Skip to main content
NCBI home page
Wiley Open Access Collection logoLink to Wiley Open Access Collection
. 2018 Dec 7;234(8):12663–12675. doi: 10.1002/jcp.27875

Artemisinin inhibits breast cancer‐induced osteolysis by inhibiting osteoclast formation and breast cancer cell proliferation

Jia Li 1, Wenyu Feng 2,3, Huiping Lu 1, Yan Wei 1, Shiting Ma 2, Linfeng Wei 2,3, Qian Liu 3,5, Jinmin Zhao 2,3,4,5, Qingjun Wei 2,3,5,✉, Jun Yao 3,4,5,✉
PMCID: PMC13484186  PMID: 30536376

Abstract

In addition to being used to treat malaria, artemisinin (Art) can be used as an anti‐inflammatory and antitumor agent. In this study, we evaluated the effects of Art on osteoclast formation and activation and on the development of breast cancer cells in bone. To evaluate the effect of Art on osteoclast differentiation in vitro, we treated bone marrow‐derived macrophages (BMMs) with various concentrations of Art and evaluated the expression of genes and proteins involved in osteoclast formation. We also performed cell counting kit‐8 assays to evaluate the toxicity of Art in BMMs and MDA‐MB‐231 cells. We also performed Transwell assays, wound‐healing assays, colony formation assays, and cell apoptosis assays to evaluate the effect of Art in MDA‐MB‐231 cells. We also evaluated the effect of Art in an in vivo osteoclast bone resorption assay using a nude mouse model. We demonstrated that Art inhibits the differentiation and establishment of osteoclasts even though Art is not toxic to osteoclasts. In addition, Art reduced expression of genes involved in osteoclast formation and inhibited osteoclast bone resorption in a concentration‐dependent manner. Based on our data, we believe that Art can inhibit proliferation of breast cancer cells by activating apoptosis pathways, and inhibit osteoclast formation and differentiation by inhibiting activation of cathepsin K, ATPase H+ transporting V0 subunit D2, nuclear factor of activated T cells 1, calcitonin receptor, and tartrate‐resistant acid phosphatase and by inhibiting nuclear factor‐κB activation.

Keywords: artemisinin, breast cancer, osteoclast, RANKL

Art can inhibit proliferation of breast cancer cells by activating apoptosis pathways, and inhibit osteoclast formation and differentiation by inhibiting activation of cathepsin K, ATPase H+ transporting V0 subunit D2, nuclear factor of activated T cells 1, calcitonin receptor, and tartrate‐resistant acid phosphatase and by inhibiting nuclear factor‐κB activation.

graphic file with name JCP-234-12663-g003.jpg

1. INTRODUCTION

Breast cancer is a metastasizing malignancy that leads to osteolytic diseases, bone pain, and pathological fracture. The seed and soil hypothesis of metastasis may be applied to the complex interactions between bone matrix and breast cancer cells (Hayashida, Jinno, & Kitagawa, 2012). First, breast cancer cells acquire the ability to develop in bone, with bone matrix providing a suitable environment for the growth and survival of breast cancer cells. During bone reconstruction, bone resorption is mediated primarily by osteoclasts and bone formation is mediated primarily by osteoblasts (Cocchi, Tonello, Gabrielli, & Pregnolato, 2011; Cui et al., 2014; Galli, Macaluso, & Passeri, 2013; Inose, 2010; Ooi, Zheng, Stalgis‐Bilinski, & Dunstan, 2011).

Metastatic breast cancer cells express the receptor activator of nuclear factor‐κB ligand (RANKL), which activates osteoclasts directly or indirectly to release transforming growth factor‐β (TGF‐β), which stimulates the growth of tumor cells, leading to dissolved bone. This process is a primary mechanism of bone metastasis by breast cancer cells (Guise et al., 2006; Mundy, 2002; Yoneda & Hiraga, 2005; Zhang, Ma, & Fan, 2010). RANKL is the ligand of receptor activator of nuclear factor‐κB (RANK), which expressed on the osteoclast progenitor cell surface. RANKL is a member of the tumor necrosis factor (TNF) ligand superfamily, and can be produced by osteoblasts, osteoblast precursors, T cells, B cells, and megakaryocytes. It modulates expression of RANK and TNF receptor connection factor (TRAF), and is involved in the activation of the nuclear factor‐κB (NF‐κB), c‐Fos, mitogen‐activated protein kinase (MAPK), Src–phosphoinositide 3‐kinase–Akt, and nuclear factor of activated T cells (NFAT)c1 signaling pathways.

Although bisphosphonate is used in the clinical treatment of osteolytic disease, it has been reported that biphosphonate can increase the risk of bone necrosis in patients (Mariotti, 2008; Mundy, 2002; Roodman, 2004; Suva, Washam, Nicholas, & Griffin, 2011; Weilbaecher, Guise, & McCauley, 2011). Currently, bone metastasis by breast cancer is treated primarily by inhibiting osteolysis and bone loss, and good results have been achieved (Jiang et al., 2013; Remus, Stewart, Camp, Novak, & Johnson, 2015). Bone formation mediated by osteoclasts and osteoblasts maintains a dynamic balance of bone. Osteoclasts are derived from hematopoietic progenitor macrophages, and differentiation, fusion, and activation of osteoclasts involve RANKL and macrophage colony‐stimulating factor (M‐CSF; Hayashi et al., 2012). RANKL induces differentiation of osteoclasts, whereas M‐CSF promotes cell proliferation and survival during differentiation (Takayanagi, 2007; Teitelbaum, 2000). During osteoclast formation, RANKL binds to the RANK receptor and activates TNF receptor‐associated factor 6 (TRAF6), thereby activating protein kinase MAPK and the transcription factors AP‐1, NF‐κB, and NFAT, which are involved in osteoclast formation and regulation of osteoclast differentiation (Kim et al., 2008; Walsh et al., 2006).

Artemisia annua, also known as sweet wormwood, is a herbaceous plant that has detoxification properties and has been used in Chinese medicine for more than 2,000 years. In the 1970s, Chinese scientists isolated artemisinin (Art) from A. annua. Art has been used to treat malaria and has been shown to have antitumor properties, such as regulating cell cycle arrest, inducing apoptosis, and preventing angiogenesis but there have been no reports on the inhibition of breast cancer cells by Art (Li, Li, Wu, Wang, & Yu, 2016; Sadava, Phillips, Lin, & Kane, 2002; Wang et al., 2008). Because artesunate derivatives of Art have been shown to inhibit osteoclast proliferation by inhibiting nuclear factor NF‐κB p65 subunit (NF‐κBp65; also known as RelA) pathways (Wei et al., 2018), we hypothesized that Art could disrupt the interaction between bone matrix and breast cancer cells by inhibiting osteoclast proliferation, thereby inhibiting breast cancer cell proliferation in bone.

2. MATERIALS AND METHODS

2.1. Media, antibodies, reagents, mice, and cells

Anhydrous ethanol, isopropyl alcohol, and chloroform were obtained from the Tianjin Fuyu Reagent Factory (Tianjin, China). We purchased α‐mem fetal and medium bovine serum from Gibco (Sydney, Australia) and RANKL and M‐CSF from R&D Systems (Minneapolis, MN), polymerse chain reaction (PCR) primers were synthesized by Thermo Fisher Scientific (Scoresby, Vic, Australia), Mouse antibodies were purchased from Abcam (Cambridge, UK) and real‐time PCR reagents and kits were purchased from Thermo Fisher Scientific, TUNEL kits were purchased from Solarbio (Beijing, China) and Promega (Madison, WI) and the ELISA kit was purchased from Humanwell (Wuhan, China). Polyethylene (PE) particles were purchased from Clariant (Gersthofen, Germany). Art was purchased from Manst Biotech (Chengdu, China). Calcium phosphate (CaP)‐coated 48‐well plates were purchased from Cosmo Bio Co., Ltd. (Tokyo, Japan). Anti‐p‐NF‐κB, anti‐NF‐κB, anti‐β‐actin, anti‐ERK, anti‐p‐ERK, anti‐p38, anti‐p‐p38, anti‐JNK, anti‐p‐JNK, anti‐Bax, anti‐Bcl‐2, anti‐caspase‐3, and anti‐caspase‐9 antibodies were purchased from Cell Signaling Technology (Danvers, MA). Six‐week‐old male C57BL/6 mice (average weight, 17.9 ± 1.2 g; range, 17.1–19.1 g) and 4‐week‐old nude mice (average weight of 15.2 ± 0.8 g, range 14.5–16.1 g) were purchased from the Animal Experiment Center of Guangxi Medical University. The MDA‐MB‐231 cell line was purchased from the Shanghai cell bank (No. CBP60382). Bone marrow‐derived macrophages (BMMs) were obtained from the tibial bone marrow of 6‐week‐old male C57BL/6 mice.

