Skip to main content
NCBI home page
Wiley Open Access Collection logoLink to Wiley Open Access Collection
. 2018 Dec 24;234(8):13145–13156. doi: 10.1002/jcp.27985

The effects of CCR7 and related signaling pathways on Leishmania major ‐infected human dendritic cells

Yumin Zhao 1, Zhisheng Dang 2, Riming Wei 3, Weifeng Gui 1, Yishu Zhang 1, Shigui Chong 4,✉
PMCID: PMC13483333  PMID: 30584667

Abstract

Objectives

In our research, we aimed to investigate the roles of CC‐chemokine receptor 7 (CCR7) and relevant signaling pathways in Leishmania major‐infected human dendritic cells (DCs).

Methods

Differentially expressed genes (DEGs) in L. major‐infected human DCs were selected out and visualized using R program. Kyoto Encyclopedia of Genes and Genomes pathway analysis was conducted for investigation of significantly enriched signaling pathways and Gene Ontology enrichment analysis was carried out for the unveiling of enriched Molecular Functions and Biological Processes in L. major‐infected human DCs. Besides, Hub gene was screened out using weighted gene coexpression network analysis and Cytoscape. In addition, enzyme‐linked immunosorbent assay and real‐time quantitative polymerase chain reaction were used for detection of relative expression of CCR7, interleukin‐12 (IL‐12), and interferon‐γ (IFN‐γ) in L. major‐infected human DCs and western blot analysis was used for detection of relative expression of CCR7 and other proteins in JAK‐STAT signaling pathway in L. major‐infected human DCs.

Results

CCR7 was upregulated and both chemokine and JAK‐STAT signaling pathway were activated in L. major‐infected human DCs. During the L. major infection, total number of L. major‐infected human DCs were increased, as well as the relative expression levels of CCR7, IL‐12, and IFN‐γ and proteins in the JAK‐STAT signaling pathway. Overexpression of CCR7 not only increased expression levels of IL‐12 and IFN‐γ but also activated the JAK‐STAT signaling pathway to affect the leishmaniasis progression.

Conclusion

L. major infection‐induced activation of CCR7, as well as JAK2 and STAT1, might well upregulate the expression of BAX yet suppress the expression of both Bcl2 and c‐Jun to affect leishmaniasis progression.

Keywords: CCR7, human dendritic cells, JAK‐STAT signaling pathway, Leishmania major

1. Our study showed that CCR7 was up‐regulated and both chemokine and JAK‐STAT signaling pathways were activated in Leishmaniasis. 2. Down‐regulation of CCR7 and inactivation of JAK‐STAT signaling pathway may suppress Leishmaniasis progression in the future.

graphic file with name JCP-234-13145-g005.jpg

1. INTRODUCTION

Leishmaniasis is a complex vector‐borne disease caused by heteroxenous protozoan parasites of the genus and influences around 12 million people primarily in developing countries (Gutierrez‐Corbo et al., 2017). According to the location of the parasite in mammalian tissues, leishmaniasis has four main clinical forms, visceral leishmaniasis (VL), cutaneous leishmaniasis, diffuse cutaneous leishmaniasis, and mucocutaneous leishmaniasis (Saha, Basu, & Ukil, 2018). The parasite is spread through sandfly vectors, inoculating the promastigote forms into the human host. They are taken in by macrophages and then transformed into the obligate intracellular amastigotes. Thereafter, other phagocytes are infected (Wright et al., 2015). Parasite visceralization from the skin to internal organs is likely to be mediated by migratory infected myeloid cells. Therefore, the development of targeted antileishmaniasis drugs against the mononuclear phagocytic system of the infected host could be a plausible strategy against leishmaniasis.

Previous reports showed that it was necessary for antigen‐specific naive T cells to physically interact with antigen presenting cells (APCs) to generate antigen‐specific immune response (Pereira‐Carvalho et al., 2013). Besides, antigen presentation is an important immune process which is vital to trigger T cell immune response (Ato et al., 2006). CC‐chemokine receptor 7 (CCR7) is widely expressed in naive and memory T cells and APCs, and has essential effects in this progression (Kling, Mack, & Korner, 2013). In spite of the core function of CCR7, it has been reported that protective immune responses is triggered in CCR7‐deficient models and that the magnitude to the role of CCR7 has oppositely proportional relation to the number of antigens which starts the response (Ato, Stager, Engwerda, & Kaye, 2002). However, the functions of CCR7 in leishmaniasis progression remained to be further understood.

Protein tyrosine kinases in Janus kinase (JAK) family were constitutively associated with many cytokine receptors (Beringer, Thiam, Molle, Bartosch, & Miossec, 2018) and enhanced by cytokine stimulation in some cases the association. The combination of a ligand and its receptor rapidly activated those associated JAK proteins, leading to tyrosine‐phosphorylation of receptors and subsequent generation of docking sites for other molecules which included transcription factors (signal transducer and activator of transcription [STAT]) and phospholipase C or the signaling transducer and activator (Soldevila et al., 2004). Chemokines signal through seven‐transmembrane G protein‐coupled receptors (GPCR) that activate a Gi protein (Soriano et al., 2003). Previous results showed that chemokines triggered receptor dimerization, followed by association and activation of JAK proteins, which suggested that JAK played a significant role in chemokine responses (Soriano et al., 2003). Our study was aimed to further investigate the roles of the JAK‐STAT signaling pathway in leishmaniasis.

The potential roles of CCR7, as well as the JAK‐STAT signaling pathway, were investigated in this study, based on which, we expected to find out a new method to treat leishmaniasis.

