Skip to main content
NCBI home page
Poultry Science logoLink to Poultry Science
. 2026 Jul 27;105(11):107504. doi: 10.1016/j.psj.2026.107504

Cecal invasion mediators EnMIC and its essential domain EnMAR2 confer immunoprotection against Eimeria necatrix in chickens

Shilin Xin 1, Fengwan Zhang 1, Yifan Zhang 1, Chen Chen 1, Mingmin Lu 1, Lixin Xu 1, Ruofeng Yan 1, Xiangrui Li 1, Xiaokai Song 1,⁎
PMCID: PMC13487385  PMID: 42585926

Abstract

Avian coccidiosis caused by Eimeria species threatens the global poultry industry. Current control measures rely mainly on anticoccidial drugs and live vaccines, but drug resistance and safety concerns drive the need for novel vaccines such as subunit vaccines. Among Eimeria species, Eimeria necatrix is one of the most pathogenic. Its life cycle involves sporozoites invading the jejunum and undergoing two generations of schizogony; the released second-generation merozoites then migrate specifically to the cecum for further development—a step essential for completing the life cycle. Previously, we identified EnMIC as the key molecule mediating this cecum-specific invasion, and its essential adhesive domain EnMAR2. In the present study, we evaluated the immunoprotective potential of EnMIC and EnMAR2. Recombinant subunit vaccines of EnMIC and EnMAR2 were administered to chickens. Humoral and cellular immune responses were assessed by measuring serum IgY, intestinal IgA, T-cell subsets (CD4⁺/CD8⁺), and cytokine transcripts (IL-2, IFN-γ, IL-4) in the spleen and cecal tonsils. After challenge with E. necatrix, protective effects were evaluated by survival rate, weight gain, lesion index, oocyst output, and the anticoccidial index (ACI). Both vaccines significantly elevated serum IgY and intestinal IgA levels. They also increased splenic IL‑2, IFN‑γ, and IL‑4 mRNA levels, while downregulating these cytokines in cecal tonsils. Furthermore, the rEnMIC group showed an increased proportion of CD4⁺ T cells in both the spleen and cecal tonsils. In the challenge trial, both the rEnMIC and rEnMAR2 groups exhibited significantly better weight gain, lower lesion index, and greater oocyst reduction than the non‑immunized infected group. Their ACI values were 168.92 and 166.60, respectively. These results demonstrate that EnMIC and EnMAR2, as key mediators of E. necatrix site-specific cecal invasion, can induce both humoral and cellular immune responses when delivered as recombinant protein vaccines. The vaccines effectively alleviated pathological damage, reduced oocyst output, and improved growth performance. Therefore, EnMIC and EnMAR2 represent promising novel vaccine candidates against E. necatrix infection in chickens.

Keywords: Eimeria necatrix, Site-specific cecal invasion, EnMIC, EnMAR2, Immunoprotection

Introduction

Avian coccidiosis is a parasitic disease of chickens caused by intracellular protozoa of the genus Eimeria. These parasites invade and replicate within intestinal epithelial cells. The disease is primarily characterized by enteritis, diarrhea, hemorrhagic feces, impaired feed utilization, and mortality in severe cases (Arianne et al., 2018; Chengat Prakashbabu et al., 2017; Venkatas et al., 2019; Vrba et al., 2010). Chicken coccidiosis is prevalent worldwide. It is estimated that in 2016, chicken coccidiosis caused economic losses of £10.4 billion to the global poultry industry. In countries such as the United States and the United Kingdom, it ranks among the most economically damaging poultry diseases (Blake et al., 2020). Currently, seven Eimeria species are recognized to cause coccidiosis in chickens, with varying pathogenicity. Among them, E. tenella and E. necatrix are regarded as the most pathogenic (Saidi et al., 2021), capable of causing intestinal hemorrhage in chicks and resulting in high morbidity and mortality (Hein, 1971; Morris et al., 2007). E. brunetti, E. maxima, and E. acervulina can also cause clinical diseases, whereas E. praecox and E. mitis are generally considered non-pathogenic but can lead to reduced feed conversion rate and slower growth rate (Fitz-Coy et al., 1992; Gore and Long, 1982; Jorgensen et al., 1997; Williams et al., 2009). Overall, this disease poses a significant threat to the sustainable development of the global poultry industry (Gussem, 2007).