2.2. PE particle preparation

To remove endotoxin from the PE particles, the particles were soaked in 95% ethanol and repeatedly washed. The particles were resuspended in phosphate‐buffered saline (PBS) at a concentration of 1000 mg/ml. The average particle size was 1.75 ± 1.50 µm.

2.3. Cell culture

Six‐week‐old C57BL/6 mice were executed by cervical dislocation and immersed in 75% alcohol for disinfection before the hind leg femurs and tibiae were stripped and the soft tissues were removed aseptically. The cells of the bone marrow cavity were cultured in 10% fetal bovine serum (FBS), 35 ng/ml M‐CSF, and 1% penicillin–streptomycin medium at 37°C under 5% CO2 and saturated humidity conditions until 90% confluence. MDA‐MB‐231 cells were cultured in Dulbecco's modified Eagle's media (DMEM) with 10% FBS in a humidified atmosphere of 5% CO2 at 37°C.

2.4. In vivo osteolytic bone metastasis assay

We cultured MDA‐MB‐231 cells to a concentration of 107 cells/ml and immediately inoculated them at the tibial platforms of nude mice. The mice were separated randomly into four groups and treated with PBS or various concentrations of Art. The concentration of Art used in the low‐dose mice group was 2.5 mg/kg, and the Art concentration used in the high‐dose group was 5 mg/kg. Injections were given intraperitoneally every other day (n = 6). After 28 days, the tibiae of the mice were analyzed using high‐resolution micro‐computed tomography (micro‐CT) and tumor tissues from hind limbs were examined histologically.

2.5. PE particle‐induced osteolysis of the cranium in a mouse model

We established a mouse skull dissolution model to measure the effect of Art on bone osteolysis in vivo. Twenty‐four healthy 6‐week‐old C57BL/J6 mice were divided randomly into four groups. PE particles (30 µl; 1000 mg/ml) were inserted under the periosteum of the suture of the central skull. Every other day for 14 days, the low‐dose Art group was injected intraperitoneally with 2.5 mg/kg Art and the high‐dose Art group was injected intraperitoneally with 5 mg/kg Art. The negative and positive groups were injected with PBS every other day. After 14 days, the mice were killed by cervical dislocation after anesthesia. Then, abdominal aortas and arterial blood were harvested from the mice. Sera were analyzed using enzyme‐linked immunosorbent assay (ELISA) and crania were scanned using micro‐CT and stained histologically.

2.6. Serological analysis

We used an ELISA kit according to the manufacturer's instructions to detect three osteoclast‐related indicators, RANKL, osteoclast‐associated immunoglobulin‐like receptor (OSCAR), and collagen type I C‐telopeptide (CTX‐1), in sera from arterial blood.

2.7. Histological and immunohistochemical analysis

The tibiae of nude mice and the skulls of C57BL/6 mice were placed in a 10% ethylenediaminetetraacetic acid (EDTA) solution for 4 weeks. After decalcification, bone tissues were buried in wax blocks for sectioning, TRAP staining (Sigma‐Aldrich, Darmstadt, Germany), and hematoxylin and eosin (HE) staining (Solarbio). Liver and small intestine samples were stained histologically and TUNEL stained (Promega) after dewaxing.

2.8. Cell viability assay

The cell viability assay was performed according to the instructions of the cell counting kit‐8 (CCK‐8). Briefly, BMMs were seeded into 5,000 wells of 96‐well culture plates and incubated with various concentrations of Art for 24 hr or 5 days. MDA‐MB‐231 cells were seeded into 5,000 wells of 96‐well culture plates and incubated with various concentrations of Art for 24 hr or 5 days. Then, 10 µl of CCK‐8 buffer was added to each well and incubated at 37°C for 2 hr. Absorbances were measured at 450 nm (630 nm reference) on an ELX800 absorbance microplate reader (Bio‐Tek, VT). This experiment was repeated at least three times.

2.9. Transwell assay

For this assay, a 24‐well transwell chamber with 8‐µm pore polycarbonate filters was used according to the manufacturer's instructions (Corning Inc., Corning, NY). MDA‐MB‐231 cells at a density of 5 × 104 cells/well in 200 µl of serum‐free medium with or without 0, 5, 10, 20, 40, or 80 µM of Art were placed in the upper wells of the chamber, 600 µl of complete medium was added to the lower wells, and the chamber was incubated at 37°C for 24 hr. Then, cells in the lower wells were fixed with 4% paraformaldehyde for 0.5 hr and stained with crystal violet (Solarbio) for 0.5 hr. Nonmigratory cells in the upper wells were removed with cotton swabs. Migration was quantified by calculating the surface area containing cells in the lower well.

2.10. Wound‐healing assay

MDA‐MB‐231 cells were grown to 95% confluence and linear wounds were created in confluent monolayers using a 100 µl micropipette tip. Then, the cell monolayers were washed with 1× PBS and cultured in serum‐free DMEM with or without 0, 10, 20, 40, or 80 µM Art for 12, 24, and 48 hr. Closure of the edges of the wounds were measured using Image J software (NIH, Bethesda).

2.11. Colony formation assay

MDA‐MB‐231 cells (1 × 103 cells/ml) were incubated with 0, 5, 10, 20, 40, or 80 µM Art in six‐well plates for 9 days. Then, the cells were fixed with 4% paraformaldehyde for 0.5 hr, stained with crystal violet (Solarbio) for 0.5 hr at 25°C, washed with 1× PBS, and the numbers of colonies were counted.

2.12. Cell apoptosis assay

Apoptosis was measured using the annexin‐V‐fluorescein isothiocyanate/propidium iodide staining kit (BD Biosciences, NJ) according to the manufacturer's instructions. Briefly, 2 × 105 cells/ml of MDA‐MB‐231 cells were placed into six‐well plates and were incubated at 25°C for 24 hr. The MDA‐MB‐231 cells were then treated with 0, 10, 20, 40, or 80 µM Art for 24 hr and were analyzed with the FACSCalibur and FACSMelody cytometry systems (BD Biosciences). This experiment was performed in triplicate three independent times.

2.13. In vitro osteoclastogenesis assay

BMMs were separated and cultured in 10% FBS, 35 ng/ml M‐CSF, and 1% penicillin for 24 hr to obtain BMMs for further experiments. BMMs were incubated with 35 ng/ml M‐CSF, 60 ng/ml RANKL, and various Art concentrations (0, 0.5, 1, 2, or 5 µM) for 5 to 7 days. Afterward, the BMMs were fixed in 4% paraformaldehyde for 20 min and stained with a TRAP staining solution according to the manufacturer's instructions. Osteoclasts were identified as cells containing at least three nuclei. This experiment was repeated at least three times.

2.14. Quantitative PCR assay and RNA extraction

Total RNA was extracted from cells with TRIzol and complementary DNA was synthesized using real‐time PCR reagents and kits from Thermo Fisher Scientific. Real‐time PCR was performed using the SYBR Premix Ex Tag Kit (TaKaRa, bioengineering (Dalian) co., LTD, Japan) and the ABI 7300 Sequencing Detection System (Applied Biosystems, Foster City, CA) following the manufacturer's protocols. Real‐time PCR primers are listed in Table 1.

Table 1.