2. MATERIALS AND METHODS

2.1. Differential gene expression analysis

Microarray data of messenger RNA (mRNA) expression profile was obtained from Gene Expression Ominbus (https://www.ncbi.nlm.nih.gov/geo/). The series accession number was GSE42088 and matched platform was GPL570. Besides, Benjamini‐Hochberg method was used to calculate the false discovery rate (FDR) in R program. In brief, data was filtered out and normalized for selecting out differentially expressed mRNAs with screening criteria FDR < 0.05 and |log2 fold change| > 1 using limma package. Top differentially expressed genes (DEGs) were selected out and visualized using R program. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis was carried out for investigation of significantly enriched signaling pathways and Gene Ontology (GO) enrichment analysis was conducted for unveiling of enriched Molecular Functions and Biological Processes in Leishmania major‐infected human dendritic cells (DCs) using genome set enrichment analysis (GSEA; Version 3.0; Broad Institute, Cambridge, MA) in this study. Dotplot and joyplot for GSEA result were established using R project with both “ggplot2” and “easygplot2” packages.

2.2. Weighted gene coexpression network analysis (WGCNA) and identification of hub genes

WGCNA was conducted to unveil L. major infection‐associated gene modules for expression profiling of L. major‐infected human DCs. A gene module was a collection of genes with high topological similarity. In brief, L. major‐infected human DCs included a selected maximum variance of 1,060 genes. To create an almost scale‐free network, soft threshold power needed to be set to 20 according to the network topology. Gene coexpression adjacency matrices were calculated and converted to topological overlap matrix (TOM). In this study, gene modules were selected out from dendrogram which was established based on DEGs. To screen out specific modules Z summary = (Z density + Z connectivity)/2 was adopted as screening criteria. Modules with Z summary < 10 were preserved in leishmaniasis groups. Module membership (MM) reflected the significance of a gene within its module and MM with the highest correlation coefficient was considered to be significantly associated with Leishmania infection. Hub genes are those genes which could exert most significant effects on the total network. In general, they are highly connected with their modules and correlated with other genes in the same modules. In this study, scatter plots of gene significance (GS; reflecting the correlation of gene expression) relative to MM for genes which were grouped by module color were plotted with hub genes highlighted. Thereafter, the coexpression network of the selected module was plotted using Cytoscape 3.5.1 (http://www.cytoscape.org/).

2.3. Clinical specimens

Peripheral blood was obtained from 10 healthy human donors kindly supplied by the blood bank of the Affiliated Hospital of Guilin Medical University in this study. All specimens were frozen immediately and preserved at −80°C in liquid nitrogen. All of the healthy human donors signed informed consents, and our research was approved by the Clinical Research Ethics Committee of Affiliated Hospital of Guilin Medical University.

2.4. Generation of monocyte‐derived DCs

Mononuclear cells were isolated from peripheral blood of healthy human donors using a Ficoll density gradient according to the protocol by Boyum (1983). Thereafter, pureness of the monocyte culture was enhanced to about 97% by adhesion on γ globulin‐coated Roswell Park Memorial Institute (RPMI) 1640 complete medium (10% fetal bovine serum [FBS], 2 mM l‐glutamine, 100 U/ml and 1% penicillin/streptomycin) as suggested by Nickel et al. (2011). It was noteworthy that DCs were generated from this monocyte culture with granulocyte‐macrophage colony‐stimulating factor, granulocyte macrophage stem cell factor (1000 U/ml; PeproTech, Rocky Hill, NJ), and recombinant human interleukin‐4 (IL‐4; 40 U/ml; PeproTech) stimulation according to our previous report (Weis, Schlichting, Engleman, & Cooke, 2002). In addition, the stimulation was started between 4th and 5th day of DC cultivation. This time period was chosen as the most DCs are immature at this crucial time point and started to differentiate into mature DCs or back to monocytes. To remove any residual cytokines, cells were harvested and washed 1 day before infection.

2.5. Plasmid construction and cell transfection

Short hairpin RNA (shRNA) negative control (NC) and sh‐CCR7 were purchased from GenePharma Co., Ltd. (Shanghai, China). In brief, shRNAs were loaded into the PENTR/U6™ vector (Invitrogen, Carlsbad, CA) and introduced into DCs using Lipofectamine 2000 (Invitrogen, Carlsbad, CA). pcDNA3.1 and pcDNA3.1‐CCR7 were synthesized by GenePharma as well. Before plasmid transfection, DCs were suspended and seeded in six‐well culture plates at 37℃. When cell confluence rate reached 80–90%, cell culture media should be replaced by serum‐free fresh medium 3 hr before transfection.

2.6. Parasite growth, preparation of soluble Leishmania antigen (SLA), and L. major infection

Promastigotes of L. major strain FV1 (MHOM/IL/80/Friedlin) were cultured at 26° in RPMI medium (Life Technologies, Carlsbad, CA) supplemented with 10% FBS (Life Technologies), 0.1 mg/ml streptomycin sulfate, and 100 U/ml penicillin G. This strain was obtained from World Health Organisation reference center for leishmaniasis, Instituto de Salud Carlos III (Madrid, Spain). Promastigotes were used for infection after one to three passages in vitro. Infective‐stage metacyclic promastigotes were isolated from stationary cultures (4–5 days old) by negative selection of noninfective forms using peanut agglutinin (Vector Laboratories, Burlingame, CA) as described by Sacks et al. (1985). SLA was prepared from log‐phase promastigotes (approximately 108 parasites/ml). In brief, L. major promastigotes were harvested from culture and washed four times in phosphate‐buffered saline (PBS). Afterward, the parasites were suspended in PBS and subjected to three freezing and thawing cycles and sonicated with six cycles of 30 s at 40 MHz. After cell lysis, soluble antigens were separated from the insoluble fraction by centrifugation for 15 min at 12,000g using a microcentrifuge. Protein concentration was assessed by the BCA protein assay kit (Thermo Fisher Scientific, Rockford, IL). DCs were infected at a concentration of 10 parasites per DC and the cocultures of L. major‐infected human DCs were harvested at 2, 4, 8, and 24 hr post infection. Slides were prepared at the conclusion of each experiment, Diff‐Quick stained (Thermo Fischer Scientific, Pittsburgh, PA) and visualized using light microscopy. For each infection sample, infection percentages (%DCs infected) were determined by counting the number of uninfected versus infected DCs (100 total). The parasite index was determined by counting the total number of intracellular parasites per 100 cells.

