Characterization of scp3 and Its Expression Dynamics Identifies the Critical Period for Meiotic Initiation in Female Turbot (Scophthalmus maximus)

ABSTRACT

Synaptonemal complex protein 3 (Scp3), a structural component of the synaptonemal complex, serves as a key molecular marker for studying meiosis and germ cell development in teleosts. To elucidate the molecular mechanisms of germ cell meiosis and identify critical windows for sex differentiation in turbot (Scophthalmus maximus), a flatfish of considerable economic value in global aquaculture, this study cloned the full‐length cDNA sequence of the scp3 gene. The obtained sequence is 1094 bp in length, containing an open reading frame of 717 bp that encodes a polypeptide of 238 amino acids, with bioinformatic analyses revealing characteristic coiled‐coil domains. Tissue distribution analysis demonstrated that scp3 expression was predominantly restricted to the gonads. Quantitative PCR in an all‐female lineage revealed that transcripts were initially detectable at 25 days post‐hatching (dph), remained low until 55 dph, and increased significantly thereafter, peaking after 80 dph (p < 0.05). In situ hybridization localized scp3 mRNA to the cytoplasm of early primary oocytes. The expression window, initiating at 25 dph and intensifying from 60 dph, aligns with the initiation of meiotic prophase I and precedes morphological sex differentiation. These results indicate that scp3 functions as a reliable noninvasive molecular marker for the onset of meiosis in female turbot and may play a specific role in oocyte proliferation. This study provides a crucial theoretical foundation and key temporal information for further elucidating the molecular mechanism of sex differentiation and advancing all‐female population cultivation in turbot.

The meiotic marker scp3 was cloned and characterized in turbot, revealing expression onset at 25 dph prior to morphological ovarian differentiation. This expression window coincides with the thermosensitive period, highlighting a potential target phase for environmental sex control.

1. Introduction

Germ cells, as one of the two primordial cell lineages established during early embryogenesis, are fundamental to an individual's reproductive potential. Their development involves germline specification and progression through meiosis—a specialized form of cell division crucial for generating haploid gametes and ensuring genetic diversity (Penman and Piferrer 2008; Begum et al. 2022). A central component of this process is synaptonemal complex protein 3 (Scp3), a structural element of the synaptonemal complex that mediates chromosome synapsis and recombination during meiotic prophase I (Page and Hawley 2004; Syrjänen et al. 2014). The expression of scp3 is highly conserved across vertebrates and is widely utilized as a meiotic marker in teleosts, exhibiting stage‐specific expression during germ cell development. In zebrafish (Danio rerio), scp3 localizes to spermatocytes with a distinct nuclear pattern, affirming its role as a marker for spermatocytes and early spermatogonia (Ozaki et al. 2011). In black porgy (Acanthopagrus schlegelii), scp3 functions alongside dazl and dmc1 to sustain the meiotic competency of germ cells (Lau et al. 2013). Similarly, in catfish (Clarias gariepinus), scp3 is specifically expressed in germ cells during critical phases of gonadal development, suggesting gonadotropin‐mediated regulation of meiosis (Laldinsangi and Senthilkumaran 2018). Collectively, these studies highlight the utility of scp3 in predicting the onset of gonadal differentiation in teleosts. It should be noted, however, that meiosis is regulated by a complex network of interacting genes—including dazl, dmc1, boule, and sycp1—and scp3 represents one component of this broader regulatory framework (Li et al. 2011; Wang et al. 2023). Therefore, while scp3 serves as a valuable marker for meiotic entry, its expression dynamics must ultimately be integrated with those of other molecular markers to fully elucidate the regulatory hierarchy governing germ cell development in turbot.