Primers used in real‐time PCR

Genes Primer sequences (5′–3′)
CTSK Forward: GGGAGAAAAACCTGAAGC
Reverse: ATTCTGGGGACTCAGAGC
ATP6v0d2 Forward: GTGAGACCTTGGAAGACCTGAA
Reverse: GAGAAATGTGCTCAGGGGCT
NFATc1 Forward: CAACGCCCTGACCACCGATAG
Reverse: GGCTGCCTTCCGTCTCATAGT
Calcitonin receptor Forward: TGGTTGAGGTTGTGCCCA
Reverse: CTCGTGGGTTTGCCTCATC
TRACP Forward: TGTGGCCATCTTTATGCT
Reverse: GTCATTTCTTTGGGGCTT
GAPDH Forward: ACCACAGTCCATGCCATCAC
Reverse: TCCACCACCCTGTTGCTGTA
Open in a new tab

Note. ATP6v0d2: ATPase H+ transporting V0 subunit D2; CTSK: cathepsin K; GAPDH: glyceraldehyde 3‐phosphate dehydrogenase; NFATc1: nuclear factor of activated T cells 1; TRACP: tartrate‐resistant acid phosphatase

2.15. Resorption assay

BMMs were seeded in CaP‐coated 48‐well plates (Cosmo Bio Co., Ltd.) and cultured with 35 ng/ml M‐CSF, 100 ng/ml RANKL, and 0, 1, 2, or 5 µM Art to generate multinucleate osteoclasts. The plates were treated with 5% sodium and hypochlorite for 5 min, and then rinsed with water and dried. Microscopic images of each well were captured and quantified using Image J.

2.16. Western blot analysis

BMMs were treated with 1 µM Art for 4 hr after treating with RANKL for 0, 5, 10, 15, 30, or 60 min. MDA‐MB‐231 cells were treated with 0, 10, 20, 40, or 80 µM Art for 24 hr. Whole cell lysates were prepared in a buffer containing 50 mM Tris‐HCl, 150 mM NaCl, 5 mM EDTA, 1% Triton X‐100, 1 mM sodium fluoride, 1 mM sodium vanadate, 1% deoxycholate, and protease inhibitors. The lysates were centrifuged at 14,000g for 20 min and supernatants were collected. The protein concentrations of the lysates were determined and cell lysates containing 25 µg of protein were electrophoresed on 8% sodium dodecyl sulfate polyacrylamide gel electrophoresis gels and transferred to polyvinylidene difluoride membranes (Bio‐Rad, Hercules, CA). The membranes were incubated with primary antibody overnight at 4°C and with secondary antibody for 1 hr at 25°C. Bands were detected and quantified using Odyssey v3.0 image scan (Li‐COR Inc.) and Image J software.

2.17. Statistical analysis

Data were subjected to analyses of variance in SPSS 18.0 (IBM Corp.) and expressed as mean ± SD. Each experiment was performed at least three independent times. In all cases, p < 0.05 was considered statistically significant.

3. RESULTS

3.1. Art inhibits osteolysis and growth of breast cancer in vivo

To determine whether Art affects proliferation of MDA‐MB‐231 cells according to the soil and seed theory (Hayashida et al., 2012), inhibits bone destruction by osteoclasts, and affects the microenvironment of MDA‐MB‐231 cells, we used a mouse xenotransplant model. The 40 naked mice were randomly divided into four groups of 10 naked mice. We injected saline into the right tibial bone marrow cavity in the negative group. The high‐dose, low‐dose, and positive groups were injected with 2 × 106 MDA‐MB‐231 cells. Afterward, the high‐ and low‐dose groups were injected with different concentrations of Art. The negative and the positive groups were injected with the same volume of saline. After 28 days, we evaluated the right lower limbs of naked mice with the naked eye. The sizes of the tumors were the smallest in the negative group, intermediate in the low‐ and high‐dose Art groups, and highest in the positive group (Figure 1a). Tumor width, length, and volume, determined with vernier calipers, were significantly higher in the positive group than in the negative, low‐, and high‐dose Art groups (Figure 1b). Micro‐CT scan images showed that there was significantly more bone destruction in the positive group than in the negative and high‐dose Art groups (Figure 1c). There were no significant differences in trabecular number, trabecular separation, trabecular thickness, structure model index, and bone mineral density values between the low‐dose Art group and the positive group (Figure 1d).

Figure 1.

Figure 1

Open in a new tab

Art inhibits tumor growth, breast cancer‐induced osteolysis and PE particle‐induced osteolysis in vivo. (a) Tumors observed 28 days after MDA‐MB‐231 cells were injected directly into the tibial bone marrow cavity (n = 6). (b) Mean tumor width, length, and volume by group (n = 6). (c) Representative micro‐CT based, 3D reconstructed images from each group (n = 6). (d) Comparisons of BV/TV ratio, Tb.N, Tb.Sp, Tb.th, SMI, Conn Dn, DA, and BMD across groups (n = 6). (e) Representative micro‐CT images of PE particle‐induced calvarial osteolysis in each group 14 days after surgery (n = 6). (f) Quantification of the micro‐CT data (n = 6). (g) RANKL, OSCAR, and CTX‐1 serum concentrations were measured in a particle‐induced C57BL/6 mice model (n = 6; *p < 0.05, **p < 0.01, ***p < 0.001, and ns p > 0.05). BMD: bone mineral density; BV: bone volume; Conn Dn: connectivity density; CT: computed tomography; CTX‐1: collagen type I C‐telopeptide; DA: degree of anisotropy; ns: not significant; OSCAR: osteoclast‐associated immunoglobulin‐like receptor; PE: polyethylene; RANKL: receptor activator of nuclear factor‐κB ligand; SMI: structure model index; Tb.N: trabecular number; Tb.Sp: trabecular separation; Tb.th: trabecular thickness; TV: trabecular volume [Color figure can be viewed at wileyonlinelibrary.com]

3.2. Art attenuated PE particle‐induced osteolysis’ bone destruction in C57BL/6 mice

To evaluate the effects Art in in vivo bone dissolution tests, we injected PE particles into C57BL/6 mice to develop an induced bone dissolution model. Micro‐CT scans of mouse skull caps 14 days after intraperitoneal injections of 0, 2.5, or 5 mg/kg Art showed that Art treatment correlated positively with BV/TV values and negatively with the number of cranial cap bone pits in a dose‐dependent manner (Figure 1e,f).

3.3. Art inhibits CTX‐1, RANKL, and Oscar expression

We used a nude mouse model and serum ELISA to examine three osteoclast developmental markers: CTX‐1, the elevation of which in blood signals decomposition of collagen type 1, a protein whose loss of integrity facilitates bone transformation; RANKL, a type II membrane protein that exists in a transmembrane form, an ectodomain form, and a soluble secreted form that primarily exists in peripheral blood; and OSCAR, an active immunoglobulin collagen receptor expressed selectively by osteoclasts in mice that is found in peripheral blood. We found that expression of the osteoclast‐related factors RANKL and CTX‐1 decreased with increasing concentrations of Art. There was no difference in OSCAR expression between the positive group and the low‐dose Art (2.5 mg/kg) group. However, we found that a high‐dose of Art (5 mg/kg) inhibited OSCAR, RANKL, and CTX‐1 expression (Figure 1g).

3.4. Histology and immunohistochemistry

To further evaluate Art‐induced inhibition of osteosclerotic destruction in vivo, we used the nude mouse model and TRAP and HE stained tibial plateaus and C57BL/6 mouse skulls. We observed larger numbers of inflammatory cells, such as lymphocytes and macrophages, together with osteoclasts in the positive group compared to the high‐dose Art, low‐dose Art, and negative groups (Figure 2a,b). Pathological staining of small intestines and livers extracted from nude mice showed no difference in the pathologies of these among the negative, positive, high‐dose Art, and low‐dose Art groups (Figure 2c,d). The results of terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) in the livers and small intestines of the mice did not differ among the groups indicating that there were similar levels of apoptosis in all of the groups. Thus, Art does not appear to be harmful to nude mice.

Figure 2.

