cutting was used to define those modules. The expression distance between the genes is defined by the y‐axis and the genes are plotted on the x‐axis. According to the Z scores shown in Figure 1c, almost all modules got Z scores between 0 and 8, which suggested the weak preservation of modules. The hub genes corresponding to each module are presented in Figure 2, which shows that the PTGS1 is the hub gene in the black module. The Z score of the black module was close to zero, and the hub gene map showed that the differentiation of the black module was significant, both of which indicate that the black module was necessary to study. Figure 3c illustrated the significant enrichment of protein–protein interactions within the black module, which further verifies that PTGS1 was the hub gene and highly expressed in the OA group.

Figure 2.

Figure 2

Open in a new tab

Hub genes in each module. The hub genes corresponding to each module were identified, especially PTGS1 is the hub gene in the black module. PTGS1: prostaglandin‐endoperoxide synthase 1 [Color figure can be viewed at wileyonlinelibrary.com]

Figure 3.

Figure 3

Open in a new tab

Naproxen could restrain OA by targeting PTGS1. (a) 10 genes targeted by naproxen, which include PTGS1. (b) The intersection between hub genes and the genes related to naproxen shows that PTGS1 is not only one of the genes targeted by naproxen, but also the hub gene in black module with low preservation. (c) protein‐protein interaction (PPI) of genes in the black module, red represents high expression and blue represents low expression. OA: osteoarthritis; PPI: protein‐protein interaction; PTGS1: prostaglandin‐endoperoxide synthase 1 [Color figure can be viewed at wileyonlinelibrary.com]

3.3. PTGS1 is targeted by naproxen

Ten genes related with naproxen are shown in Figure 3a. PTGS1 has been found to have a closely targeted relationship with naproxen. By using Venny 2.1.0, it was shown that PTGS1 is the intersection of hub genes in 19 modules and the genes that are targeted by naproxen (Figure 3b).

3.4. The effect of naproxen on PTGS1 expression in OA synovial cells and tissues

The results of qRT‐PCR and western blot illustrate that PTGS1 has higher expression level in OA synoviocytes and OA synovial tissues compared with the expression level in normal synoviocytes and tissues (Figure 4a,b). β‐actin was applied to normalize the expression level of PTGS1. However, its expression level is negatively correlated with the concentration of naproxen and the treatment time of naproxen. When treated with naproxen, the expression level of PTGS1 mRNA decreases along with the increasing concentration of naproxen (Figure 4c). What is more, the expression of PYGS1 also shows a significant decrease with the increase of treatment time (Figure 4d). When the concentration of naproxen increased to 50 and 100 μg/ml, the level of PTGS1 mRNA showed a considerable decrease (p < 0.05). After being treated with naproxen for 6 hr, the relative expression of PTGS1 mRNA showed an extreme decrease (p < 0.05). The expression levels of six OA‐related genes: LUBRICIN, MMP‐13, COX‐2, ACAN, COL2A1, and COL1A1 were analyzed through western blot and qRT‐PCR (Figure 4e). Upon comparing their expression levels between the untreated group and the naproxen treated group (100 μg/ml, 6 hr), we found that LUBRICIN, ACAN, COL2A1, and COL1A1 expression shows a significant increase (p < 0.05) whereas MMP‐13, and COX‐2 expression show significant decreases (p < 0.05) after being treated with naproxen (normalized with β‐actin expression level).

Figure 4.

Figure 4

Open in a new tab

Naproxen inhibited progression of OA by inhibiting the expression of PTGS1. (a,b) PTGS1 is highly expressed in OA synovial cells and tissues compared with normal synovial cells and tissues, the increase of expression level is significant (p < 0.05). (c,d) PTGS1 expression could be inhibited with the naproxen treatment, when the concentration of naproxen achieves 100 μg/ml, the expression level of PTGS1 decreases dramatically compared with the NC group (p < 0.05). In addition, treating with naproxen for 6 hr could decrease PTGS1 expression to the lowest level (p < 0.05). (e) Expression levels of six OA‐related genes: LUBRICIN, MMP‐13, COX‐2, ACAN, COL2A1, and COL1A1 in OA synovial cells treated with 100 μg/ml naproxen for 6 hr compared with the untreated group. The expression level of LUBRICIN shows a significant increase after being treated with naproxen whereas other two genes show obviously decreased expression level after being treated (p < 0.05). (* means p < 0.05 compared with NC group). COX‐2: cyclooxygenase‐1; MMP‐13: matrix metalloproteinase 13; NC: negative control; OA: osteoarthritis; PTGS1: prostaglandin‐endoperoxide synthase 1