The turbot (Scophthalmus maximus), a high‐value flatfish species with expanding global production and significant economic importance in aquaculture, exhibits significant sexual growth dimorphism, with females growing faster and attaining larger sizes than males (Imsland et al. 1997; Meng et al. 2023). This female growth advantage makes the production of all‐female populations highly desirable for improving aquaculture profitability. Although a female heterogametic (ZW/ZZ) sex determination system has been identified, with sox2 proposed as a candidate sex‐determining gene (Martínez et al. 2021), the molecular and cellular mechanisms underlying sex differentiation and germ cell meiosis remain poorly characterized. Previous studies employing steroid treatment (Haffray et al. 2009), histology (Han 2011; Zhao et al. 2017), and gene expression analysis (Robledo et al. 2015; Ribas et al. 2016; Martínez et al. 2021) have failed to establish a consistent timeline for sex differentiation. Accurately determining the initiation of sex differentiation is essential for developing environmental sex control methods, such as temperature manipulation, to effectively maintain genotypic sex and achieve monosex female production. The histological chronology of gonadal sex differentiation in turbot has been documented in several studies. Using detailed histological analysis, Zhao et al. (2017) systematically described the early events of gonadal development: six to nine individual primordial germ cells (PGCs) with large nuclei were observed until 15 days post‐hatching (dph), and these PGCs migrated along the dorsal mesentery toward the genital ridge from 0 to 15 dph. At 20 dph, aggregation of somatic cells at the genital ridge indicated the formation of the primary gonad, with PGC numbers increasing to approximately 60 and vasa expression being upregulated. Undifferentiated gonads continued to grow from 20 to 35 dph, followed by cytological gonadal differentiation during 36–52 dph. Ovarian cavity formation was first evident at approximately 60 dph, and meiotic oocytes appeared by 75 dph. More recently, a concurrent histological investigation by our research group, using the same all‐female turbot population employed in the present study, has further refined this chronology: ovarian cavity formation commences at 45 dph (37.4 mm TL), meiotic oocytes first appear at 65 dph, and a critical thermosensitive window for sex determination spans 28–54 dph (Meng et al. 2026). It is also known that female turbot enters meiosis earlier than males (Viñas et al. 2012; Meng et al. 2016). Despite this well‐characterized histological framework, the molecular markers that signal the onset of meiotic commitment prior to visible morphological changes remain poorly defined. While scp3 expression has been characterized during spermatogenesis in adult males (Feng et al. 2017), its expression dynamics and potential role in early female gonadal development remain unknown, representing a significant gap in understanding the timing of meiotic initiation in females.

In this study, we cloned the full‐length cDNA of scp3 in turbot and analyzed its tissue distribution in adults. Using an all‐female progeny, we further examined the spatiotemporal expression pattern of scp3 during early gonadal development via quantitative PCR and in situ hybridization. Our objective was to precisely define the onset of meiosis and the window of sex differentiation in females, thereby providing a molecular basis for targeting the labile period with temperature treatments to guide phenotypic sex toward femaleness. The findings provide critical insights into the timing of meiotic initiation and advance the understanding of sex differentiation mechanisms in turbot, and offer basic data for further exploring the role of the scp3 gene in ovarian differentiation and development in turbot and other fish species.

2. Materials and Methods

2.1. Fish and Sample Collection

An all‐female turbot population was generated by crossing super‐female (WW♀) and common male (ZZ♂) broodstock, obtained from Qingdao General Aquaculture Co. Ltd. Since all offspring from a WW × ZZ cross inherit a Z chromosome from the father and a W chromosome from the mother, the resulting population is genetically 100% female (ZW) (Meng et al. 2016). Larvae and juveniles were reared in a flow‐through seawater system under natural photoperiod conditions (approximately 12 h light:12 h dark during the sampling period). Water temperature was maintained at 18.0°C ± 0.5°C, salinity at 30 ± 1 ppt, and dissolved oxygen above 6.0 mg/L throughout the rearing and sampling period. Although no universal sex‐linked molecular markers are currently available for direct genetic sex verification in turbot, previous experiments conducted by our group have confirmed that turbot reared at 18°C prior to 60 dph do not undergo sex reversal (Meng et al. 2026). Therefore, under the controlled rearing conditions employed in this study, the confounding effects of environmental sex reversal on phenotypic sex are effectively eliminated. The all‐female turbot population and sampling scheme used in this study are identical to those described in a concurrent histological investigation of gonadal sex differentiation (Meng et al. 2026), ensuring direct comparability between molecular and histological data sets. Gonadal tissues were sampled from this all‐female juvenile cohort (15–120 dph). This sampling window was selected to encompass the entire period of gonadal sex differentiation in turbot, spanning from the undifferentiated gonad stage (20–35 dph), through cytological differentiation (36–52 dph), to the completion of ovarian differentiation with cavity formation (~60 dph) and the appearance of meiotic oocytes (~75 dph) as described by Zhao et al. (2017). Sampling was performed at 5‐day intervals starting at 15 dph, with 6–8 individuals collected per time point. Prior to sampling, fish were anesthetized with 150 mg/L tricaine methanesulfonate (MS‐222; Sigma, St. Louis, MO, USA).

For larvae up to 30 dph, heads and tails were removed, and the remaining body was fixed intact. For juveniles aged 30–75 dph, visceral organs were dissected before fixation. From 75 dph onwards, only ovarian tissues were collected and fixed. All samples were stored at −80°C for subsequent RNA extraction.