2.7. RNA extraction and real‐time quantitative polymerase chain reaction (qRT‐PCR)

Total RNA was extracted from DCs using TRIzol reagent (Invitrogen) according to manufacturer’s instructions. Thereafter, RNAs were subjected to DNase I digestion at 37℃ for 30 min and measured using a ND‐100 NanoDrop spectrophotometer (Nano drop Technologies, Thermo Sientific, Wilmington, DE). A total of 500 ng RNA was reversely transcripted into complementary DNA (cDNA) using SuperScript III reverse transcriptase kit (Invitrogen) and oligo(dT)20 primers. QRT‐PCR was carried out using SYBR Green Chemistry (Kapa, Wilmington, MA). The relative expression levels of mRNA were calculated using 2−ΔΔCt method, and glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) was utilized as the internal loading control. Primers for qRT‐PCR in this study were all enlisted in Table 1.

Table 1.

Primer sequences for real‐time quantitative polymerase chain reaction

Genes Sequences
CCR7 F: 5′‐TTTTCCAGGTGTGCTTCTGCC‐3′
R: 5′‐ACGCCGATGAAGGCATACAA‐3′
GAPDH F: 5′‐GGAAAGCTGTGGCGTGAT‐3′
R: 5′‐AAGGTGGAAGAATGGGAGTT‐3′
Open in a new tab

Note. F: forward; GADPH: glyceraldehyde 3‐phosphate dehydrogenase; R: reverse.

2.8. Cytokine enzyme‐linked immunosorbent assay (ELISA)

Levels of IL‐12 and interferon‐γ (IFN‐γ; Mabtech, Nacka, Sweden) in cell culture supernatants were measured by sandwich ELISA according to the manufacturer’s guidelines. All samples were tested in duplicates, and the optical density was measured with an ELISA plate reader (Vmax™ Kinetic Microplate Reader, Menlo Park, Molecular Devices, Sunnyvale, CA).

2.9. Protein isolation and western blot analysis

Total proteins were isolated using radioimmunoprecipitation assay buffer and protein concentration was determined using BCA protein assay kit (Thermo Fischer Scientific). Thereafter, protein samples were subjected to 10% sodium dodecyl sulfate polyacrylamide gel (10% polyacrylamide) ran for 4 hr. Gel‐separated proteins were subsequently transferred to polyvinylidene difluoride membrane (Millipore, Billerica, MA), and exposed to 5% nonfat milk overnight incubation with rabbit polyclonal anti‐CCR7 (ab191575; 1:10,000; Abcam), rabbit polyclonal anti‐pJAK2 (ab195055; 1:500; Abcam), rabbit polyclonal anti‐JAK2 (ab39636; 1:1,000; Abcam, Cambridge, Cambs, UK), rabbit polyclonal anti‐pSTAT1 (ab30645; 1:1,000; Abcam), rabbit polyclonal anti‐STAT1 (ab31369; 1:1,000; Abcam), rabbit polyclonal anti‐BAX (ab53154; 1:1,000; Abcam), rabbit polyclonal anti‐Bcl2 (ab196495; 1:2,000; Abcam), rabbit polyclonal anti‐c‐Jun (ab31419; 1:1,000; Abcam), rabbit polyclonal anti‐p‐c‐Jun (ab30620; 1:1,000; Abcam), and rabbit polyclonal anti‐GAPDH (ab9485; 1:2,500; Abcam) at 4℃. Afterward, membranes were washed by tris‐buffered saline three times and then incubated with second antibody horseradish peroxidase‐conjugated goat‐antirabbit IgG (ab205718; 1:2,000; Abcam) for about 3.5 hr. The internal loading control for this study was rabbit anti‐GAPDH (1:2,500; ab9485; Abcam). Protein bands were revealed using ECL Western Blotting Detection Kit (GE Healthcare, Amersham, UK). Alpha Innotech digital imaging system (Shanghai, China) was used for data quantifying and visualization.

2.10. Flow cytometry analysis

Flow cytometry analysis for detection of DC‐associated marker CD1a+ and CD11c+ were conducted to confirm homogenous populations of immature DCs. DCs were infected in a concentration of 10 parasites per 1 DC. Stably infected cells were resuspended in 150 μl of staining buffer (eBioscience, San Diego, CA) containing 1% FBS. After incubation with primary anti‐CD1a (ab212980; 1:1,000; Abcam) and anti‐CD11c (ab206933; 1:1,000; Abcam) for 45 min, cells were washed and centrifuged. Cells resuspended in 0.5 ml of 2% formaldehyde fixation buffer were analyzed using FlowJo software and BD FAC‐SCanto II flow cytometer (BD Biosciences, San Jose, CA).

2.11. Cell migration assay

Cell migration rate in this study was measured using Transwell chamber assay (8 µm; Millipore). In brief, DCs were digested and resuspended 48 hr after transfection. A total of 2 × 105 cells in about 250 μl serum‐free medium was added to the upper chamber of transwell plates (Sigma‐Aldrich, St. Louis, MO). Furthermore, total volume of 500 μl medium was added into the lower chamber. After cultivation for 24 hr, cells on the upper chamber were washed using PBS, while migrated cells in the lower chamber were washed and fixed with formaldehyde for about 30 min. Take pictures of each room and count 5–10 independent fields using an optical microscope.

2.12. Statistical analysis

Data were presented as mean ± standard deviation in this study. GraphPad Prism 6.0 (GraphPad Software, Inc., San Diego, CA) and WGCNA software package were used for statistical analysis in this study. The Student t test and one‐way analysis of variance were used to determine the statistical significance of the comparison between two or more groups. P < 0.05 was considered to be statistically significant.