3.5. Naproxen targets PTGS1 expression to regulate the migration, invasion, and apoptosis of OA synovial cells

Western blot assay was used to analyze the expression level of PTGS1, which illustrates that naproxen treatment will significantly decrease the expression of PTGS1 compared with the NC group (Figure 5a; p < 0.05). Whereas the transfected sh‐PTGS1 group showed a significant decrease in expression level compared with the sh‐control group (p < 0.05). The results have been verified by qRT‐PCR assay. In addition, the colony numbers of OA synovial cells in each field also illustrates a great fluctuation along with the alteration in the PTGS1 mRNA concentration (Figure 5b). The colony numbers in the sh‐PTGS1 group as well the naproxen treatment group descend dramatically compared with the sh‐control group (p < 0.05). The results above demonstrate that the treatment of naproxen does have an inhibition effect on PTGS1 expression. According to the results of the transwell migration and invasion assay, compared with the sh‐control group, the numbers of migration cells as well invasion cells in the sh‐PTGS1 group significantly decreased (Figure 5c; p < 0.05). The results of the naproxen group in two assays also show a similar decrease with the sh‐PTGS1 group (P < 0.05). The PTGS1+naproxen group expresses the similar number of migration and invasion cells with NC group because the effect of naproxen treatment offsets the influence of PTGS1 overexpression in OA synovial cells. Cell cytometry assay was used to examine the apoptosis rate of OA synovial cells (Figure 6a). We found that the apoptosis rate of cells in the sh‐PTGS1/naproxen group grows obviously compared with the sh‐control/NC group (p < 0.05), which verifies that the naproxen could inhibit the expression of PTGS1. The apoptosis rate of cells in PTGS1+naproxen group shows no significant alteration with the NC group, which further indicates that the naproxen could target PTGS1 expression in OA synovial cells.

Figure 5.

Figure 5

Open in a new tab

Naproxen inhibited proliferation, migration and invasion of OA synovial cells. (a,b) The expression of PTGS1 mRNA in sh‐PTGS1 group and naproxen group is decreased obviously (p < 0.05 compared with sh‐control group), but there is no significant difference in the expression level of PTGS1 between PTGS1+naproxen and NC groups. The colony numbers of cells illustrate the similar tendency along with the addition of naproxen. (c) Naproxen constrains OA synovial cell migration and invasion through downregulating PTGS1. (* means p < 0.05 compared with sh‐control group, # means p < 0.05 compared with pcDNA3.1 group, + means p < 0.05 compared with NC group). mRNA: messenger RNA; NC: negative control; OA: osteoarthritis; PTGS1: prostaglandin‐endoperoxide synthase 1 [Color figure can be viewed at wileyonlinelibrary.com]

Figure 6.

Figure 6

Open in a new tab

Naproxen promotes the apoptosis of OA synovial cells and constrains the expression of six OA‐related genes. (a) Naproxen promotes OA synovial cell apoptosis through downregulating PTGS1. (b–e) Naproxen constrains the expression of six OA‐related genes: LUBRICIN, MMP‐13, COX‐2, ACAN, COL2A1, and COL1A1. (* means p < 0.05 compared with sh‐control group, # means p < 0.05 compared with pcDNA3.1 group, + means p < 0.05 compared with NC group) COX‐2: cyclooxygenase‐1; MMP‐13: matrix metalloproteinase 13; NC: negative control; OA: osteoarthritis; PTGS1: prostaglandin‐endoperoxide synthase 1 [Color figure can be viewed at wileyonlinelibrary.com]

3.6. The expressions of LUBRICIN, MMP‐13, COX‐2, ACAN, COL2A1, and COL1A1 in OA synovial cells

The expression level of LUBRICIN, ACAN, COL2A1, and COL1A1 showed a significant increase in the sh‐PTGS1 group whereas a decrease in PTGS1 group when compared with the sh‐control/pcDNA3.1 group (p < 0.05; Figure 6b,e), which demonstrates that the attenuation of OA will suppress the expression of LUBRICIN, ACAN, COL2A1, and COL1A1. What is more, the naproxen treatment group also shows an overexpression of LUBRICIN, ACAN, COL2A1, and COL1A1 (p < 0.05). However, the results on MMP‐13 and COX‐2 are opposite to that of LUBRICIN. The overexpression of PTGS1 can aggravate OA and further stimulate the expression of MMP‐13 and COX‐2 (p < 0.05; Figure 6c–e). The transfected sh‐PTGS1 group showed a significant decrease of MMP‐13and COX‐2 expression (p < 0.05).