Figure 2

Open in a new tab

Histological staining of tibiae, livers, and the small intestines from nude mice. (a) Images of HE and TRAP stained tissues from nude mice. (b) Images of HE and TRAP stained tissues from C57BL/6 mice. The number of TRAP‐positive cells per wide field (a fixed‐size region of the image) and the erosion area was measured at the suture site of the tibia platform. (c) HE staining and TUNEL staining of the liver. (d) HE staining (×10) and TUNEL staining of the small intestine. For quantification, apoptotic cells were counted in a rectangular region of a TUNEL stained image (n = 3; *p < 0.05, **p < 0.01, ***p < 0.001, and ns p > 0.05). Art: artemisinin; H: high‐dose; HE: hematoxylin and eosin; L: low‐dose; NS: not significant; TRAP: tartrate‐resistant acid phosphatase; TUNEL: terminal deoxynucleotidyl transferase dUTP nick end labeling [Color figure can be viewed at wileyonlinelibrary.com]

3.5. Art suppresses the invasion, migration, and colony formation and proliferation of MDA‐MB‐231 cells in vitro

We found that Art concentrations as low as 10 µM suppress MDA‐MB‐231 cell invasion and wound closure. The percent invasions of MDA‐MB‐231 cells were 95.50 ± 1.48%, 73.71 ± 2.91%, 70.77 ± 2.08%, 35.96 ± 4.54%, 28.03 ± 3.27%, and 12.18 ± 1.86% upon treatment with 0, 5, 10, 20, 40, and 80 µM Art for 24 hr, respectively (Figure 3a,d). Furthermore, in the wound‐healing assay, the percentage wound healing of MDA‐MB‐231 cells were 27.98 ± 0.31%, 23.54 ± 0.94%, 9.50 ± 0.23%, 1.98 ± 0.06%, and 1.40 ± 0.11% upon treatment with 0, 10, 20, 40 and 80 µM Art for 12 hr, respectively. The percentage wound healing of MDA‐MB‐231 cells were 31.92 ± 0.15%, 27.08 ± 0.74%, 10.04 ± 0.07%, 2.17 ± 0.11%, and 1.93 ± 0.05% upon treatment with 0, 10, 20, 40, and 80 µM Art for 24 hr, respectively. The percentage wound healing of MDA‐MB‐231 cells were 41.63 ± 1.18%, 29.65 ± 1.68%, 22.07 ± 0.78%, 17.03 ± 0.38%, and 1.97 ± 0.12% upon treatment with 0, 10, 20, 40, and 80 µM Art for 48 hr, respectively (Figure 3b,e) [Correction added on 28 Dec 2018, after first online publication: in the preceding sentence, 24 hr was corrected to 48 hr]. Then, in the colony formation assay, the percentage of colonies of MDA‐MB‐231 cells were 93.00 ± 1.63%, 72.67 ± 2.05%, 62.67 ± 2.88%, 35.33 ± 1.25%, 18.33 ± 1.36%, and 13.33 ± 1.28% upon treatment with 0, 5, 10, 20, 40, and 80 µM Art for 9 days (Figure 3c,f). To determine whether Art inhibits the proliferation of MDA‐MB‐231 breast cancer cells, we evaluated MDA‐MB‐231 cell proliferation intended and cytotoxicity with the CCK‐8 assay, which showed that the semi‐inhibitory concentrations of Art on MDA‐MB‐231 cells after 24, 48, 72, 96, and 120 hr of cell culture were 730.905, 593.587, 554.136, 371.221, and 279.783 µM, respectively (Figure 3g–k).

Figure 3.

Figure 3

Open in a new tab

Art inhibits the migration, invasion, colony formation, and proliferation of MDA‐MB‐231 cells. (a) MDA‐MB‐231 cells were incubated with or without Art (0, 10, 20, 40, and 80 μM) for 24 hr. Art inhibits the invasion of MDA‐MB‐231 cells. (b) MDA‐MB‐231 cells were incubated with or without Art (0, 10, 20, 40, and 80 μM) for 12, 24, and 48 hr, Art inhibits the wound healing of MDA‐MB‐231 cells. (c) MDA‐MB‐231 cells were incubated with or without Art (0, 10, 20, 40, and 80 μM) for further 9 days. Art inhibits the colony formation of MDA‐MB‐231 cells. (d) The area of MDA‐MB‐231 cells were counted. (e) The percentage of wound‐healing were counted. (f) The percent of colonies were counted. (g–k) MDA‐MB‐231 cells were cultured for the indicated time periods and Art concentrations. Cell viability was determined using cell counting kit‐8 assay and IC 50 values were calculated (**p < 0.01 and ***p < 0.001). Art: artemisinin [Color figure can be viewed at wileyonlinelibrary.com]

We found that Art concentrations as low as 10 µM suppress MDA‐MB‐231 cell invasion and wound closure. The percent invasions of MDA‐MB‐231 cells were 95.50 ± 1.48%, 73.71 ± 2.91%, 70.77 ± 2.08%, 35.96 ± 4.54%, 28.03 ± 3.27%, and 12.18 ± 1.86% upon treatment with 0, 5, 10, 20, 40, and 80 µM Art for 24 hr, respectively (Figure 3a,d). Furthermore, in the wound‐healing assay, the percentage wound healing of MDA‐MB‐231 cells were 27.98 ± 0.31%, 23.54 ± 0.94%, 9.50 ± 0.23%, 1.98 ± 0.06%, and 1.40 ± 0.11% upon treatment with 0, 10, 20, 40 and 80 µM Art for 12 hr, respectively. The percentage wound healing of MDA‐MB‐231 cells were 31.92 ± 0.15%, 27.08 ± 0.74%, 10.04 ± 0.07%, 2.17 ± 0.11%, and 1.93 ± 0.05% upon treatment with 0, 10, 20, 40, and 80 µM Art for 24 hr, respectively. The percentage wound healing of MDA‐MB‐231 cells were 41.63 ± 1.18%, 29.65 ± 1.68%, 22.07 ± 0.78%, 17.03 ± 0.38%, and 1.97 ± 0.12% upon treatment with 0, 10, 20, 40, and 80 µM Art for 48 hr, respectively (Figure 3b,e) [Correction added on 28 Dec 2018, after first online publication: in the preceding sentence, 24 hr was corrected to 48 hr]. Then, in the colony formation assay, the percentage of colonies of MDA‐MB‐231 cells were 93.00 ± 1.63%, 72.67 ± 2.05%, 62.67 ± 2.88%, 35.33 ± 1.25%, 18.33 ± 1.36%, and 13.33 ± 1.28% upon treatment with 0, 5, 10, 20, 40, and 80 µM Art for 9 days (Figure 3c,f). To determine whether Art inhibits the proliferation of MDA‐MB‐231 breast cancer cells, we evaluated MDA‐MB‐231 cell proliferation intended and cytotoxicity with the CCK‐8 assay, which showed that the semi‐inhibitory concentrations of Art on MDA‐MB‐231 cells after 24, 48, 72, 96, and 120 hr of cell culture were 730.905, 593.587, 554.136, 371.221, and 279.783 µM, respectively (Figure 3g–k).

We found that Art concentrations as low as 10 µM suppress MDA‐MB‐231 cell invasion and wound closure. The percent invasions of MDA‐MB‐231 cells were 95.50 ± 1.48%, 73.71 ± 2.91%, 70.77 ± 2.08%, 35.96 ± 4.54%, 28.03 ± 3.27%, and 12.18 ± 1.86% upon treatment with 0, 5, 10, 20, 40, and 80 µM Art for 24 hr, respectively (Figure 3a,d). Furthermore, in the wound‐healing assay, the percentage wound healing of MDA‐MB‐231 cells were 27.98 ± 0.31%, 23.54 ± 0.94%, 9.50 ± 0.23%, 1.98 ± 0.06%, and 1.40 ± 0.11% upon treatment with 0, 10, 20, 40 and 80 µM Art for 12 hr, respectively. The percentage wound healing of MDA‐MB‐231 cells were 31.92 ± 0.15%, 27.08 ± 0.74%, 10.04 ± 0.07%, 2.17 ± 0.11%, and 1.93 ± 0.05% upon treatment with 0, 10, 20, 40, and 80 µM Art for 24 hr, respectively. The percentage wound healing of MDA‐MB‐231 cells were 41.63 ± 1.18%, 29.65 ± 1.68%, 22.07 ± 0.78%, 17.03 ± 0.38%, and 1.97 ± 0.12% upon treatment with 0, 10, 20, 40, and 80 µM Art for 48 hr, respectively (Figure 3b,e) [Correction added on 28 Dec 2018, after first online publication: in the preceding sentence, 24 hr was corrected to 48 hr]. Then, in the colony formation assay, the percentage of colonies of MDA‐MB‐231 cells were 93.00 ± 1.63%, 72.67 ± 2.05%, 62.67 ± 2.88%, 35.33 ± 1.25%, 18.33 ± 1.36%, and 13.33 ± 1.28% upon treatment with 0, 5, 10, 20, 40, and 80 µM Art for 9 days (Figure 3c,f). To determine whether Art inhibits the proliferation of MDA‐MB‐231 breast cancer cells, we evaluated MDA‐MB‐231 cell proliferation intended and cytotoxicity with the CCK‐8 assay, which showed that the semi‐inhibitory concentrations of Art on MDA‐MB‐231 cells after 24, 48, 72, 96, and 120 hr of cell culture were 730.905, 593.587, 554.136, 371.221, and 279.783 µM, respectively (Figure 3g–k).