Additionally, tissues from three female and three male adult turbot (18 months post‐hatching, mph), with an average body weight of 1002.33 ± 53.6 g, were sourced from the artificial breeding stock of Yantai Development Zone Tianyuan Aquatic Products Co. Ltd. Various tissues—including brain, pituitary, kidney, spleen, gill, heart, intestine, stomach, ovary, and testis—were collected for tissue distribution analysis. Female turbot at 8 mph and 18 mph were also obtained from the same breeding stock. Ovarian samples from these fish were fixed in 4% paraformaldehyde (PFA) for histological sectioning and in situ hybridization.

2.2. RNA Extraction and cDNA Synthesis

Total RNA was extracted from tissue samples using the RNAprep Pure Animal Tissue RNA Kit (TIANGEN, Beijing, China), following the manufacturer's protocol. RNA integrity was assessed by 1% agarose gel electrophoresis, and concentration was determined spectrophotometrically (NanoDrop, GE, USA). Genomic DNA was removed using RNase‐free DNase I. First‐strand cDNA was synthesized from 1 µg of total RNA using the PrimeScript RT Reagent Kit (Takara, Dalian, China), with oligo(dT) and random hexamer primers as per the manufacturer's instructions. The cDNA was stored at −20°C.

2.3. Cloning and Full‐Length cDNA Amplification of scp3

Degenerate primers were designed based on conserved regions of scp3 orthologs from teleosts available in GenBank. A partial scp3 cDNA fragment was amplified by PCR using primers scp3‐F1/R1 (Table 1) in a 25 µL reaction mixture containing 12.5 µL Premix Taq (TaKaRa, Japan), 1 µL of each primer, and 100 ng cDNA. The thermal cycling protocol was optimized as follows: an initial denaturation step at 95°C for 5 min to ensure complete template unwinding; 35 cycles of denaturation at 95°C for 30 s, annealing at 62°C for 30 s, and extension at 72°C for 1 min; and a final extension step at 72°C for 5 min to ensure complete synthesis of all PCR products. Following amplification, the PCR amplicons were resolved by agarose gel electrophoresis. The target band corresponding to the partial scp3 cDNA was excised and purified using the FastPure Gel DNA Extraction Mini Kit (Vazyme, Nanjing, China) to remove residual agarose and nonspecific products. The purified fragment was then ligated into the pMD18‐T Vector (TaKaRa, Japan) for subsequent Sanger sequencing, ensuring accurate verification of the partial sequence.

Table 1.

Sequences of the primers used for gene cloning, expression analysis, and probe synthesis.

Primers	Primer sequence (5′–3′)
scp‐F1	GGSAAYGAGGTWCARWCHATGTTGG
scp‐R1	GACTTGCGRACWGTKGCCATCTC
race‐R1	TTCTGCAGCGTGGCCATCTCCTTCC
race‐R2	AGTCGTGGCTCTTCTCCATGTCCTCC
race‐F1	AGAGAGCAGAGGAGCAGGAGGAG
race‐F2	CATGGAGGACATGGAGAAGAGCCACG
scp‐qF	ACGCAACAGCAGGAGATGG
scp‐qR	ACAAAGTCCCCAAATGAACAGG
actin‐F	GTGGAGCGATTTGTCTGGTT
actin‐R	CTCAATCTCGTGTGGCTGAA
scp‐probeFa	ATTTAGGTGACACTATAGAACCACCACAGTCAGAGGCAG
scp‐probeRa	TAATACGACTCACTATAGGGCCATCTCCTGTTGTTGCGT

Note: S = C/G, Y = C/T, W = A/T, R = A/G, H = A/C/T, K = G/T.

^a Annealing temperature for probe template amplification was 64°C.

To obtain the full‐length cDNA, 5′‐ and 3′‐ rapid amplification of cDNA ends (RACE) were performed using a commercial kit (Accurate Biology, China). Gene‐specific primers (GSPs) were designed from the partial scp3 sequence. RACE involved a first‐round PCR with universal and GSP primers, followed by a nested PCR using nested GSP primers (Table 1). The thermal profile included 30 cycles of 94°C for 30 s, 64°C (first PCR) or 68°C (nested PCR) for 30 s, and 72°C for 3 min. RACE products were cloned, sequenced, and assembled with the partial sequence to reconstruct the full‐length scp3 cDNA.

2.4. Bioinformatic Analyses

The assembled scp3 cDNA sequence was analyzed using BLAST (NCBI). The open reading frame (ORF) and deduced amino acid sequence were identified with ORF Finder. ExPASy ProtParam was used to estimate the theoretical physicochemical properties of the Scp3 protein. Secondary structure was predicted with SOPMA, and the tertiary structure was modeled using SWISS‐MODEL. Signal peptides and protein domains were predicted using SignalP 6.0 and SMART, respectively. Nuclear localization signals were inferred with PSORT II.