3.7. Naproxen's protection of articular cartilage in ACLT mice by reducing PTGS1 expression

By performing Safranin O and fast green staining, we noticed that proteoglycan shows a sharp decrease in the PTGS1 group whereas it quickly increases in the sh‐PTGS1 and naproxen group compared with the sh‐control/pcDNA3.1 group, showing the most significant alteration at 30 and 60 days after ACLT (Figure 7a). The results of HE staining method show that chondral calcification thickness has an increase in the PTGS1 group. Also, the chondrocytes showed signs of degeneration, but these symptom could be alleviated with naproxen treatment at 60 days after operation (Figure 7a). The results of OARSI scores of different groups at 30 or 60 days postoperation are shown in Figure 7b. It showed that the sh‐PTGS1 and naproxen groups get extremely low OARSI scores compared with the pcDNA3.1/NC group, which represent low cartilage degeneration (p < 0.05). The PTGS1 group shows the highest OARSI score compared with the pcDNA3.1 group (p < 0.05), whereas no significant difference could be found between the PTGS1+naproxen group and the NC group. Figure 7c–j showed that the expression of Lubricin, ACAN, COL2A1, and COL1A1 was suppressed significantly in the PTGS1 group, whereas the expression level of Lubricin, ACAN, COL2A1, and COL1A1 was increased obviously in the naproxen group (p < 0.05). The alternation in MMP‐13 and COX‐2 expression levels is opposite with the expression of Lubricin, and we found an obvious increase in the PTGS1 group and a significant decrease in the naproxen treatment group (p < 0.05). Western blot assay and qRT‐PCR were also used to measure the expression level of PTGS1 in the mice model, which illustrated that naproxen treatment would significantly decrease the expression of PTGS1 (compared with the NC group). The results of the mice model experiments were consistent with previous human synoviocytes studies in OA.

Figure 7.

Figure 7

Open in a new tab

Naproxen suppressed the progression of OA in mice model. Naproxen protects articular cartilage in ACLT mice by downregulating PTGS1. (a) Safranin O and fast green staining (top line results of 30‐day and 60‐day). Solid arrows represent cartilage degeneration and proteoglycan loss. Scale bar, 200 mm. The bottom of 30‐day and 60‐day is the results of HE staining method. The double‐headed arrows illustrate the thickness of CC and HC. Scale bar, 100 mm. (b) OARSI score at 30‐ and 60‐day postoperation. (c–i) The expression levels of Lubricin, MMP‐13, COX‐2, ACAN, COL2A1, and COL1A1 are evaluated by western blot and qRT‐PCR assays. (j) The expression of PTGS1 was measured by western blot and qRT‐PCR. (* means p < 0.05 compared with sh‐control group, # means p < 0.05 compared with pcDNA3.1 group, + means p < 0.05 compared with NC group). ACLT: anterior cruciate ligament transection; CC: calcified cartilage; COX‐2: cyclooxygenase‐1; HC: hyaline cartilage; MMP‐13: matrix metalloproteinase 13; NC: negative control; OA: osteoarthritis; PTGS1: prostaglandin‐endoperoxide synthase 1; qRT‐PCR: quantitative real‐time polymerase chain reaction [Color figure can be viewed at wileyonlinelibrary.com]

4. DISCUSSION

Recently, NSAIDs are commonly used to alleviate OA pain as well other related symptoms (Kean, Kean, & Buchanan, 2004). In this study, naproxen was selected as a therapeutic agent because it had been reported to be the least harmful in terms of side effects, which include fevers, menstrual cramps, arthritis, or even the risk of cardiovascular (Leung, Rainsford, & Kean, 2014). Therefore, the experiment subjects will not be affected by adverse effects to the maximum extent and the accuracy of our experiment data is credible. Our study mainly focuses on the target relationship between naproxen and PTGS1, the results of microarray assay illustrated that the overexpression of PTGS1 in OA synovial cells and the naproxen treatment inhibits the expression of PTGS1 and attenuates OA progression. The previous studies have analyzed the correlation between the concentration of naproxen and the activity response of PTGS1 and PTGS2 in vitro, which showed the inhibition effect of naproxen on PTGS1 and PTGS2 (Garcia Rodriguez, Tacconelli, & Patrignani, 2008). It suggests that naproxen could serve as a specific inhibitor of PTGS1.