We found that Art concentrations as low as 10 µM suppress MDA‐MB‐231 cell invasion and wound closure. The percent invasions of MDA‐MB‐231 cells were 95.50 ± 1.48%, 73.71 ± 2.91%, 70.77 ± 2.08%, 35.96 ± 4.54%, 28.03 ± 3.27%, and 12.18 ± 1.86% upon treatment with 0, 5, 10, 20, 40, and 80 µM Art for 24 hr, respectively (Figure 3a,d). Furthermore, in the wound‐healing assay, the percentage wound healing of MDA‐MB‐231 cells were 27.98 ± 0.31%, 23.54 ± 0.94%, 9.50 ± 0.23%, 1.98 ± 0.06%, and 1.40 ± 0.11% upon treatment with 0, 10, 20, 40 and 80 µM Art for 12 hr, respectively. The percentage wound healing of MDA‐MB‐231 cells were 31.92 ± 0.15%, 27.08 ± 0.74%, 10.04 ± 0.07%, 2.17 ± 0.11%, and 1.93 ± 0.05% upon treatment with 0, 10, 20, 40, and 80 µM Art for 24 hr, respectively. The percentage wound healing of MDA‐MB‐231 cells were 41.63 ± 1.18%, 29.65 ± 1.68%, 22.07 ± 0.78%, 17.03 ± 0.38%, and 1.97 ± 0.12% upon treatment with 0, 10, 20, 40, and 80 µM Art for 48 hr, respectively (Figure 3b,e) [Correction added on 28 Dec 2018, after first online publication: in the preceding sentence, 24 hr was corrected to 48 hr]. Then, in the colony formation assay, the percentage of colonies of MDA‐MB‐231 cells were 93.00 ± 1.63%, 72.67 ± 2.05%, 62.67 ± 2.88%, 35.33 ± 1.25%, 18.33 ± 1.36%, and 13.33 ± 1.28% upon treatment with 0, 5, 10, 20, 40, and 80 µM Art for 9 days (Figure 3c,f). To determine whether Art inhibits the proliferation of MDA‐MB‐231 breast cancer cells, we evaluated MDA‐MB‐231 cell proliferation intended and cytotoxicity with the CCK‐8 assay, which showed that the semi‐inhibitory concentrations of Art on MDA‐MB‐231 cells after 24, 48, 72, 96, and 120 hr of cell culture were 730.905, 593.587, 554.136, 371.221, and 279.783 µM, respectively (Figure 3g–k).

3.6. Art enhances apoptosis by suppressing B‐cell lymphoma 2 (Bcl‐2) and activating caspase‐3, caspase‐9, and BCL2‐associated X (bax) in MDA‐MB‐231 cells

We evaluated the effects of 0, 10, 20, 40, and 80 µM Art on the induction of apoptosis in MDA‐MB‐231 cells using flow cytometry. We found that 10, 20, 40, and 80 µM Art significantly increased cell apoptosis to 8.71%, 18.99%, 44.26%, and 74.53%, respectively (Figure 4a,c). In addition, western blot analysis showed that treatment with Art increased caspase‐3, caspase‐9, and Bax expression, but downregulated Bcl‐2 expression (Figure 4b,d–g). These results indicate that Art activates the mitochondrial apoptotic pathway in MDA‐MB‐231 cells.

Figure 4.

Figure 4

Open in a new tab

Art altered expression of MAPK and apoptotic signaling pathway of MDA‐MB‐231 cells. MDA‐MB‐231 cells were incubated with or without Art (0, 10, 20, 40, 80 μM) for 24 hr. (a) Flow cytometric analysis of Art‐treated MDA‐MB‐231 cells. (b) Cell lysates were analyzed for expression of Bcl‐2, Bax, caspase‐3, caspase‐9, JNK, p38, and ERK signaling pathway proteins using western blot analysis. (c) The percentage of apoptosis were counted. (d–j) Gray values of Bax, Bcl‐2, caspase‐3, caspase‐9, p‐p38, p‐ERK, and p‐JNK were counted (*p < 0.05, **p < 0.01, and ***p < 0.001). Art: artemisinin; Bcl‐2: B‐cell lymphoma 2; Bax: BCL2‐associated X; p‐ERK: phosphorylated extracellular signal‐regulated kinase; JNK: c‐Jun N‐terminal kinase; MAPK: mitogen‐activated protein kinase [Color figure can be viewed at wileyonlinelibrary.com]

3.7. Art suppresses ERK and activates c‐Jun N‐terminal kinase (JNK) and p38 in MDA‐MB‐231 cells

We evaluated the effects of 0, 10, 20, 40, and 80 µM Art on MAPK signaling in MDA‐MB‐231 cells. Western blot analysis showed that treatment with Art increased p‐JNK and p‐p38 expression but decreased ERK expression (Figure 4b,h–j) indicating that Art inhibits MDA‐MB‐231 cell proliferation via the MAPK signaling pathway.

3.8. Art inhibits RANKL‐induced osteoclastogenesis and osteoclast‐specific gene expression in vitro

After BMMs were treated with M‐CSF, RANKL, and different concentrations of Art, the cells in the different treatment groups were tartrate‐resistant acid phosphatase (TRAP) stained, and we identified positively stained cells containing more than three nuclei as osteoclasts (Figure 5a). Our data showed that Art inhibited differentiation of osteoclasts and that the number of osteoclasts decreased as the Art concentration increased. To determine whether Art inhibits osteoclast formation because it is cytotoxic to osteoclasts, a cell viability assay was performed. The semi‐inhibitory concentrations of Art on BMMs after 24, 48, 72, 96, and 120 hr were 598.571, 166.513, 87.15, 21.322, and 16.602 µM, respectively. Because these Art concentrations are higher than the 1 µM Art concentration required to inhibit osteoclast differentiation, it appears that Art‐induced inhibition of osteoclast formation is not due to toxicity (Figure 5b). Investigating the effects of Art on osteoclast differentiation‐associated gene expression, we found that 2, 5, and 10 µM Art inhibited transcription of the genes encoding cathepsin K (CTSK), nuclear factor of activated T cells 1 (NFATc1), tartrate‐resistant acid phosphatase (TRACP), and calcitonin receptor, in a concentration‐dependent manner (Figure 5c); ATPase H+ transporting V0 subunit D2 (ATP6v0d2) expression was not inhibited by 2 µM Art but was inhibited by 5 and 10 µM Art in a concentration‐dependent manner.

Figure 5.