The protein sequences of Scp3 from different species were downloaded from the NCBI website (organism: GenBank accession number): Paralichthys olivaceus (Japanese flounder): XP_019946061; Cynoglossus semilaevis (tongue sole): XP_008309588; Oncorhynchus mykiss (rainbow trout): AAT35600; Gobiocypris rarus (rare minnow): AID21699.1; Oryzias latipes (Japanese medaka): NP_001098182; Tachysurus fulvidraco (yellow catfish): AIT69835; D. rerio (zebrafish): NP_001035440; Cyprinus carpio (common carp): QIU81895; Oreochromis niloticus (Nile tilapia): XP_005449200; C. gariepinus (North African catfish): AUR45270; A. schlegelii (black porgy): AFV31618; Channa argus (northern snakehead): XP_067349466; and Mus musculus (house mouse): NP_035647. A multiple sequence alignment of Scp3 proteins from various vertebrates was generated using DNAMAN. A phylogenetic tree was constructed with MEGA 6.0 using the neighbor‐joining method, with bootstrap values calculated from 1000 replicates.

2.5. Semi‐Quantitative RT‐PCR

Tissue‐specific expression of scp3 was analyzed in adult turbot tissues via semi‐quantitative RT‐PCR, with β‐actin as an internal control (Gao et al. 2020) (primers listed in Table 1). Each 15 µL reaction contained 7.5 µL Premix Taq, 0.6 µL of each primer, and 0.5 µL cDNA. Amplification conditions were: 94°C for 30 s; 35 cycles of 94°C for 30 s, 62°C for 30 s, and 72°C for 1 min.

2.6. Quantitative Real‐Time PCR

The expression profile of scp3 during early gonadal development was quantified using a 7500 Real‐Time PCR System (Applied Biosystems, USA). Each 20 µL reaction contained 100 ng cDNA, 10 µL THUNDERBIRD Next SYBR qPCR Mix (TOYOBO, Japan), and 10 µM of each primer. The thermocycling protocol was: 95°C for 3 min; 45 cycles of 95°C for 7 s, 57°C for 10 s, and 72°C for 15 s; followed by melting curve analysis. Relative expression levels were calculated using the 2^−ΔΔCt method. Statistical significance (p < 0.05) was determined using one‐way ANOVA in SPSS 19.0.

2.7. In Situ Hybridization

A DIG‐labeled RNA probe targeting a nonconserved region of the scp3 coding sequence (CDS) was synthesized using the DIG RNA Labeling Kit (Roche, Germany). Probe primers (scp‐probeF and scp‐probeR) contained T7 and SP6 RNA polymerase promoter sequences (Table 1). Ovarian samples from 8 and 18 mph fish were fixed in 4% PFA, dehydrated, embedded in paraffin, and sectioned at 6 μm thickness. Section pretreatment, hybridization with the probe at 60°C for 15 h, post‐hybridization washes, and colorimetric detection using NBT/BCIP (Roche) were performed according to the method described by Li et al. (2017). Sections were examined and photographed under a Nikon ECLIPSE 80i microscope.

3. Results

3.1. Molecular Cloning of scp3

The full‐length cDNA of scp3 was successfully isolated from turbot ovarian tissue through a combined approach of core fragment amplification and rapid amplification of cDNA ends (RACE). Initial PCR yielded a 463 bp core fragment, while 5′‐ and 3′‐RACE produced products of 539 bp and 692 bp, respectively. The assembled complete cDNA sequence was 1094 bp in length, containing a 717 bp ORF that encodes a 238‐amino‐acid protein (Figure 1) and has been submitted to GenBank (Accession Number: PZ294890). Analysis of PCR products and sequencing chromatograms further indicated the presence of a single, uniform scp3 transcript, with no evidence of alternative splicing under the conditions examined.

Figure 1.

Nucleotide and deduced amino acid sequence of turbot scp3 cDNA. The start (ATG) and stop (TGA) codons are shaded. Conserved motifs (CM1 and CM2) are highlighted in black and gray boxes, respectively. The coiled‐coil domain is underlined.

3.2. Bioinformatic Analyses of scp3

ProtParam analysis predicted the Scp3 protein to have a molecular formula of C₁₁₈₉H₁₉₃₉N₃₅₃O₃₈₇S₁₅, a molecular weight of 27.85 kDa, and a theoretical pI of 7.72. The protein was predicted to be unstable (instability index = 66.74) and hydrophilic (GRAVY = −1.139). The amino acid composition included 40 negatively charged (Asp + Glu) and 41 positively charged (Arg + Lys) residues. Secondary structure prediction indicated a predominance of α‐helices (75.63%), with the remainder as random coils. Tertiary structure modeling showed highest similarity (80%) to the Scp3 protein of guppy (Poecilia reticulata) (SWISS‐MODEL ID: A0A3B3V5X7.1.A) (Figure 2A).