The review of Ulrich, Bigler, and Potter (2006) pointed out that the specific inhibitors of PTGS2 might be less toxic than NSAIDs, which regulate both PTGS1 and PTGS2. It also has been reported that nonselective NSAIDs, such as naproxen, might cause ulceration of upper gastrointestine (Masso Gonzalez, Patrignani, Tacconelli, & Garcia Rodriguez, 2010). However, naproxen is not associated with cardiovascular risk; its long‐half life (>12 hr) and the complete and persistent inhibition of PTGS1 activity provide an optimal condition for OA therapy (Capone et al., 2007; Garcia Rodriguez et al., 2008). And in this way, we set several experiment groups treated with naproxen in different concentration or treated with naproxen for different times. The results showed that the higher the concentration of naproxen, the lower the expression level of PTGS1. In addition, the treatment time was also negatively proportional to the PTGS1 expression level. Our results above are consistent with the research of Garcia Rodriguez et al. (2008).

It has been demonstrated that the detection of COX‐2 could be considered as a marker of OA (Xu et al., 2018). Meanwhile, MMP‐13 is regarded as the leading collagenase that is expressed in OA cartilage (Akhtar, Makki, & Haqqi, 2015). ACAN, COL2A1, and COL1A1 present low expression in OA tissues (Sundman et al., 2014; Zhu, He, Wei, & Wang, 2018). In this study, LUBRICIN, MMP‐13, COX‐2, ACAN, COL2A1, and COL1A1 expression levels were determined in both human and ACLT mice models. LUBRICIN is secreted by several tissues, including synoviocytes, synovial fibroblasts, and meniscal cells (Cui et al., 2015). Some studies have illustrated that the expression of LUBRICIN is downregulated in OA mice models (Teeple et al., 2011), which supports our conclusion that the expression level of LUBRICIN was decreased extremely in PTGS1 groups (severe OA condition).

To measure if the bone modeling level could modify the cartilage metabolism, an ACLT mice model was used in our study. ACLT mice have been widely characterized and they express appropriate histological and biochemical alterations, are which correlated with OA progression (Wen et al., 2016). On the basis of the observations of the Safranin O and fast green staining method, we found that the thickness of chondral calcification increased when PTGS1 was overexpressed, but this condition could be alleviated with naproxen treatment at 60 days after operation. What is more, to verify the effects of PTGS1 overexpression on three OA‐related genes, we analyzed the expression levels of LUBRICIN, MMP‐13, COX‐2, ACAN, COL2A1, and COL1A1 in OA mice synovial cells. The results were almost the same with the previous experiment on human subjects and confirmed in human studies. However, there are still limitations in our study, the major pathological feature of OA is cartilage and bone degradation, the mechanism of OA in chondrocytes should be explored in further research. Also, there were many NSAIDs in the treatment of OA, for example, ibuprofen, naproxen, and celecoxib. In further studies, we may explore the mechanism of other NSAIDs in the treatment of OA.

Our data demonstrate that naproxen targets the expression of PTGS1 and promotes the apoptosis rate of OA synovial cells. The experiments in human and mice models provide an explanation for our findings that the expression of PTGS1 was significantly high in damaged cartilage and OA synovial cells, whereas the treatment of naproxen could suppress the high expression of PTGS1 in OA synovial cells. What is more, we measured the expression levels of LUBRICIN, MMP‐13, CoX‐2, ACAN, COL2A1, and COL1A1 to confirm the differential expression of PTGS1 and the positive effect of naproxen in patients with OA. In conclusion, our study suggests that PTGS1 might be explored as a novel therapeutic strategy for the treatment of OA.

ETHICS APPROVAL AND CONSENT TO PARTICIPATE

This study was authorized by Linyi People's Hospital, and written informed consents were obtained from all the participants.

CONFLICTS OF INTEREST

The authors declare that there are no conflicts of interest in this study.