3. RESULTS

3.1. CCR7 was upregulated and both chemokine and JAK‐STAT signaling pathways were activated in L. major ‐infected human DCs

Previous results showed that chemokine and JAK‐STAT signaling pathways were closely related with leishmaniasis progression (Fernandez‐Figueroa et al., 2016; Saha et al., 2014). In this study, DEGs in JAK‐STAT and chemokine signaling pathways in L. major‐infected human DCs were filtered out, top seven of which were visualized in heat map in Figure 1a,b, respectively. Among them, CCR7 showed a robust increase in L. major‐infected human DCs compared with uninfected human DCs. In addition, gseaplot result showed that chemokine and JAK‐STAT signaling pathways were greatly activated in L. major‐infected human DCs as shown in Figure 1c,d. According to the KEGG website (http://www.kegg.jp/kegg/pathway.html), chemokine and the JAK‐STAT signaling pathway are functionally linked with each other and Figure 1e showed their intrinsic correlations. In addition, GO analysis revealed that both JAK‐STAT and chemokine signaling pathways were significantly upregulated in the L. major‐infected human DCs as shown in Figure 2a. Besides, those biological processes related to the inflammatory response and the cytokine activity were significantly upregulated in the L. major‐infected human DCs as revealed in Figure 2b. Furthermore, joyplot and dotplot were used for better visualization of GSEA result, including significantly enriched signaling pathways and biological processes in L. major‐infected human DCs. Jotplot and doyplot of significantly enriched signaling pathways were established in Figure 2c,d, which showed that both JAK‐STAT and chemokine signaling pathways were activated in L. major‐infected human DCs. As shown in Figure 2e, the majority of methylation and RNA splicing‐related biological processes were suppressed in L. major‐infected human DCs. In addition, inflammatory and immune defense‐related biological processes were enriched in L. major‐infected human DCs as shown in Figure 1f. In short, CCR7 was upregulated and both chemokine and JAK‐STAT signaling pathways were activated in L. major‐infected human DCs.

Figure 1.

Figure 1

Open in a new tab

Microarray analysis and enrichment analysis. (a) Heat map of DEGs in the chemokine signaling pathway. (b) Heat maps of DEGs in the JAK‐STAT signaling pathway. Red indicated upregulated genes and green indicated downregulated genes. (c, d) Gseaplot for chemokine and JAK‐STAT signaling pathway. (e) Relative relationship between chemokine signaling pathway and JAK‐STAT signaling pathway. DEG: differentially expressed gene; JAK: Janus kinase; STAT: signal transducer and activator of transcription [Color figure can be viewed at wileyonlinelibrary.com]

Figure 2.

Figure 2

Open in a new tab

KEGG pathway analysis and GO enrichment analysis. (a) Top seven significantly enriched signaling pathways by GO enrichment analysis. (b) Top seven significantly enriched BPs by GO enrichment analysis. (c, d) Dotplot and joyplot of significantly enriched signaling pathways. (e, f) Dotplot and joyplot of significantly enriched BPs. BP: Biological Process; GO: Gene Ontology; KEGG: Kyoto Encyclopedia of Genes and Genomes [Color figure can be viewed at wileyonlinelibrary.com]

3.2. Coexpression module construction by WGCNA and identification of hub genes

WGCNA not only captured the coexpression coefficients between genes but also identified the contents of coexpressed gene partners to determine the similarity between genes. A TOM was calculated based on the total number of shared “‘friends”’ (interacting partners) between any pairs of coexpressed genes and the adjacent coefficient. Furthermore, module identification was performed using agglomerative hierarchical clustering‐based TOM to determine assembled coexpressed genes with specific functions. In WGCNA, cluster dendrogram was established based on DEGs as shown in Figure 3a. Branches of this dendrogram represented the interconnection of these DEGs that were categorized into six gene modules and distinguished by different colors correspondingly. In all modules, Zsummary statistics were adopted to test their module stability. The module will be eliminated if its Zsummary is greater than 10. In six modules, scatter plots of GS relative to MM were plotted. Based on those plots, nicotinamide phosphoribosyltransferase (brown), metallothionein 2A (red), CCR7 (blue), C‐C motif chemokine ligand 5 (CCL5; yellow), DNA methyltransferase 1 (turquoise), and caspase 6 (green) could be selected as the hub genes of those six modules as shown in Figure 3b. Furthermore, coexpression network of the blue module which contained CCR7 was plotted using Cytoscape software. Genes which were upregulated in L. major‐infected human DCs were represented in red, while genes downregulated in L. major‐infected human DCs were represented in green. Figure 3c indicated that CCR7 was greatly upregulated in L. major‐infected human DCs and located in the central part of this module, which further confirmed its role of a hub gene.

Figure 3.

Figure 3

Open in a new tab

Coexpression module construction by WGCNA and identification of hub genes. (a) Cluster dendrogram based on all DEGs. (b) The hub genes in the six modules were identified separately. (c) Global view of the protein‐protein interaction network. The nodes in red color were upregulated and the nodes in green color were downregulated. CCL5: C‐C motif chemokine ligand 5; CCR7: CC‐chemokine receptor 7; DEG: differentially expressed gene; DNMT1: DNA methyltransferase 1; MT2A: metallothionein 2A; NAMPT: nicotinamide phosphoribosyltransferase; WGCNA: weighted gene coexpression network analysis [Color figure can be viewed at wileyonlinelibrary.com]