Figure 2.

Bioinformatic characterization of the turbot Scp3 protein. (A) Predicted three‐dimensional structural model generated by SWISS‐MODEL (https://swissmodel.expasy.org/) using homology‐based modeling. The model displayed the highest similarity (80%) to the Scp3 protein of guppy (Poecilia reticulata; UniProt ID: A0A3B3V5X7.1.A). (B) Schematic representation of the conserved Cor1 domain (amino acids 85–216, E value = 3.30 × 10⁻⁴⁶) identified using the Simple Modular Architecture Research Tool (SMART) (https://smart.embl.de/). The shaded boxes represent the conserved functional Cor1 domain.

A conserved Cor1 domain (amino acids 85–216), a characteristic structural domain of Scp3, was identified using SMART (Figure 2B). PSORT II predicted nuclear localization. No transmembrane domains or signal peptides were detected. Post‐translational modification analysis predicted 21 phosphorylation sites (15 serine and 6 threonine) and no N‐glycosylation sites.

3.3. Sequence Alignment and Phylogenetic Analysis

BLAST alignment showed that the turbot Scp3 amino acid sequence shared the highest identity with that of olive flounder (P. olivaceus) (84.87%), followed by A. schlegelii (84.52%) and Nile tilapia (O. niloticus) (84.45%). Multiple sequence alignment across selected teleost species and one mammalian representative (mouse) confirmed the presence of one coiled‐coil domain and two conserved motifs (CM1 and CM2) in turbot Scp3, consistent with other teleost orthologs (Figure 3).

Figure 3.

Multiple sequence alignment of Scp3 amino acid sequences from selected teleost species and mouse (Mus musculus). Conserved motifs (CM1 and CM2) and the coiled‐coil domain are indicated.

A neighbor‐joining phylogenetic tree constructed from Scp3 sequences distinctly partitioned the teleost and mammalian clades with strong bootstrap support. The turbot Scp3 robustly clustered within the teleost group, exhibiting the closest evolutionary relationship with P. olivaceus, and formed a monophyletic group with other perciform species including O. niloticus and A. schlegelii (Figure 4).

Figure 4.

Phylogenetic tree constructed based on Scp3 amino acid sequences from selected teleost species and mouse (Mus musculus) using the neighbor‐joining method in MEGA 6.0. Bootstrap values (1000 replicates) are shown at the nodes.

3.4. Tissue Distribution of scp3 Expression

Semi‐quantitative RT‐PCR analysis revealed that scp3 expression was restricted to the gonads in adult turbot (18 mph), with transcripts detected in both testis and ovary. No expression was observed in any somatic tissues examined, including brain, pituitary, kidney, spleen, gill, heart, intestine, and stomach, indicating a gonad‐specific expression pattern without sexual dimorphism (Figure 5).

Figure 5.

Tissue distribution of scp3 mRNA in adult turbot. M: DNA marker; O: ovary; T: testis; B: brain; P: pituitary; G: gill; St: stomach; Sp: spleen; I: intestine; L: liver; K: kidney; H: heart; Mu: muscle.

3.5. Expression Profile of scp3 During Gonadal Development

Analysis of scp3 transcript levels by quantitative RT‐PCR revealed that expression was first detectable at 25 dph and remained low but measurable throughout the period from 25 to 55 dph (Figure 6). A pronounced increase in transcript abundance was observed between 60 and 75 dph, followed by a sustained upward trend, with expression levels becoming significantly elevated from 80 dph onward (p < 0.05).

Figure 6.

Temporal expression profile of scp3 during early ovarian development (15–120 days post‐hatching, dph) in all‐female turbot. Relative mRNA levels were determined by quantitative real‐time PCR and normalized to β‐actin. Data are presented as mean ± SEM (n = 4–6 individuals per time point). Different lowercase letters (a, b, c, cd) above the bars indicate statistically significant differences among time points (one‐way ANOVA followed by Tukey's post hoc test, p < 0.05). Bars sharing the same letter are not significantly different. Key developmental events correlated with this expression profile are annotated below the x‐axis: primordial germ cell (PGC) proliferation and differentiation (~20–35 dph); onset of meiotic prophase I and initial scp3 detection (~25–55 dph); and the critical window for morphological ovarian differentiation (~75–90 dph), during which scp3 transcript levels increase markedly.