Supporting information

Supporting information

JCP-234-12771-s001.docx (154KB, docx)

References

REFERENCES

  1. Akhtar, N. , Makki, M. S. , & Haqqi, T. M. (2015). MicroRNA‐602 and microRNA‐608 regulate sonic hedgehog expression via target sites in the coding region in human chondrocytes. Arthritis Rheumatol, 67(2), 423–434. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bruyère, O. , Cooper, C. , Pelletier, J. P. , Branco, J. , Luisa Brandi, M. , Guillemin, F. , … Reginster, J. Y. (2014). An algorithm recommendation for the management of knee osteoarthritis in Europe and internationally: A report from a task force of the European Society for Clinical and Economic Aspects of Osteoporosis and Osteoarthritis (ESCEO). Seminars in Arthritis and Rheumatism, 44(3), 253–263. [DOI] [PubMed] [Google Scholar]
  3. Capone, M. L. , Tacconelli, S. , Sciulli, M. G. , Anzellotti, P. , Di Francesco, L. , Merciaro, G. , … Patrignani, P. (2007). Human pharmacology of naproxen sodium. Journal of Pharmacology and Experimental Therapeutics, 322(2), 453–460. [DOI] [PubMed] [Google Scholar]
  4. Cui, Z. , Xu, C. , Li, X. , Song, J. , & Yu, B. (2015). Treatment with recombinant lubricin attenuates osteoarthritis by a positive feedback loop between articular cartilage and subchondral bone in ovariectomized rats. Bone, 74, 37–47. [DOI] [PubMed] [Google Scholar]
  5. Ekman, E. F. , Gimbel, J. S. , Bello, A. E. , Smith, M. D. , Keller, D. S. , Annis, K. M. , … Verburg, K. M. (2014). Efficacy and safety of intravenous tanezumab for the symptomatic treatment of osteoarthritis: 2 randomized controlled trials versus naproxen. Journal of Rheumatology, 41(11), 2249–2259. [DOI] [PubMed] [Google Scholar]
  6. Fan, H. W. , Liu, G. Y. , Zhao, C. F. , Li, X. F. , & Yang, X. Y. (2015). Differential expression of COX‐2 in osteoarthritis and rheumatoid arthritis. Genetics and Molecular Research, 14(4), 12872–12879. [DOI] [PubMed] [Google Scholar]
  7. García Rodríguez, L. A. , Tacconelli, S. , & Patrignani, P. (2008). Role of dose potency in the prediction of risk of myocardial infarction associated with nonsteroidal anti‐inflammatory drugs in the general population. Journal of the American College of Cardiology, 52(20), 1628–1636. [DOI] [PubMed] [Google Scholar]
  8. Holt, R. J. , Fort, J. G. , Grahn, A. Y. , Kent, J. D. , & Bello, A. E. (2015). Onset and durability of pain relief in knee osteoarthritis: Pooled results from two placebo trials of naproxen/esomeprazole combination and celecoxib. The Physician and Sportsmedicine, 43, 1–13. [PubMed] [Google Scholar]
  9. Ji, B. , Zhang, Z. , Guo, W. , Ma, H. , Xu, B. , Mu, W. , … Cao, L. (2018). Isoliquiritigenin blunts osteoarthritis by inhibition of bone resorption and angiogenesis in subchondral bone. Scientific Reports, 8(1), 1721. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Kean, W. F. , Kean, R. , & Buchanan, W. W. (2004). Osteoarthritis: Symptoms, signs and source of pain. Inflammopharmacology, 12(1), 3–31. [DOI] [PubMed] [Google Scholar]
  11. Knorth, H. , Dorfmüller, P. , Lebert, R. , Schmidt, W. E. , Wittenberg, R. H. , Heukamp, M. , … Willburger, R. E. (2004). Participation of cyclooxygenase‐1 in prostaglandin E2 release from synovitis tissue in primary osteoarthritis in vitro. Osteoarthritis and Cartilage, 12(8), 658–666. [DOI] [PubMed] [Google Scholar]
  12. Koog, Y. H. , Lee, J. S. , & Wi, H. (2014). Nonspecific adverse events in knee osteoarthritis clinical trials: A systematic review. PLoS One, 9(11), e111776. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Kuyinu, E. L. , Narayanan, G. , Nair, L. S. , & Laurencin, C. T. (2016). Animal models of osteoarthritis: Classification, update, and measurement of outcomes. Journal of Orthopaedic Surgery and Research, 11, 19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Lampropoulou‐Adamidou, K. , Lelovas, P. , Karadimas, E. V. , Liakou, C. , Triantafillopoulos, I. K. , Dontas, I. , & Papaioannou, N. A. (2014). Useful animal models for the research of osteoarthritis. European Journal of Orthopaedic Surgery & Traumatology, 24(3), 263–271. [DOI] [PubMed] [Google Scholar]