3.3. The expression of CCR7 and immune‐related cytokines were increased in L. major‐infected human DCs

First, L. major‐infected human DCs were prepared and observed with an optical microscope using Diff‐Quick staining (Thermo Fisher Scientific). The percentage of L. major‐infected human DCs in all infected samples and parasite index (parasites/100 cells) were increased in a time‐dependent manner as shown in Figure 4a,b. Thereafter, identity of DC cells was detected using flow cytometry and the total number of DC cells was counted in 2, 4, 8, and 24 hr, respectively. QRT‐PCR results showed that the expression levels of both CD1a+ and CD11c+ were gradually increased over time, which was in line with the result by Zhou et al. (2018). Furthermore, the percentage of L. major‐infected human DCs was increased continuously in a time‐dependent manner as shown in Figure 4c. In addition, the expression levels of IL‐12 and IFN‐γ were tested using ELISA at 2, 4, 8, and 24 hr, respectively. The results indicated that the expression levels of IL‐12 and IFN‐γ were gradually increased over time (Figure 4d,e). Subsequently, to determine whether CCR7 expression level was associated with L. major infection, the expression of CCR7 in L. major‐infected human DCs was detected. QRT‐PCR result indicated that the expression level of CCR7 was upregulated in a time‐dependent manner, which was in line with the result of western blot analysis as shown in Figure 4f. Besides, relative expression levels of JAK‐STAT signaling pathway‐associated protein JAK2, STAT1, bcl2‐associated x protein (BAX), B‐cell lymphoma 2 (Bcl2), and c‐Jun were measured at different time periods using western blot analysis. Results of western blot analysis revealed that the expression levels of phosphorylated form of JAK2 and STAT1 and BAX were gradually increased over time, while the expression levels of Bcl2 and active c‐Jun were increased in a time‐dependent manner (Figure 4g). Taken together, overexpression of CCR7, as well as activation of the JAK‐STAT signaling pathway may affect leishmaniasis progression by upregulating the expression of JAK2, STAT1, and BAX yet downregulating the expression of Bcl2 and c‐Jun.

Figure 4.

Figure 4

Open in a new tab

The expression of CCR7 and immune‐related cytokines were increased in Leishmania major ‐infected human DCs. For each infection time point (2, 4, 8, and 24 hr), the percentage of infected cells (%DC infected) (a) and the parasite index (number of parasites/100 cells) (b) are presented. Mean values of individual donors 6 SD are presented. (c) DC cells were identified using flow cytometer and the total number of L. major‐infected human DCs for each infection time point was given (2, 4, 8, and 24 hr). (d) ELISA showed IL‐12 expression levels at each infection time point (2, 4, 8, and 24 hr). (e) ELISA showed IFN‐γ expression levels at each infection time point (2, 4, 8, and 24 hr). (f) qRT‐PCR and western blot analysis showed CCR7 expression levels at each infection time point (2, 4, 8, and 24 hr). (g) Western blot analysis detected the expression level of proteins at each infection time point (2, 4, 8, and 24 hr). *p < 0.05, two‐way analysis of variance, Bonferroni multiple comparisons post test. Bcl2: B‐cell lymphoma 2; BAX: bcl2‐associated x protein; CCR7: CC‐chemokine receptor 7; DC: dendritic cell; ELISA: enzyme‐linked immunosorbent assay; GAPDH: glyceraldehyde 3‐phosphate dehydrogenase; IFN‐γ: interferon‐γ; JAK: Janus kinase; IL‐12: interleukin‐12; qRT‐PCR: real‐time quantitative polymerase chain reaction; STAT: signal transducer and activator of transcription [Color figure can be viewed at wileyonlinelibrary.com]

3.4. Overexpression of CCR7 exacerbated L. major infection and further activated JAK‐STAT signaling pathway

QRT‐PCR was used for detection of transfection efficiency. QRT‐PCR results indicated that the mRNA expression level of CCR7 was greatly increased with overexpression of CCR7, which could be instead downregulated with sh‐CCR7. Western blot analysis showed the similar result as shown in Figure 5a. Cell migration assay was used for detection of cell migration ability in four groups. The result of cell migration assay showed that overexpression of CCR7 enhanced cell migration, which could be otherwise suppressed with knockdown of CCR7 (Figure 5b). In addition, the expression levels of IL‐12 and IFN‐γ were also measured for further validation of their regulatory relationships. QRT‐PCR result showed that overexpression of CCR7 could upregulate the expression levels of both IL‐12 and IFN‐γ, which were instead decreased with the silence of CCR7 as shown in Figure 5c,d. Result of western blot analysis indicated that upregulation of CCR7 increased the protein expression levels of active JAK2 and STAT1 and BAX, which were instead downregulated with knockdown of CCR7. In addition, upregulation of CCR7 decreased the protein phosphorylatedexpression levels of active c‐Jun and Bcl2, which were instead upregulated with the silence of CCR7 (Figure 5e). In addition, upregulation of CCL5 or C‐X‐C motif chemokine ligand 10 (CXCL10) greatly upregulated the expression phosphorylated‐JAK2 (p‐JAK2). In addition, sh‐CCR7 significantly downregulated the expression of p‐JAK2, which could be rescued to normal expression level with overexpression of CCL5 or CXCL10. Above all, blockade of CCR7 could be compensated by CCL5 or CXCL10 overexpression in the JAK‐STAT signaling pathway (Figure 5f). Taken together, overexpression of CCR7 exacerbated L. major infection and further activated JAK‐STAT signaling pathway.

Figure 5.