3.6. Cellular Localization of scp3 Transcripts in the Ovary

Histological examination by HE staining confirmed that ovarian tissues from 8 and 18 mph turbot were at the previtellogenic stage, containing stages I and II primary oocytes arranged along the ovarian lamellae (OL). Stage II oocytes exhibited nucleoli distributed along the nuclear membrane (Figure 7A,D). In situ hybridization demonstrated that scp3 mRNA was uniformly distributed in the cytoplasm of oocytes at both developmental stages (Figure 7B,E). No specific signal was detected in control sections hybridized with the sense probe (Figure 7C,F).

Figure 7.

Histological examination and cellular localization of scp3 transcripts in previtellogenic ovaries of turbot by in situ hybridization. Hematoxylin and eosin (H&E) staining of ovarian tissue at 8 months post‐hatching (mph) (A) and 18 mph (D), showing ovarian lamellae (OL) containing stage I (I) and stage II (II) primary oocytes. Stage II oocytes are characterized by multiple nucleoli (NU) distributed along the inner nuclear membrane. Hybridization with the antisense DIG‐labeled RNA probe for scp3 at 8 mph (B) and 18 mph (E). Positive hybridization signals are visible as purple‐blue precipitates within the cytoplasm of oocytes. Negative control sections hybridized with the corresponding sense probe at 8 mph (C) and 18 mph (F), showing no specific staining. Scale bars: 200 μm.

4. Discussion

The Scp3 protein, a core structural component of the synaptonemal complex lateral elements, facilitates DNA binding and homologous chromosome synapsis during meiosis, playing an essential role in recombination and crossover formation (Winters et al. 2014; Bollschweiler et al. 2019; Tian et al. 2023). Consistent with its meiotic function, expression of scp3 in turbot was restricted to gonadal tissues, a pattern also observed in closely related flatfish species such as P. olivaceus (Wang et al. 2023), as well as in other teleosts including D. rerio and C. gariepinus (Yuan et al. 2014; Laldinsangi and Senthilkumaran 2018). This conserved gonad‐specific expression among flatfishes reinforces the utility of scp3 as a meiotic marker within this commercially important taxonomic group.

In this study, we cloned and characterized the scp3 gene in turbot. The deduced amino acid sequence contained critical conserved domains, including the Cor1 motif and coiled‐coil regions, which are essential for synaptonemal complex assembly (Ozaki et al. 2011; Wang et al. 2023). Bioinformatics analysis revealed that the Scp3 protein harbors multiple potential phosphorylation sites (with no N‐glycosylation sites), suggesting that phosphorylation may be a critical mechanism regulating its function (Di Carlo et al. 2000). This finding is consistent with the post‐translational modification patterns of Scp3 observed in various vertebrates. In Monopterus albus (Y. Li et al. 2016), the apparent molecular weight of Scp3 is higher than its theoretical value, and this has been confirmed to be a phosphorylated form—reflecting that a similar regulatory mechanism may govern Scp3 function during meiosis in this species. Phylogenetic analysis of the selected teleost species further confirmed the sequence conservation of Scp3 within this group, which is highly consistent with the role of scp3 as a core component in meiosis. This evolutionary conservation provides the molecular basis for Scp3 to maintain its key meiotic functions, including homologous chromosome pairing and recombination (C. Yuan et al. 2014; L. Yuan et al. 2000). The coiled‐coil domain of the Scp3 protein can form stable α‐helical dimers, providing a structural basis for its interaction with Scp1 (the central element of the synaptonemal complex) (Guo et al. 2025; Syrjänen et al. 2014). As an evolutionarily conserved functional anchor, the Cor1 domain ensures the assembly and stability of homologous chromosome axes; this aligns with the molecular mechanism by which Scp3 mediates homologous chromosome synapsis in mammals (Page and Hawley 2003; Robledo et al. 2017).

Multiple sequence alignment results showed that the amino acid sequence of turbot Scp3 shares the highest homology (84.87%) with that of P. olivaceus. Additionally, all aligned species' Scp3 proteins contain coiled‐coil domains and two conserved sequences (CM1 and CM2). The observed sequence conservation, particularly within the Cor1 domain and coiled‐coil regions, is consistent with the essential role of Scp3 as a structural component of the synaptonemal complex lateral elements. In teleosts, this conserved architecture is thought to facilitate homologous chromosome pairing and recombination during meiotic prophase I (Yuan et al. 2014; Wang et al. 2023). The strong conservation of these motifs further supports the indispensable structural role of Scp3 during meiotic chromosome synapsis.