  15. Langfelder, P. , & Horvath, S. (2008). WGCNA: An R package for weighted correlation network analysis. BMC Bioinformatics, 9, 559. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Leung, G. J. , Rainsford, K. D. , & Kean, W. F. (2014). Osteoarthritis of the hand II: Chemistry, pharmacokinetics and pharmacodynamics of naproxen, and clinical outcome studies. Journal of Pharmacy and Pharmacology, 66(3), 347–357. [DOI] [PubMed] [Google Scholar]
  17. Li, Z. , Meng, D. , Li, G. , Xu, J. , Tian, K. , & Li, Y. (2016). Overexpression of microRNA‐210 promotes chondrocyte proliferation and extracellular matrix deposition by targeting HIF‐3alpha in osteoarthritis. Molecular Medicine Reports, 13(3), 2769–2776. [DOI] [PubMed] [Google Scholar]
  18. Litwic, A. , Edwards, M. H. , Dennison, E. M. , & Cooper, C. (2013). Epidemiology and burden of osteoarthritis. British Medical Bulletin, 105, 185–199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Ma, F. B. , Liu, N. , Hu, N. , Wen, C. Y. , & Tang, B. (2017). Synthesis of strontium chondroitin sulfate and the evaluation of its capability to attenuate osteoarthritis. Carbohydrate Polymers, 170, 217–225. [DOI] [PubMed] [Google Scholar]
  20. Mandal, P. , Kundu, B. K. , Vyas, K. , Sabu, V. , Helen, A. , Dhankhar, S. S. , … Mukhopadhyay, S. (2018). Ruthenium(ii) arene NSAID complexes: Inhibition of cyclooxygenase and antiproliferative activity against cancer cell lines. Dalton Transactions, 47(2), 517–527. [DOI] [PubMed] [Google Scholar]
  21. Massó González, E. L. , Patrignani, P. , Tacconelli, S. , & Rodríguez, L. A. G. (2010). Variability among nonsteroidal antiinflammatory drugs in risk of upper gastrointestinal bleeding. Arthtitis and Rheumatism, 62(6), 1592–1601. [DOI] [PubMed] [Google Scholar]
  22. McGettigan, P. , & Henry, D. (2011). Cardiovascular risk with non‐steroidal anti‐inflammatory drugs: Systematic review of population‐based controlled observational studies. PLoS Medicine, 8(9), e1001098. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. McGettigan, P. , & Henry, D. (2013). Use of non‐steroidal anti‐inflammatory drugs that elevate cardiovascular risk: An examination of sales and essential medicines lists in low‐, middle‐, and high‐income countries. PLoS Medicine, 10(2), e1001388. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Nagao, M. , Sato, Y. , & Yamauchi, A. (2013). A meta‐analysis of PTGS1 and PTGS2 polymorphisms and NSAID intake on the risk of developing cancer. PLoS One, 8(8), e71126. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Palazzo, C. , Nguyen, C. , Lefevre‐Colau, M. M. , Rannou, F. , & Poiraudeau, S. (2016). Risk factors and burden of osteoarthritis. Annals of Physical and Rehabilitation Medicine, 59(3), 134–138. [DOI] [PubMed] [Google Scholar]
  26. Pritzker, K. P. H. , Gay, S. , Jimenez, S. A. , Ostergaard, K. , Pelletier, J. P. , Revell, P. A. , … van den Berg, W. B. (2006). Osteoarthritis cartilage histopathology: Grading and staging. Osteoarthritis and Cartilage, 14(1), 13–29. [DOI] [PubMed] [Google Scholar]
  27. Sanders, D. , Krause, K. , O'Muircheartaigh, J. , Thacker, M. A. , Huggins, J. P. , Vennart, W. , … Howard, M. A. (2015). Pharmacologic modulation of hand pain in osteoarthritis: A double‐blind placebo‐controlled functional magnetic resonance imaging study using naproxen. Arthritis & Rheumatology, 67(3), 741–751. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Shui, X. L. , Lin, W. , Mao, C. W. , Feng, Y. Z. , Kong, J. Z. , & Chen, S. M. (2017). Blockade of IL‐17 alleviated inflammation in rat arthritis and MMP‐13 expression. European Review for Medical and Pharmacological Sciences, 21(10), 2329–2337. [PubMed] [Google Scholar]