Figure 5

Open in a new tab

Overexpression of CCR7 exacerbated Leishmania infection and further activated JAK‐STAT signaling pathway. (a) The relative mRNA expression level and protein expression levels of CCR7 were measured using qRT‐PCR and western blot analysis. (b) Cell migration ability of DCs was measured in four groups. (c, d) Relative expression levels of IL‐12 and IFN‐γ were measured in four groups. (e) The expression levels of proteins in JAK‐STAT signaling pathway were measured using western blot analysis. (f) Blockade of CCR7 could be compensated by CCL5 or CXCL10 overexpression in the JAK‐STAT signaling pathway. *p < 0.05 indicated statistical significance compared with NC group. CCL5: C‐C motif chemokine ligand 5; CCR7: CC‐chemokine receptor 7; CXCL10: C‐X‐C motif chemokine ligand 10; DC: dendritic cell; IFN‐γ: interferon‐γ; JAK: Janus kinase; qRT‐PCR: real‐time quantitative polymerase chain reaction; STAT: signal transducer and activator of transcription

4. DISCUSSION

In our study, we aimed to figure out the effect of CCR7 and related signaling pathways on the leishmaniasis progression. Chemokine and JAK‐STAT signaling pathways were both activated in L. major‐infected human DCs based on GSEA. Furthermore, the percentage of L. major‐infected human DCs in all infected samples and parasite index was increased in a time‐dependent manner. In addition, overexpression of CCR7 exacerbated L. major infection and further activated JAK‐STAT signaling pathway. Taken together, overexpression of CCR7, as well as activation of the JAK‐STAT signaling pathway, may affect leishmaniasis progression by upregulating the expression of JAK2, STAT1, and BAX yet downregulating the expression of Bcl2 and c‐Jun.

Chemokines or chemotactic cytokines were a group of small, secreted molecules that signaled through G protein‐coupled receptors to promote cell survival and proliferation and to provide directional guidance to migrating cells (Wang & Knaut, 2014). Chemokines were pivotal regulators of cell migration during continuous immune surveillance, inflammation, homeostasis, and development, and subsequent studies showed that chemokine signaling also guided the migration of neurons, neural crest cells, and germ cells during embryonic development, and regulated the patterning and remodeling of the vascular system (Cha et al., 2012; Lewellis & Knaut, 2012). In addition, chemokine binding to their 7‐transmembrane domain, GPCRs caused conformational changes that elicited intracellular signaling pathways to acquire and maintain an asymmetric architectural organization and a polarized distribution of signaling molecules necessary for directional cell migration (Hauser & Legler, 2016). Previous reports showed that the main function of CCR7 was to guide directional cell migration. Therefore, CCR7‐expressing cells underwent rapid shape change upon exposure to its ligands and eventually polarize (Hauser & Legler, 2016). In addition, reduced expression of CCR7 could lead to decreased cell migration ability both in human and in mice (Diaz, Zerpa, & Tapia, 2013; Nico et al., 2018). Our result showed that upregulation of CCR7 greatly enhanced cell migration yet suppression of CCR7 largely inhibited cell migration in human DCs, which was in line with previous results.

It was reported that various signaling pathways were affected by L. major‐mediated infection. Soong et al. (2012) reported in their study that Leishmania parasites could alter the signaling pathways within mice and human DCs, which might have an effect on human VL. Ruhland and Kima (2009) also found that infection of bone marrow‐derived macrophages with Leishmania promastigotes activated both positive and negative signaling pathways that controlled IL‐12 production which was a cytokine influencing the clinical course of leishmaniasis. In our study, chemokine and JAK‐STAT signaling pathways were activated in L. major‐infected human DCs. However, Contreras et al. (2010) claimed Leishmania parasites subverted macrophage immune responses through changing the host cell signal transduction mechanism, including restraint of JAK/STAT signaling pathway. These contradictories could be figured out in the following aspects. AP‐1/c‐Jun is an important transcription factor which mediates gene regulation in response to physiological and pathological stimuli, as well as oncogenic responses (Contreras et al., 2010; Hess, Angel, & Schorpp‐Kistner, 2004). Previous reports indicated that downregulation of activated protein‐1 (AP‐1) suppressed cell proliferation yet enhanced cell apoptosis in several kinds of diseases and cancers (Moyano et al., 2018; Zhang et al., 2018). Combing oncogenic role of AP‐1 with the result by Contreras et al. (2010), it was suggested that L. major‐induced inactivation of the macrophage transcription factor AP‐1 suppressed cell proliferation yet enhanced cell apoptosis in leishmaniasis. In addition, our results showed that CCR7 and JAK‐STAT signaling pathway were both upregulated in leishmaniasis. Besides, previous studies showed that activation of proteins in the JAK‐STAT signaling pathway, including JAK2 and STAT3 could upregulate the expression of BAX yet suppress the expression of Bcl2 to affect hepatocyte proliferation and apoptosis (Ling et al., 2018). Taken together, Leishmania‐induced activation of CCR7, as well as JAK2 and STAT1, might well upregulate the expression of BAX yet suppress the expression of Bcl2 and c‐Jun to promote cell apoptosis and inhibit cell proliferation in leishmaniasis in our study.

CCR7 also played an important role in the course of Leishmania infection in DC. We found that CCR7 was highly expressed during L. major‐induced DC infection. CCR7 was widely investigated in homeostasis and inflammation and it was a crucial factor in the coordinate migration of T cells and DCs in secondary lymphoid organs (Forster, Davalos‐Misslitz, & Rot, 2008). According to Kling et al. (2013) CCR7 was an important factor in the migration of inflammatory monocytes and Tregs. Besides, CCR7 was crucial for protective immune responses (Kling et al., 2013). In our study, we found that the levels of IL‐12 and IFN‐γ were increased in L. major‐infected human DCs. However, according to Akbari et al. (2014) infection with Leishmania parasites modulated the protective immune response triggered by macrophages through inhibiting them to produce IL‐12 and L. major attenuated STAT1‐mediated IFN‐γ signaling in macrophages (Bhardwaj, Rosas, Lafuse, & Satoskar, 2005). Our study investigated the role of CCR7 and related signaling pathways in the process of L. major infection, which could be used for future research and a direction for an effective therapy of L. major‐induced infection.

However, there were some limitations in our research. It was demonstrated by previous reports that the effects of CCR7 were very complex in infection models. Therefore, more studies were required to further investigate the molecular functions of CCR7 in L. major‐induced infection. In addition, unveiling of other receptors or signaling pathways affected by L. major‐induced infection might supply us with more insights into therapeutic strategies for leishmaniasis. In conclusion, our study showed that CCR7 was upregulated and both chemokine and JAK‐STAT signaling pathways were activated in leishmaniasis. Downregulation of CCR7 and inactivation of the JAK‐STAT signaling pathway may suppress leishmaniasis progression in the future.