Figure 5

Open in a new tab

Art inhibited RANKL‐induced osteoclastogenesis. (a) TRAP stained BMMs treated with various concentrations of Art, 30 ng/ml M‐CSF, and 50 ng/ml RANKL for 5–7 days, Scale bars = 100 µm. (b) BMMs were cultured for the indicated times with the indicated Art concentrations, M‐CSF (30 ng/ml). Cell viability was determined using cell counting kit‐8 assay and IC 50 values were calculated. (c) Real‐time reverse transcription polymerase chain reaction determined mRNA expression of CTSK, ATP6v0d2, NFATc1, calcitonin receptor, and TRACP by BMMs incubated for 5 days with M‐CSF and RANKL in the presence or absence of Art (*p < 0.05, **p < 0.01, and ***p < 0.001). Art: artemisinin; BMM: bone marrow‐derived macrophage; CTSK: cathepsin K; M‐CSF: macrophage colony‐stimulating factor; mRNA: messenger RNA; NFATc1: nuclear factor of activated T cells 1; RANKL: receptor activator of nuclear factor‐κB ligand; TRAP: tartrate‐resistant acid phosphatase [Color figure can be viewed at wileyonlinelibrary.com]

3.9. Art suppressed bone resorption in vitro

We determined whether Art could inhibit bone resorption in vitro by seeding BMMs in a CaP‐coated 48‐well plate, treating with various concentrations of Art for 120 hr, and evaluating the formation of multinucleated osteoclasts [Correction added on 28 Dec 2018, after first online publication: in the preceding sentence, 24 hr was corrected to 120 hr]. The areas of bone resorption were quantified in Image Pro Plus 6.0 software (NIH, Bethesda). Art was found to inhibit bone resorption in a concentration‐dependent manner (Figure 6).

Figure 6.

Figure 6

Open in a new tab

Art suppressed osteoclast‐associated bone resorption in vitro. BMMs were plated onto CaP‐coated 48‐well plates and were treated with the indicated Art concentrations. The cells that were attached to the 48‐well plates were removed and photographed under a light microscope. The mean total areas of the resorption pits formed in the presence of the three tested concentrations of Art (measured in Image J) are presented in the graph (**p < 0.01 ***p < 0.001). Art: artemisinin; BMM: bone marrow‐derived macrophage; CaP: calcium phosphate; NS: not significant [Color figure can be viewed at wileyonlinelibrary.com]

3.10. Art suppressed NF‐kB signaling during in vitro osteoclastogenesis

To explore the mechanism of Art‐induced inhibition of osteoclast formation, we evaluated the key signaling pathways that influence osteoclast formation. Because NF‐κB and MAPK signaling pathways are key signaling pathways of osteoclast formation, we studied the effects of Art on ERK, JNK, p38, phosphorylated (p)‐ERK, JNK, p‐JNK, p38, p‐p38, NF‐κBp65, and p‐NF‐κBp65, protein expression using western blot analysis. We found that Art suppressed phosphorylation of NF‐κBp65, however, Art did not inhibit p‐ERK, p‐JNK, and p‐p38 expression (Figure 7) indicating that Art inhibits RANKL‐dependent NF‐κB pathways.

Figure 7.

Figure 7

Open in a new tab

Art altered expression of NF‐κB signaling pathway proteins during osteoclastogenesis. BMMs were incubated with or without 1 μM Art for 3 hr followed by incubation with 50 ng/ml RANKL for the indicated time periods (above gels). Cell lysates were analyzed for expression of NF‐κBp65 and MAPK signaling pathway proteins using western blot analysis (**p < 0.01 and ***p < 0.001). BMM: bone marrow‐derived macrophage; MAPK: mitogen‐activated protein kinase; NF‐κB: nuclear factor‐κB; NF‐κBp65: nuclear factor NF‐κB p65 subunit; RANKL: receptor activator of nuclear factor‐κB ligand

4. DISCUSSION

In this study, we confirmed, for the first time, that Art inhibits osteoclast formation and activity without toxicity. We also confirmed that Art alters expression of the osteoclast genes CTSK, ATP6v0d2, NFATc1, calcitonin receptor, and TRACP in a concentration‐dependent manner. In a bone resorption experiment, we confirmed that Art inhibits osteoclast activity and formation in a concentration‐dependent manner. NF‐κB is a transcription factor in the NF‐κB/Rel family and it plays a role in bone formation. In resting cells, NF‐κB is the source of NF‐κBp50/p65 subunits. The polymer form of NF‐κB combines with I‐κB in the cytoplasm. When TRAF6 activates NF‐κB inducing kinase and I‐κB kinase, NF‐κB, and I‐κB separate, enter the nucleus, and target mature osteoclast differentiation and apoptosis gene promoters. The MAPK signaling pathway, which includes ERK, p38, and JNK, is also important for osteoclastogenesis. It has been shown that ERK is required for survival, apoptosis, and differentiation of osteoclasts, and inhibition of ERK has been shown to inhibit osteoclastogenesis (Miyazaki et al., 2000). P38 is partially required for early osteoclast formation and inhibits p38 by disrupting osteoclastogenesis (Matsuo, Owens, Elliott, Chambers, & Wagner E., 2000). The JNK pathway has been shown to regulate osteoclasts apoptosis (Ikeda et al., 2004). We studied the effects of Art on members of the NFκBp65 and MAPK signaling pathway, and we found that Art inhibited activation of NFκBp65 but did not inhibit activation of ERK, p38, or JNK.

Bone metastasis is a serious complication of modern breast cancer that can lead to soreness, pathological fracture, and hypercalcemia, which sharply reduce a patient's quality of life (Casimiro, Guise, & Chirgwin, 2009; Coleman, 1997; Coleman, Smith, & Rubens, 1998; Costa & Major, 2009). There are numerous hypotheses regarding breast cancer bone metastasis, including the seed and soil theory, which suggests an interaction between the bone matrix and adenocarcinomas. Breast cancer cells express the NF‐κB receptor ligand RANKL, which stimulates growth of osteoclasts, and in turn, osteoclasts express TGF‐β, which stimulates the growth of tumor cells; this is generally accepted as the explanation for breast cancer bone metastasis (Guise et al., 2006; Mundy, 2002; Yoneda & Hiraga, 2005; Zhang et al., 2010). Although the mechanism of breast cancer bone metastasis is not fully elucidated, breast cancer bone metastasis has been shown to associate strongly with bone dissolution and destruction (Guise et al., 2006; Hayashida et al., 2012; Mundy, 2002; Park et al., 2007; Yoneda & Hiraga, 2005). Previous studies have shown that Bcl‐2 and Bax are involved in the regulation of apoptosis. Bcl‐2 regulates the release of Ca2+ from the endoplasmic reticulum, regulates nuclear membrane permeability and transport of nuclear material, maintains the integrity of the mitochondrial inner and outer membranes, and inhibits the release of cytochrome c, the outflow of protons, and the transmembrane potential in the mitochondria to inhibit cell apoptosis. In contrast, Bax alters the permeability of the mitochondrial membrane, promotes the release of cytochrome c, activates caspase‐3, and induces tumor cell apoptosis. Thus, Bax and Bcl‐2 have mutually antagonistic biological effects (Haeberlein, 2004; Tan et al., 2005).

The ERK signal transduction pathway is involved in various biological responses, including cell differentiation and apoptosis, and activation of the ERK pathway allows a cell to resist apoptosis (Alejandro & Johnson, 2008; Mansour et al., 1994). It has also been confirmed that hypoxia indirectly upregulates telomerase activity in solid tumor cells by activating ERK. In tumor cells, activated p38 enhances c‐myc expression, phosphorylates p53, and participates in Fas/Fasl mediated apoptosis. Activated p38 can also enhance TNF‐a expression and induce apoptosis by acting on caspases (Lim, Lee, & Lee, 2006; Xia, Dickens, Raingeaud, Davis, & Greenberg, 1995). The JNK signaling transduction pathway is also involved in apoptosis. The JNK pathway mediates apoptosis of tumor cells through phosphorylation of Bcl‐2, which promotes the release of cytochrome c in mitochondria, activates the caspase cascade reaction, and finally acts on caspase‐3, which leads to apoptosis (Brosseau, Pirianov, & Colston, 2010; Guma et al., 2009). We found that Art inhibits activation of ERK and Bcl‐2 and promotes JNK, p38, caspase‐9, and caspase‐3 activation.

Recently, molecules, including tanshinone type IIA, curcumin, and hydrastis, have been isolated from Chinese herbal medicines and have been shown to inhibit osteoclast activity (Bharti, Takada, & Aggarwal, 2004; Hu et al., 2008; Kwak et al., 2006). Art is a molecule that was isolated from the Chinese medicinal plant A. annua (Hayashi et al., 2012) and is widely used in the treatment of malaria (Rosenthal, 2008). Recently, in China, artesunate, a derivative of Art, has been used by some clinicians to treat rheumatoid arthritis, osteoporosis, and bone metastatic tumors (Boyle, Simonet, & Lacey, 2003), thus Art has potential as a therapeutic for the treatment of bone disease.