The rapid expansion of intensive poultry farming has made coccidiosis control increasingly challenging. Infectious oocysts, once released and dispersed, can trigger disease outbreaks and cause substantial economic losses (Gao et al., 2024). Currently, farms primarily rely on drugs, vaccines, and improved management to combat avian coccidiosis (Attree et al., 2021; Blake et al., 2014). However, the extensive use of anticoccidial drugs has led to significant drug residues and health concerns. Moreover, growing consumer demand for antibiotic-free products and the implementation of antibiotic restrictions have further complicated coccidiosis control (Bremner, 2018; Clarke et al., 2014). Therefore, immunological strategies are emerging as ideal alternatives to pharmacological interventions. In parallel, host-directed strategies that modulate gut microbiota, reinforce mucosal barrier integrity, and enhance antioxidant capacity are gaining attention for their potential to support intestinal immune protection against enteric pathogens (Chen et al., 2023; Su et al., 2023; Chen et al., 2025). The coccidiosis vaccines currently used for immunological prevention and control of avian coccidiosis mainly include virulent live vaccines and attenuated live vaccines, and research on novel vaccines (such as subunit vaccines and DNA vaccines) is increasingly being conducted (Williams, 2002; Sharman et al., 2010; Song et al., 2010). However, high production costs and limited manufacturing scalability hinder the widespread adoption of live coccidiosis vaccines (Blake et al., 2014; David et al., 2014). Furthermore, oocyst shedding following live vaccination poses a risk of pathogen dissemination and may trigger coccidiosis outbreaks. Therefore, there is an urgent need to develop novel vaccines that are effective, stable, cost-effective, widely accessible, and capable of overcoming drug resistance (Gao et al., 2024; Longlong et al., 2023). Accumulating evidence suggests that recombinant vaccines offer a promising strategy for coccidiosis control (Kundu et al., 2017; Lin et al., 2017; Tian et al., 2017).

The search for effective vaccine candidates has increasingly focused on antigens involved in critical life-cycle stages of the parasite, particularly those related to host cell invasion. Apicomplexan parasites actively invade host cells through a rapid, complex, and obligatory process (Carruthers et al., 2007); this process is primarily initiated by invasion-related proteins secreted from the apical complex (Kibria et al., 2019). Invasion begins with non-oriented attachment to the host cell, followed by recognition of specific surface receptors, and culminates in the deployment of the cell-entry machinery. Throughout invasion, adhesion, and recognition are mediated by microneme proteins. These proteins also connect to the parasite’s actinomyosin system, thereby providing the mechanical platform that drives invasion (Soldati et al., 2004; Tomley et al., 2001; Travis et al., 2003). Therefore, microneme proteins, which play key roles in recognition, adhesion, and invasion, are promising candidate vaccine antigens.

Among highly pathogenic Eimeria species, E. necatrix exhibits a unique life cycle. Unlike most Eimeria spp., in which sporozoites complete the entire life cycle at the initial intestinal infection site, E. necatrix sporozoites first invade the jejunum and undergo two generations of schizogony. The released second-generation merozoites then migrate to the cecum, where they specifically invade cecal epithelial cells to complete subsequent schizogony and gametogony, ultimately producing oocysts. This site-specific cecal invasion by second-generation merozoites is essential for E. necatrix to complete its life cycle. In a previous study, we identified a key microneme protein, designated EnMIC (XM_013583258.1), that mediates this cecum‑specific invasion, along with its essential adhesive domain, EnMAR2 (data unpublished). The EnMAR2 domain was named according to its sequential position within the MAR repeats of EnMIC, and its conserved domain features were confirmed by Pfam and CDD searches prior to this study.

In the present study, we evaluated the immunoprotective efficacy of EnMIC and EnMAR2 as recombinant subunit vaccines. The prokaryotic expression vectors pET-32a-EnMIC and pET-32a-EnMAR2 were successfully constructed and expressed. Subsequently, the recombinant proteins were prepared as subunit vaccines for animal immunization and challenge experiments to assess their protective effects. This study provides an important reference for the development of vaccine candidate antigens against E. necatrix infection.

Materials and methods

Parasites, animals, and vectors

E. necatrix was maintained in our laboratory and was reactivated and propagated as previously described (Wang et al., 2023). The prokaryotic expression vector pET-32a was stored in the laboratory. Chickens were reared under specific-pathogen-free (SPF) conditions and confirmed to be free of Eimeria by fecal examination. All animal procedures were approved by the Animal Experiment Committee of Nanjing Agricultural University (ethical approval number: NJAU.No20251223299).