CONFLICTS OF INTEREST

The authors declare that there are no conflicts of interest.

ACKNOWLEDGMENTS

This study was supported by Guangxi Natural Fund Project (Gui Keji word [2016] 380), an experimental study on the treatment of mouse secondary alveolar echinococcosis with MAPK signaling pathway inhibitor based on full‐length cDNA library. Guangxi Science and Technology Major Project (Gui Keji word [2017] 292), a preclinical study of Maoyujin dropping pills and a New Chinese Medicine of five kinds of traditional Chinese medicine for treating coronary heart disease.

References

REFERENCES

  1. Akbari, M. , Honma, K. , Kimura, D. , Miyakoda, M. , Kimura, K. , Matsuyama, T. , & Yui, K. (2014). IRF4 in dendritic cells inhibits IL‐12 production and controls Th1 immune responses against Leishmania major . Journal of Immunology, 192(5), 2271–2279. [DOI] [PubMed] [Google Scholar]
  2. Ato, M. , Maroof, A. , Zubairi, S. , Nakano, H. , Kakiuchi, T. , & Kaye, P. M. (2006). Loss of dendritic cell migration and impaired resistance to Leishmania donovani infection in mice deficient in CCL19 and CCL21. Journal of Immunology, 176(9), 5486–5493. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Ato, M. , Stäger, S. , Engwerda, C. R. , & Kaye, P. M. (2002). Defective CCR7 expression on dendritic cells contributes to the development of visceral leishmaniasis. Nature Immunology, 3(12), 1185–1191. [DOI] [PubMed] [Google Scholar]
  4. Beringer, A. , Thiam, N. , Molle, J. , Bartosch, B. , & Miossec, P. (2018). Synergistic effect of interleukin‐17 and tumour necrosis factor‐alpha on inflammatory response in hepatocytes through interleukin‐6‐dependent and independent pathways. Clinical and Experimental Immunology, 193(2), 221–233. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bhardwaj, N. , Rosas, L. E. , Lafuse, W. P. , & Satoskar, A. R. (2005). Leishmania inhibits STAT1‐mediated IFN‐gamma signaling in macrophages: Increased tyrosine phosphorylation of dominant negative STAT1beta by Leishmania mexicana . International Journal for Parasitology, 35(1), 75–82. [DOI] [PubMed] [Google Scholar]
  6. Boyum, A. (1983). Isolation of human blood monocytes with Nycodenz, a new non‐ionic iodinated gradient medium. Scandinavian Journal of Immunology, 17(5), 429–436. [DOI] [PubMed] [Google Scholar]
  7. Cha, Y. R. , Fujita, M. , Butler, M. , Isogai, S. , Kochhan, E. , Siekmann, A. F. , & Weinstein, B. M. (2012). Chemokine signaling directs trunk lymphatic network formation along the preexisting blood vasculature. Developmental Cell, 22(4), 824–836. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Contreras, I. , Gómez, M. A. , Nguyen, O. , Shio, M. T. , McMaster, R. W. , & Olivier, M. (2010). Leishmania‐induced inactivation of the macrophage transcription factor AP‐1 is mediated by the parasite metalloprotease GP63. PLOS Pathogens, 6(10), e1001148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Diaz, N. L. , Zerpa, O. , & Tapia, F. J. (2013). Chemokines and chemokine receptors expression in the lesions of patients with American cutaneous leishmaniasis. Memorias do Instituto Oswaldo Cruz, 108(4), 446–452. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Fernández‐Figueroa, E. A. , Imaz‐Rosshandler, I. , Castillo‐Fernández, J. E. , Miranda‐Ortíz, H. , Fernández‐López, J. C. , Becker, I. , & Rangel‐Escareño, C. (2016). Down‐regulation of TLR and JAK/STAT pathway genes is associated with diffuse cutaneous leishmaniasis: A gene expression analysis in NK cells from patients infected with Leishmania mexicana . PLOS Neglected Tropical Diseases, 10(3), e0004570. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Förster, R. , Davalos‐Misslitz, A. C. , & Rot, A. (2008). CCR7 and its ligands: Balancing immunity and tolerance. Nature Reviews Immunology, 8(5), 362–371. [DOI] [PubMed] [Google Scholar]
  12. Gutierrez‐Corbo, C. , Dominguez‐Asenjo, B. , Vossen, L. I. , Pérez‐Pertejo, Y. , Muñoz‐Fenández, M. A. , Balaña‐Fouce, R. , … Reguera, R. M. (2017). PEGylated dendritic polyglycerol conjugate delivers doxorubicin to the parasitophorous vacuole in Leishmania infantum Infections. Macromolecular Bioscience, 17(10), 1700098. [DOI] [PubMed] [Google Scholar]
  13. Hauser, M. A. , & Legler, D. F. (2016). Common and biased signaling pathways of the chemokine receptor CCR7 elicited by its ligands CCL19 and CCL21 in leukocytes. Journal of Leukocyte Biology, 99(6), 869–882. [DOI] [PubMed] [Google Scholar]
  14. Hess, J. , Angel, P. , & Schorpp‐Kistner, M. (2004). AP‐1 subunits: Quarrel and harmony among siblings. Journal of Cell Science, 117(Pt 25), 5965–5973. [DOI] [PubMed] [Google Scholar]
  15. Kling, J. C. , Mack, M. , & Körner, H. (2013). The absence of CCR7 results in dysregulated monocyte migration and immunosuppression facilitating chronic cutaneous leishmaniasis. PLOS One, 8(10), e79098. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Lewellis, S. W. , & Knaut, H. (2012). Attractive guidance: How the chemokine SDF1/CXCL12 guides different cells to different locations. Seminars in Cell and Developmental Biology, 23(3), 333–340. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Ling, L. , Zhang, S. H. , Zhi, L. D. , Li, H. , Wen, Q. K. , Li, G. , & Zhang, W. J. (2018). MicroRNA‐30e promotes hepatocyte proliferation and inhibits apoptosis in cecal ligation and puncture‐induced sepsis through the JAK/STAT signaling pathway by binding to FOSL2. Biomedicine and Pharmacotherapy, 104, 411–419. [DOI] [PubMed] [Google Scholar]