  29. Smith, M. M. , Russell, A. K. , Schiavinato, A. , & Little, C. B. (2013). A hexadecylamide derivative of hyaluronan (HYMOVIS(R)) has superior beneficial effects on human osteoarthritic chondrocytes and synoviocytes than unmodified hyaluronan. Journal of Inflammation (London, England), 10, 26. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Sundman, E. A. , Cole, B. J. , Karas, V. , Della Valle, C. , Tetreault, M. W. , Mohammed, H. O. , & Fortier, L. A. (2014). The anti‐inflammatory and matrix restorative mechanisms of platelet‐rich plasma in osteoarthritis. American Journal of Sports Medicine, 42(1), 35–41. [DOI] [PubMed] [Google Scholar]
  31. Teeple, E. , Elsaid, K. A. , Jay, G. D. , Zhang, L. , Badger, G. J. , Akelman, M. , … Fleming, B. C. (2011). Effects of supplemental intra‐articular lubricin and hyaluronic acid on the progression of posttraumatic arthritis in the anterior cruciate ligament‐deficient rat knee. American Journal of Sports Medicine, 39(1), 164–172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Tuleja, E. , Mejza, F. , Cmiel, A. , & Szczeklik, A. (2003). Effects of cyclooxygenases inhibitors on vasoactive prostanoids and thrombin generation at the site of microvascular injury in healthy men. Arteriosclerosis, Thrombosis, and Vascular Biology, 23(6), 1111–1115. [DOI] [PubMed] [Google Scholar]
  33. Ulrich, C. M. , Bigler, J. , & Potter, J. D. (2006). Non‐steroidal anti‐inflammatory drugs for cancer prevention: Promise, perils and pharmacogenetics. Nature Reviews Cancer, 6(2), 130–140. [DOI] [PubMed] [Google Scholar]
  34. Waller, B. , Ogonowska‐Slodownik, A. , Vitor, M. , Lambeck, J. , Daly, D. , Kujala, U. M. , & Heinonen, A. (2014). Effect of therapeutic aquatic exercise on symptoms and function associated with lower limb osteoarthritis: Systematic review with meta‐analysis. Physical Therapy, 94(10), 1383–1395. [DOI] [PubMed] [Google Scholar]
  35. Wen, Z. H. , Tang, C. C. , Chang, Y. C. , Huang, S. Y. , Lin, Y. Y. , Hsieh, S. P. , … Jean, Y. H. (2016). Calcitonin attenuates cartilage degeneration and nociception in an experimental rat model of osteoarthritis: Role of TGF‐beta in chondrocytes. Scientific Reports, 6, 28862. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Xia, B. , Di, C. , Zhang, J. , Hu, S. , Jin, H. , & Tong, P. (2014). Osteoarthritis pathogenesis: A review of molecular mechanisms. Calcified Tissue International, 95(6), 495–505. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Xu, K. , Ma, C. , Xu, L. , Ran, J. , Jiang, L. , He, Y. , … Wu, L. (2018). Polygalacic acid inhibits MMPs expression and osteoarthritis via Wnt/beta‐catenin and MAPK signal pathways suppression. International Immunopharmacology, 63, 246–252. [DOI] [PubMed] [Google Scholar]
  38. Zhang, W. , Moskowitz, R. W. , Nuki, G. , Abramson, S. , Altman, R. D. , Arden, N. , … Tugwell, P. (2008). OARSI recommendations for the management of hip and knee osteoarthritis, Part II: OARSI evidence‐based, expert consensus guidelines. Osteoarthritis and Cartilage, 16(2), 137–162. [DOI] [PubMed] [Google Scholar]
  39. Zhu, J. K. , He, T. D. , Wei, Z. X. , & Wang, Y. M. (2018). LncRNA FAS‐AS1 promotes the degradation of extracellular matrix of cartilage in osteoarthritis. European Review for Medical and Pharmacological Sciences, 22(10), 2966–2972. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supporting information

JCP-234-12771-s001.docx (154KB, docx)

Articles from Journal of Cellular Physiology are provided here courtesy of Wiley

RESOURCES