A persistent challenge in turbot aquaculture has been the scarcity of molecular markers for early sex identification. To address this, we utilized all‐female (ZW) populations derived from super‐female (WW♀) × common male (ZZ♂) crosses (Meng et al. 2016), which provided a genetically uniform model for investigating ovarian development. In these families, scp3 expression was initially detectable at 25 dph, remained at low levels until 55 dph, and then exhibited a marked and sustained increase from 60 dph onwards (p < 0.05), with expression levels continuing to rise through 120 dph. This expression window aligns with the histological onset of meiotic prophase I and early oogonial differentiation (Zhao et al. 2017), confirming scp3 as a dependable molecular marker for the onset of meiosis in female turbot.

The scp3 expression timeline established in this study aligns precisely with the histological chronology documented in the concurrent study using the same all‐female population (Meng et al. 2026). Specifically, scp3 transcripts are initially detectable at 25 dph—well before ovarian cavity formation at 45 dph—and undergo marked upregulation from 60 dph onward, immediately preceding the first appearance of meiotic oocytes at 65 dph. This tight temporal concordance between independent molecular and histological data sets confirms scp3 as a dependable early molecular marker for meiotic commitment in female turbot, capable of detecting meiotic initiation prior to visible morphological changes.

During gonadal development, the expression of scp3 mRNA in larval and juvenile turbot (15–120 dph) exhibits dynamic changes. Comparison with closely related flatfish species reveals both conserved and divergent features of scp3 expression. In P. olivaceus, scp3 expression is first localized in premeiotic oogonia at approximately 60 mm total length (TL), corresponding roughly to the juvenile stage, and peaks at oocyte stage I (Wang et al. 2023). In turbot, we detected scp3 transcripts as early as 25 dph (~20 mm TL), suggesting that meiotic commitment may initiate at an earlier developmental stage or smaller body size in this species. These differences underscore the importance of species‐specific characterization rather than relying solely on cross‐species extrapolation.

In M. albus (Li et al. 2016), Scp3 immunopositive signals can be detected in oogonia of the differentiating ovary at 7 dph, which coincided with the appearance of the ovarian cavity (a morphological marker for ovarian differentiation), thereby making it an early molecular marker for ovarian differentiation. In C. gariepinus (Laldinsangi and Senthilkumaran 2018), the expression of scp3 was upregulated both during the critical periods of gonadal development and at different stages of gonadal redevelopment, which reflected its indicative role in gametogenic activities. However, in gonochoristic fish such as O. latipes, scp3 alone was insufficient for effective identification of gonadal differentiation, and it was necessary to combine it with other markers (e.g., cyp19a1a). In A. schlegelii (Lau et al. 2013), scp3, together with dazl and dmc1, was regarded as a key factor in germ cell meiosis, and its expression was downregulated after estrogen treatment, suggesting that it may be involved in the estrogen‐mediated meiotic arrest process of germ cells. Spatiotemporal analysis further localized scp3 mRNA to the cytoplasm of early primary oocytes, affording cellular resolution that circumvents the challenges associated with isolating gonadal tissues during early developmental stages. The observed transcript dynamics—especially the onset of expression at 25 dph followed by a marked rise from 60 dph—indicate that scp3 activation is a key molecular event signifying the entry of female germ cells into meiosis. Notably, this molecular initiation precedes morphological sex differentiation, suggesting that the interval from 25 to 55 dph may represent a putative susceptible phase that could be influenced by environmental factors. Moreover, the scp3 expression window (25–55 dph) overlaps precisely with the thermosensitive period for sex determination (28–54 dph) identified in the concurrent histological study (Meng et al. 2026). This overlap provides direct experimental validation that the interval during which scp3 is first expressed corresponds to the developmental phase most susceptible to temperature‐induced masculinization. However, direct experimental manipulation (e.g., temperature‐shift trials) will be required to confirm the functional significance of this temporal window for sex control.

Elucidating the critical windows for sex determination and differentiation is essential for deciphering the regulatory mechanisms governing germ cell development in turbot. Previous transcriptomic studies have delineated key developmental phases through the expression patterns of genes such as cyp19a1a, amh, and vasa (Robledo et al. 2015; Ribas et al. 2016). For instance, sexually dimorphic gene expression emerges around 5–6 cm in total length (approximately 90 dph), signifying the onset of gonadal differentiation (Robledo et al. 2015). Similarly, the upregulation of PGC proliferation‐related genes (e.g., vasa, gsdf, tdrd1) occurs at 4–6 cm (75–90 dph), with ovarian differentiation being initiated around 5 cm (Ribas et al. 2016). In a genome‐wide association study, Martínez et al. (2021) reported a significant increase in sox2 expression in females at 55 dph, although no sexual dimorphism was detected for fxr1, dnajc19, or sox2. These molecular observations are corroborated by histological evidence indicating an increase in PGC number and vasa expression as early as 20–35 dph in presumptive females, well before morphological differentiation becomes apparent (Zhao et al. 2017).