  18. Moyano, A. J. , Racca, A. C. , Soria, G. , Saka, H. A. , Andreoli, V. , Smania, A. M. , … Bocco, J. L. (2018). c‐Jun proto‐oncoprotein plays a protective role in lung epithelial cells exposed to Staphylococcal alpha‐toxin. Frontiers in Cellular and Infection Microbiology, 8, 170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Nickel, T. , Hanssen, H. , Sisic, Z. , Pfeiler, S. , Summo, C. , Schmauss, D. , … Weis, M. (2011). Immunoregulatory effects of the flavonol quercetin in vitro and in vivo. European Journal Nutrition, 50(3), 163–172. [DOI] [PubMed] [Google Scholar]
  20. Nico, D. , Martins Almeida, F. , Maria Motta, J. , Soares Dos Santos Cardoso, F. , Freire‐de‐Lima, C. G. , Freire‐de‐Lima, L. , … Palatnik‐de‐Sousa, C. B. (2018). NH36 and F3 antigen‐primed dendritic cells show preserved migrating capabilities and CCR7 expression and F3 Is effective in immunotherapy of visceral leishmaniasis. Frontiers in Immunology, 9, 967. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Pereira‐Carvalho, R. , Mendes‐Aguiar, C. O. , Oliveira‐Neto, M. P. , Covas, C. J. F. , Bertho, Á. L. , Da‐Cruz, A. M. , & Gomes‐Silva, A. (2013). Leishmania braziliensis‐reactive T cells are downregulated in long‐term cured cutaneous Leishmaniasis, but the renewal capacity of T effector memory compartments is preserved. PLOS One, 8(11), e81529. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Ruhland, A. , & Kima, P. E. (2009). Activation of PI3K/Akt signaling has a dominant negative effect on IL‐12 production by macrophages infected with Leishmania amazonensis promastigotes. Experimental Parasitology, 122(1), 28–36. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Sacks, D. L. , Hieny, S. , & Sher, A. (1985). Identification of cell surface carbohydrate and antigenic changes between noninfective and infective developmental stages of Leishmania major promastigotes. Journal of Immunology, 135(1), 564–569. [PubMed] [Google Scholar]
  24. Saha, A. , Basu, M. , & Ukil, A. (2018). Recent advances in understanding Leishmania donovani infection: The importance of diverse host regulatory pathways. IUBMB Life, 70(7), 593–601. [DOI] [PubMed] [Google Scholar]
  25. Saha, A. , Biswas, A. , Srivastav, S. , Mukherjee, M. , Das, P. K. , & Ukil, A. (2014). Prostaglandin E2 negatively regulates the production of inflammatory cytokines/chemokines and IL‐17 in visceral leishmaniasis. Journal of Immunology, 193(5), 2330–2339. [DOI] [PubMed] [Google Scholar]
  26. Soldevila, G. , Licona, I. , Salgado, A. , Ramirez, M. , Chavez, R. , & Garcia‐Zepeda, E. (2004). Impaired chemokine‐induced migration during T‐cell development in the absence of Jak 3. Immunology, 112(2), 191–200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Soong, L. , Henard, C. A. , & Melby, P. C. (2012). Immunopathogenesis of non‐healing American cutaneous leishmaniasis and progressive visceral leishmaniasis. Seminars in Immunopathology, 34(6), 735–751. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Soriano, S. F. , Serrano, A. , Hernanz‐Falcón, P. , De ana, A. M. , Monterrubio, M. , Martínez‐A, C. , … Mellado, M. (2003). Chemokines integrate JAK/STAT and G‐protein pathways during chemotaxis and calcium flux responses. European Journal of Immunology, 33(5), 1328–1333. [DOI] [PubMed] [Google Scholar]
  29. Wang, J. , & Knaut, H. (2014). Chemokine signaling in development and disease. Development, 141(22), 4199–4205. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Weis, M. , Schlichting, C. L. , Engleman, E. G. , & Cooke, J. P. (2002). Endothelial determinants of dendritic cell adhesion and migration: New implications for vascular diseases. Arteriosclerosis, Thrombosis, and Vascular Biology, 22(11), 1817–1823. [DOI] [PubMed] [Google Scholar]
  31. Wright, M. H. , Paape, D. , Storck, E. M. , Serwa, R. A. , Smith, D. F. , & Tate, E. W. (2015). Global analysis of protein N‐myristoylation and exploration of N‐myristoyltransferase as a drug target in the neglected human pathogen Leishmania donovani . Chemistry and Biology, 22(3), 342–354. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Zhang, L. Z. , Man, Q. W. , Liu, J. Y. , Zhong, W. Q. , Zheng, Y. Y. , Zhao, Y. F. , & Liu, B. (2018). Overexpression of Fra‐1, c‐Jun and c‐Fos in odontogenic keratocysts: Potential correlation with proliferative and anti‐apoptotic activity. Histopathology, 73, 933–942. [DOI] [PubMed] [Google Scholar]
  33. Zhou, J. , Lai, W. , Yang, W. , Pan, J. , Shen, H. , Cai, Y. , … Du, C. (2018). BLT1 in dendritic cells promotes Th1/Th17 differentiation and its deficiency ameliorates TNBS‐induced colitis. Cellular and Molecular Immunology, 15, 1047–1056. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Cellular Physiology are provided here courtesy of Wiley

RESOURCES