Gene amplification and plasmid construction

Based on the GenBank sequence of EnMIC (XM_013583258.1), specific primers targeting EnMIC and EnMAR2 were designed (Table 1). Total RNA was extracted from sporulated oocysts of E. necatrix using a Total RNA Extraction Kit (Omega Bio-Tek, Norcross, GA, USA) and reverse-transcribed into cDNA using a First-Strand cDNA Synthesis Kit (Vazyme, China). PCR was performed using this cDNA as the template to amplify the EnMIC and EnMAR2 products. The amplified fragments were then cloned into pET-32a, generating the recombinant plasmids pET-32a-EnMIC and pET-32a-EnMAR2. Finally, these recombinant plasmids were verified by double restriction enzyme digestion and sequencing.

Table 1.

Specific primer sequences.

Gene Primer sequence (5`∼3`)
EnMIC F: CGGGATCCCTGGATGAGGAATGTTCCCA
R: CCGCTCGAGCTCATTCACAAGCTCATCTAACCG
EnMAR2 F: GGAATTCTTGGACAGGAAGTGCGCACAG
R: CCGCTCGAGGTCAATGACCGCTTGAAGTTCG
Open in a new tab

Expression and purification of the recombinant proteins

To obtain the recombinant proteins EnMIC and EnMAR2 (designated rEnMIC and rEnMAR2), E. coli BL21(DE3) cells harboring the recombinant plasmids pET-32a-EnMIC and pET-32a-EnMAR2 were inoculated into Luria-Bertani (LB) liquid medium and cultured at 37 °C until the OD600 reached 0.6. Subsequently, IPTG was added to the culture at a final concentration of 1 mmol/L, and the culture was continued for 5 h at 37 °C. The recombinant proteins were then harvested from the bacterial cells and purified using a His Trap FF column (GE Healthcare, Piscataway, NJ, USA) following the manufacturer’s instructions. Protein concentration was determined using a BCA protein assay kit (Beyotime Biotechnology, Nanjing, China), and the protein samples were stored at –80 °C for subsequent use. Meanwhile, for the control antigen preparation, the pET‑32a empty vector was transformed into E. coli BL21(DE3), and the transformed cells were subsequently cultured, harvested, and purified using the same procedures described above.

Identification of recombinant proteins by western blot

The purified rEnMIC and rEnMAR2 were analyzed by SDS-PAGE and then transferred onto polyvinylidene fluoride (PVDF) membranes (Merck Millipore, Darmstadt, Germany). The membranes were subsequently blocked with 5% skim milk at 37 °C for 1 h. The primary antibodies used were anti-E. necatrix chicken serum (1:200) and mouse anti-His tag monoclonal antibody (1:5,000; Proteintech, Wuhan, China). The secondary antibodies were HRP-conjugated goat anti-chicken IgY (1:5,000; Abcam, Cambridge, UK) and HRP-conjugated goat anti-mouse IgG (1:8,000; Abcam, Cambridge, UK). Serum from uninfected chickens served as the negative control. Antibody recognition of the rEnMIC and rEnMAR2 proteins was detected using an ECL kit (Thermo Scientific, Waltham, MA, USA).

Animal grouping, immunization, and challenge infection

Healthy Hy-Line white chicks were raised in a coccidia‑free environment from 1 to 14 days of age. Based on similar body weights, they were randomly assigned to five groups. Each treatment group consisted of 25 chicks, with 5 replicates, and each replicate contained 5 chicks. The groups were: unimmunized and unchallenged group (PBS group), unimmunized and challenged group, pET‑32a tag protein group, rEnMIC group, and rEnMAR2 group. For the rEnMIC and rEnMAR2 groups, the recombinant proteins were emulsified with MONTANIDE™ ISA 71 R VG mineral oil adjuvant (Seppic, France) at a ratio of 30:70 (antigen: adjuvant, w/w) to form a water‑in‑oil emulsion. The first and second immunizations were administered via leg intramuscular injection at 14 and 21 days of age, respectively, with each chick receiving a dose of 200 μg. The PBS and pET‑32a control groups received the same volume of adjuvant‑emulsified PBS or pET‑32a tag protein, respectively, to exclude the non‑specific immunostimulatory effects of the adjuvant. On day 7 after the first immunization and day 7 after the second immunization, 5 chicks (1 from each pen) were randomly selected from each group at each time point, and serum and intestinal contents were collected from the selected chicks. Serum‑specific IgY and intestinal‑specific IgA antibody titers were detected by ELISA. Spleen and cecal tonsil lymphocytes were collected from the selected chicks, and the proportions of CD4⁺ and CD8⁺ T cell subsets were analyzed by flow cytometry. Additionally, qPCR was used to measure the expression levels of Th1/Th2‑related cytokines (IL‑2, IFN‑γ, and IL‑4) in these lymphocytes, in order to evaluate the immune responses induced by the recombinant subunit vaccines rEnMIC and rEnMAR2.