It has been shown that dihydroartemisinin, a derivative of Art, inhibits the proliferation of breast cancer cells (Wu et al., 2013). We used CCK‐8 cell activity, migration, invasion, colony formation, and western blot assays to compare the effects of Art on breast cancer cells and on osteoclasts. Our data suggest that Art inhibits breast cancer‐induced osteolysis by inhibiting osteoclasts and breast cancer cells but primarily by inhibiting osteoclasts. We established a nude mouse breast cancer bone metastasis model and evaluated tumor tissues using micro‐CT scan and serology. In the nude mouse model, we performed TRAP staining of the tibia platform and found that Art inhibited osteoclast formation in vivo and inhibited expression of the osteoclast‐associated factors CTX‐1, OSCAR, and RANKL, thereby inhibiting bone resorption. In addition, Art reduced both the lengths and widths of tumors. We also demonstrated that Art is safe and nontoxic using in vitro CCK‐8 experiments and in vivo TUNEL staining of nude mice tissues.

Although we were able to demonstrate that Art inhibits osteoclast formation by regulating RANKL and NFκB signaling pathways, additional signaling pathways and molecules may be involved. Further, Art may inhibit osteoclast formation and bone dissolution by affecting osteoblast formation. Future research is also required to identify methods to directly inhibit MDA‐MB‐231 cell proliferation within the bone.

In summary, this study demonstrates that Art inhibits differentiation of osteoclast precursor cells without toxicity, thereby inhibits osteoclast‐induced soluble bone destruction and MDA‐MB‐231 cell proliferation within bone. We also showed that Art reduced expression of CTSK, ATP6v0d2, NFATc1, calcitonin receptor, and TRACP and inhibited of NFκBp65 activation. Art also promotes apoptosis of MDA‐MB‐231 cells by activating apoptosis pathways. In conclusion, Art could become an effective drug to control bone metastasis in breast cancer.

CONFLICTS OF INTEREST

The authors declare that there are no conflicts of interests.

ACKNOWLEDGMENTS

This study was supported by the National Natural Science Foundation of China (81760390, 81760402, and 81560371), the Key Program of Guangxi Collaborative Innovation Center for Biomedicine (GCICB‐SR‐2017005), the Guangxi Natural Science Foundation (2017GXNSFAA198258 and 2015GXNSFBA139158), the Guangxi Scientific Research and Technology Development Program (S201655 and S201668), the Guangxi Health and Family Planning Commission Program (GZLC‐16–32), and the Innovative Project for Guangxi Graduate Education (YCSW2017101 and YCBZ2018035).

Li J, Feng W, Lu H, et al. Artemisinin inhibits breast cancer‐induced osteolysis by inhibiting osteoclast formation and breast cancer cell proliferation. J Cell Physiol. 2018;234:12663–12675. 10.1002/jcp.27875

Jia Li and Wenyu Feng have contributed equally.

Contributor Information

Qingjun Wei, Email: weiqingjungxnn@163.com.

Jun Yao, Email: yaojun800524@126.com.