The detection of scp3 transcripts prior to visible morphological differentiation suggests that this gene may serve as a useful molecular indicator for identifying the early phase of meiotic commitment. When combined with the histological timeline established in the concurrent study (Meng et al. 2026), this expression profile provides a temporal framework that could inform the design of future experiments aimed at environmental sex control, although direct functional validation remains necessary. The interval from 25 to 55 dph—spanning the initial detection and subsequent early rise in scp3 expression—represents a phase particularly amenable to environmental interventions, such as thermal treatment, to prevent sex reversal. This approach presents an environmentally sustainable, nonhormonal alternative for generating all‐female populations (Nakamura et al. 1998; Luckenbach et al. 2008; Haffray et al. 2009). The use of all‐female families in this study effectively minimized genetic variation, thereby enhancing the accuracy of ovarian developmental tracking and the reliability of the scp3 expression profile.

In practice, all‐female turbot populations can be achieved through genetic crosses (Meng et al. 2016) or via temperature‐induced sex reversal during the labile period of gonadal differentiation. This study represents the first precise identification of the initiation of scp3 expression in turbot ovaries, which aligns temporally with both PGC proliferation and the known thermosensitive period for sex reversal (Meng 2015). Targeted temperature application during the window from 25 to 55 dph—which encompasses both the initial detection of scp3 and the thermosensitive period identified histologically (Meng et al. 2026)—may offer a cost‐effective alternative to whole‐cycle manipulation, providing a potential strategy for all‐female turbot production, pending further experimental validation. This represents a potential strategy for all‐female turbot production that warrants further experimental validation through controlled temperature‐shift trials.

The present study establishes scp3 as a reliable molecular marker for meiotic initiation in female turbot and delineates a critical temporal window for sex differentiation. Nevertheless, several limitations should be acknowledged. First, meiosis is governed by a complex regulatory network comprising multiple interacting genes—such as dazl, dmc1, boule, and sycp1—whose expression dynamics in turbot remain uncharacterized. Consequently, the functional role of Scp3 within the broader meiotic machinery cannot be fully inferred from expression data alone. Future studies employing dual‐marker in situ hybridization, comprehensive transcriptomic profiling, or targeted gene knockdown approaches will be essential to elucidate the regulatory hierarchy and functional interdependencies governing germ cell development in this species. Second, the putative critical window for environmental sex control (25–55 dph) identified herein is based on correlative temporal evidence; controlled temperature‐shift experiments are required to empirically validate whether manipulation during this period can reliably influence phenotypic sex ratios. Third, while in situ hybridization confirms cytoplasmic localization of scp3 mRNA in oocytes, the current analysis was restricted to developmental stages in which gonadal structures could be reliably identified. Expanding in situ hybridization analysis to encompass the critical window of gonadal differentiation (25–55 dph) would provide more direct spatial evidence for the onset of scp3 expression in individual germ cells. However, performing ISH on the tiny, undifferentiated gonadal primordia of larval turbot is technically challenging because of the diffuse nature of the tissue and the low abundance of target transcripts. Future application of more sensitive approaches, such as whole‐mount in situ hybridization or single‐cell RNA sequencing, may help resolve the earliest cellular events associated with meiotic commitment in this species. In addition, protein‐level validation—which would require the development of a specific Scp3 antibody for turbot—would further substantiate its role in synaptonemal complex assembly. Addressing these questions will build upon the foundational temporal framework established in this work and advance both the fundamental understanding of turbot reproductive biology and the applied goal of monosex female production.

In conclusion, this study provides the first comprehensive characterization of scp3 in turbot, underscoring its dual relevance as a meiotic marker. However, additional functional experiments incorporating large‐scale transcriptome sequencing are still required to elucidate its underlying mechanisms and specific modes of action—primarily focusing on the regulation of the scp3 gene during the early stages of gonadal development. Overall, this study not only provides critical data regarding the molecular basis of gene expression associated with gonadal development during sex differentiation but also identifies a putative temporal window that lays a robust foundation for further functional investigations, such as temperature‐shift experiments and gene knockdown assays.

Author Contributions

Xiaoxuan Sun: investigation, methodology, and writing. Luyao Cheng: investigation. Zhen Meng: conceptualization, writing – review and editing, and funding acquisition. Xin Fan: investigation. Wenteng Xu: methodology. Xinfu Liu: supervision. Rongjing Xu: resources and validation; Hesen Zhang: resources and validation.

Ethics Statement

The authors have nothing to report.

Conflicts of Interest

The authors declare no conflicts of interest.

Data Availability Statement

All relevant data are within the paper, and those are available from the corresponding author.