References

REFERENCES

  1. Alejandro, E. U. , & Johnson, J. D. (2008). Inhibition of Raf‐1 alters multiple downstream pathways to induce pancreatic beta‐cell apoptosis. Journal of Biological Chemistry, 283(4), 2407–2417. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bharti, A. C. , Takada, Y. , & Aggarwal, B. B. (2004). Curcumin (diferuloylmethane) inhibits receptor activator of NF‐kappa B ligand‐induced NF‐kappa B activation in osteoclast precursors and suppresses osteoclastogenesis. Journal of Immunology, 172(10), 5940–5947. [DOI] [PubMed] [Google Scholar]
  3. Boyle, W. J. , Simonet, W. S. , & Lacey, D. L. (2003). Osteoclast differentiation and activation. Nature, 423(6937), 337–342. [DOI] [PubMed] [Google Scholar]
  4. Brosseau, C. M. , Pirianov, G. , & Colston, K. W. (2010). Involvement of stress activated protein kinases (JNK and p38) in 1,25 dihydroxyvitamin D3‐induced breast cell death. Steroids, 75(13), 1082–1088. [DOI] [PubMed] [Google Scholar]
  5. Casimiro, S. , Guise, T. A. , & Chirgwin, J. (2009). The critical role of the bone microenvironment in cancer metastases. Molecular and Cellular Endocrinology, 310(1‐2), 71–81. [DOI] [PubMed] [Google Scholar]
  6. Cocchi, M. , Tonello, L. , Gabrielli, F. , & Pregnolato, M. (2011). Depression, osteoporosis, serotonin and cell membrane viscosity between biology and philosophical anthropology. Annals of General Psychiatry, 10, 9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Coleman, R. , Smith, P. , & Rubens, R. (1998). Clinical course and prognostic factors following bone recurrence from breast cancer. British Journal of Cancer, 77(2), 336–340. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Coleman, R. E. (1997). Skeletal complications of malignancy. Cancer, 80(8 Suppl), 1588–1594. [DOI] [PubMed] [Google Scholar]
  9. Costa, L. , & Major, P. P. (2009). Effect of bisphosphonates on pain and quality of life in patients with bone metastases. Nature Clinical Practice Oncology, 6(3), 163–174. [DOI] [PubMed] [Google Scholar]
  10. Cui, Y. , Niziolek, P. J. , MacDonald, B. T. , Alenina, N. , Matthes, S. , Jacobsen, C. M. , … Robling, A. G. (2014). Reply to Lrp5 regulation of bone mass and gut serotonin synthesis. Nature Medicine, 20(11), 1229–1230. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Galli, C. , Macaluso, G. , & Passeri, G. (2013). Serotonin: A novel bone mass controller may have implications for alveolar bone. Journal of Negative Results in Biomedicine, 12, 12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Guise, T. A. , Mohammad, K. S. , Clines, G. , Stebbins, E. G. , Wong, D. H. , Higgins, L. S. , … Chirgwin, J. M. (2006). Basic mechanisms responsible for osteolytic and osteoblastic bone metastases. Clinical Cancer Research, 12(20 Pt 2), 6213s–6216s. [DOI] [PubMed] [Google Scholar]
  13. Guma, M. , Rius, J. , Duong‐Polk, K. X. , Haddad, G. G. , Lindsey, J. D. , & Karin, M. (2009). Genetic and pharmacological inhibition of JNK ameliorates hypoxia‐induced retinopathy through interference with VEGF expression. Proceedings of the National Academy of Sciences of the USA, 106(21), 8760–8765. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Haeberlein, S. L. B. (2004). Mitochondrial function in apoptotic neuronal cell death. Neurochemical Research, 29(3), 521–530. [DOI] [PubMed] [Google Scholar]
  15. Hayashi, M. , Nakashima, T. , Taniguchi, M. , Kodama, T. , Kumanogoh, A. , & Takayanagi, H. (2012). Osteoprotection by semaphorin 3A. Nature, 485(7396), 69–74. [DOI] [PubMed] [Google Scholar]
  16. Hayashida, T. , Jinno, H. , & Kitagawa, Y. (2012). Epithelial‐mesenchymal transition and tumor microenvironment propose the seed and soil theory of the present age. Nippon Rinsho. Japanese Journal of Clincal Medicine, 70(Suppl 7), 203–207. [PubMed] [Google Scholar]
  17. Hu, J. P. , Nishishita, K. , Sakai, E. , Yoshida, H. , Kato, Y. , Tsukuba, T. , & Okamoto, K. (2008). Berberine inhibits RANKL‐induced osteoclast formation and survival through suppressing the NF‐kappaB and Akt pathways. European Journal of Pharmacology, 580(1‐2), 70–79. [DOI] [PubMed] [Google Scholar]
  18. Ikeda, F. , Nishimura, R. , Matsubara, T. , Tanaka, S. , Inoue, J. , Reddy, S. V. , … Yoneda, T. (2004). Critical roles of c‐Jun signaling in regulation of NFAT family and RANKL‐regulated osteoclast differentiation. Journal of Clinical Investigation, 114(4), 475–484. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Inose, H. (2010). Control of bone remodeling by nervous system. The role of serotonin in the regulation of bone metabolism. Clinical Calcium, 20(12), 1850–1956. [PubMed] [Google Scholar]
  20. Jiang, H. , Wang, Z. , Wang, Y. , Xie, K. , Zhang, Q. , Luan, Q. , … Liu, D. (2013). Antidepressant‐like effects of curcumin in chronic mild stress of rats: Involvement of its anti‐inflammatory action. Progress in Neuro‐Psychopharmacology and Biological Psychiatry, 47, 33–39. [DOI] [PubMed] [Google Scholar]
  21. Kim, M. H. , Ryu, S. Y. , Bae, M. A. , Choi, J. S. , Min, Y. K. , & Kim, S. H. (2008). Baicalein inhibits osteoclast differentiation and induces mature osteoclast apoptosis. Food and Chemical Toxicology, 46(11), 3375–3382. [DOI] [PubMed] [Google Scholar]
  22. Kwak, H. B. , Yang, D. , Ha, H. , Lee, J. H. , Kim, H. N. , Woo, E. R. , … Lee, Z. H. (2006). Tanshinone IIA inhibits osteoclast differentiation through down‐regulation of c‐Fos and NFATc1. Experimental & Molecular Medicine, 38(3), 256–264. [DOI] [PubMed] [Google Scholar]
  23. Li, Z. , Li, Q. , Wu, J. , Wang, M. , & Yu, J. (2016). Artemisinin and its derivatives as a repurposing anticancer agent: What else do we need to do? Molecules, 21(10), 1331. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Lim, S. J. , Lee, Y. J. , & Lee, E. (2006). p38MAPK inhibitor SB203580 sensitizes human SNU‐C4 colon cancer cells to exisulind‐induced apoptosis. Oncology Reports, 16(5), 1131–1135. [PubMed] [Google Scholar]
  25. Mansour, S. , Matten, W. , Hermann, A. , Candia, J. , Rong, S. , Fukasawa, K. , … Ahn, N. (1994). Transformation of mammalian cells by constitutively active MAP kinase kinase. Science, 265(5174), 966–970. [DOI] [PubMed] [Google Scholar]
  26. Mariotti, A. (2008). Bisphosphonates and osteonecrosis of the jaws. Journal of Dental Education, 72(8), 919–929. [PubMed] [Google Scholar]
  27. Matsuo, K. , Owens, J. M. , Elliott, C. , Chambers, T. , & Wagner, E. (2000). Fosl1 is a transcriptional target of c‐Fos during osteoclast differentiation. Nature Genetics, 24(2), 184–187. [DOI] [PubMed] [Google Scholar]
  28. Miyazaki, T. , Katagiri, H. , Kanegae, Y. , Takayanagi, H. , Sawada, Y. , Yamamoto, A. , … Tanaka, S. (2000). Reciprocal role of ERK and NF‐κB pathways in survival and activation of osteoclasts. Journal of Cell Biology, 148(2), 333–342. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Mundy, G. R. (2002). Metastasis to bone: Causes, consequences, and therapeutic opportunities. Nature Reviews Cancer, 2(8), 584–593. [DOI] [PubMed] [Google Scholar]
  30. Ooi, L. L. , Zheng, Y. , Stalgis‐Bilinski, K. , & Dunstan, C. R. (2011). The bone remodeling environment is a factor in breast cancer bone metastasis. Bone, 48(1), 66–70. [DOI] [PubMed] [Google Scholar]
  31. Park, B. K. , Zhang, H. , Zeng, Q. , Dai, J. , Keller, E. T. , Giordano, T. , … Wang, C. Y. (2007). NF‐kappaB in breast cancer cells promotes osteolytic bone metastasis by inducing osteoclastogenesis via GM‐CSF. Nature Medicine, 13(1), 62–69. [DOI] [PubMed] [Google Scholar]
  32. Remus, J. L. , Stewart, L. T. , Camp, R. M. , Novak, C. M. , & Johnson, J. D. (2015). Interaction of metabolic stress with chronic mild stress in altering brain cytokines and sucrose preference. Behavioral Neuroscience, 129(3), 321–330. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Roodman, G. D. (2004). Mechanisms of bone metastasis. Discovery Medicine, 4(22), 144–148. [PubMed] [Google Scholar]
  34. Rosenthal, P. J. (2008). Artesunate for the treatment of severe falciparum malaria. New England Journal of Medicine, 358(17), 1829–1836. [DOI] [PubMed] [Google Scholar]
  35. Sadava, D. , Phillips, T. , Lin, C. , & Kane, S. E. (2002). Transferrin overcomes drug resistance to artemisinin in human small‐cell lung carcinoma cells. Cancer Letters, 179(2), 151–156. [DOI] [PubMed] [Google Scholar]
  36. Suva, L. J. , Washam, C. , Nicholas, R. W. , & Griffin, R. J. (2011). Bone metastasis: Mechanisms and therapeutic opportunities. Nature Reviews Endocrinology, 7(4), 208–218. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Takayanagi, H. (2007). Osteoimmunology: Shared mechanisms and crosstalk between the immune and bone systems. Nature Reviews Immunology, 7(4), 292–304. [DOI] [PubMed] [Google Scholar]
  38. Tan, K. O. , Fu, N. Y. , Sukumaran, S. K. , Chan, S. L. , Kang, J. H. , Poon, K. L. , … Yu, V. C. (2005). MAP‐1 is a mitochondrial effector of Bax. Proceedings of the National Academy of Sciences of the USA, 102(41), 14623–14628. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Teitelbaum, S. L. (2000). Bone resorption by osteoclasts. Science, 289(5484), 1504–1508. [DOI] [PubMed] [Google Scholar]
  40. Walsh, M. C. , Kim, N. , Kadono, Y. , Rho, J. , Lee, S. Y. , Lorenzo, J. , & Choi, Y. (2006). Osteoimmunology: Interplay between the immune system and bone metabolism. Annual Review of Immunology, 24, 33–63. [DOI] [PubMed] [Google Scholar]
  41. Wang, J. , Zhang, B. , Guo, Y. , Li, G. , Xie, Q. , Zhu, B. , … Chen, Z. (2008). Artemisinin inhibits tumor lymphangiogenesis by suppression of vascular endothelial growth factor C. Pharmacology, 82(2), 148–155. [DOI] [PubMed] [Google Scholar]
  42. Wei, C. M. , Liu, Q. , Song, F. M. , Lin, X. X. , Su, Y. J. , Xu, J. , … Zhao, J. M. (2018). Artesunate inhibits RANKL‐induced osteoclastogenesis and bone resorption in vitro and prevents LPS‐induced bone loss in vivo. Journal of Cellular Physiology, 233(1), 476–485. [DOI] [PubMed] [Google Scholar]
  43. Weilbaecher, K. N. , Guise, T. A. , & McCauley, L. K. (2011). Cancer to bone: A fatal attraction. Nature Reviews Cancer, 11(6), 411–425. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Wu, G. S. , Lu, J. J. , Guo, J. J. , Huang, M. Q. , Gan, L. , Chen, X. P. , & Wang, Y. T. (2013). Synergistic anti‐cancer activity of the combination of dihydroartemisinin and doxorubicin in breast cancer cells. Pharmacological Reports, 65(2), 453–459. [DOI] [PubMed] [Google Scholar]
  45. Xia, Z. , Dickens, M. , Raingeaud, J. , Davis, R. J. , & Greenberg, M. E. (1995). Opposing effects of ERK and JNK‐p38 MAP kinases on apoptosis. Science, 270(5240), 1326–1331. [DOI] [PubMed] [Google Scholar]
  46. Yoneda, T. , & Hiraga, T. (2005). Crosstalk between cancer cells and bone microenvironment in bone metastasis. Biochemical and Biophysical Research Communications, 328(3), 679–687. [DOI] [PubMed] [Google Scholar]
  47. Zhang, Y. , Ma, B. , & Fan, Q. (2010). Mechanisms of breast cancer bone metastasis. Cancer Letters, 292(1), 1–7. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Cellular Physiology are provided here courtesy of Wiley

RESOURCES