For the remaining 3 chicks from each pen (15 chicks per group, 5 pens × 3 chicks), all chicks except those in the unimmunized and unchallenged group were orally challenged with 1.5 × 104 sporulated E. necatrix oocysts on day 7 after the second immunization. This dose was selected based on the principles outlined in the WAAVP guidelines for evaluating anticoccidial efficacy (Holdsworth et al., 2004). The immunoprotective effects of the rEnMIC and rEnMAR2 vaccines were assessed by calculating the anticoccidial index (ACI), which was based on survival rate, relative weight gain, intestinal lesion index, and oocyst shedding. For lesion scoring and oocyst counting, the evaluators were blinded to the group allocation; all samples were coded, and the code was not broken until all measurements had been completed.

Detection of specific IgY antibodies in serum and specific IgA in intestinal contents

On the 7th day after the first and second immunizations, five chicks from each group were randomly selected for cardiac blood collection. Blood was incubated at 37 °C for 30 min and then kept overnight at 4 °C. After centrifugation at 500 × g for 10 min, the supernatant was collected as chicken serum for specific IgY detection. Subsequently, the chickens were killed, and the contents of the cecum were collected. Equal weights of cecal contents from each bird were weighed and placed into Eppendorf tubes. Ice‑cold PBS containing protease and phosphatase inhibitors was added at a ratio of 1:5 (w/v), followed by vortex mixing and centrifugation at 12,000 × g for 10 min. The supernatant was collected for specific IgA detection. IgA levels were normalized to the initial cecal content weight and expressed as OD₄₅₀ per mg cecal content (wet weight) to normalize individual differences. All samples were aliquoted and stored at –80 °C. The ELISA procedure was performed as follows. rEnMIC and rEnMAR2 proteins were diluted to 20 μg/mL in 0.05 M carbonate buffer. Then, 100 μL per well was used to coat a 96‑well plate overnight at 4 °C. After discarding the coating solution, the plate was washed three times with PBST. Each well was blocked with 100 μL of PBST containing 5% BSA at 37 °C for 2 h. Test samples (serum or cecal content supernatant) were diluted 1:100 in PBST, added to each well, and incubated at 37 °C for 1 h. After washing, HRP‑conjugated goat anti‑chicken IgY (1:5,000 for serum) or HRP‑conjugated goat anti‑chicken IgA (1:5,000 for cecal content) was added and incubated at 37 °C for 1 h. Following another wash, 100 μL of TMB substrate solution was added to each well, and the plate was incubated at room temperature in the dark for 20 min. The reaction was stopped with 100 μL of 2 M sulfuric acid. Blank and negative controls were included. Absorbance at 450 nm (OD₄₅₀) was measured using a microplate reader.

Effects of EnMIC and EnMAR2 vaccine immunization on the proportions of T lymphocyte subsets in chicken spleen and cecal tonsils

After blood collection, the spleen was aseptically removed, and a single‑cell suspension was prepared using lymphocyte separation medium. Following cell counting, the concentration was adjusted to 1 × 107 cells/mL with PBS. For flow cytometric analysis, 400 μL of splenocyte suspension was equally aliquoted into four compensation control tubes: a blank control (no antibody), a CD3 single‑stain tube (1 μL mouse anti‑chicken CD3‑FITC), a CD4 single‑stain tube (1 μL mouse anti‑chicken CD4‑APC), and a CD8 single‑stain tube (1 μL mouse anti‑chicken CD8‑PE). Additionally, 100 μL of each sample was stained with a cocktail containing all three antibodies (1 μL each) for three‑color analysis. All tubes were gently vortexed after antibody addition and incubated at 4 °C in the dark for 30 min. Cells were washed twice with pre‑cooled PBS (500 × g, 5 min) and finally resuspended in 500 μL PBS for flow cytometry.

Cecal tonsils from the same chickens were collected and cut into uniform pieces (approximately 5 mm × 5 mm) to ensure consistent digestion efficiency. Tissue fragments were digested in a solution containing collagenase IV (2 mg/mL) and DNase I (100 μg/mL) at 37 °C for 30 min with shaking. Digestion was terminated by adding complete medium supplemented with 10% fetal bovine serum (FBS). The cell suspension was sequentially filtered through a 45‑mesh strainer and a 40 μm cell strainer. After centrifugation at 300 × g for 10 min, the pellet was washed three times with pre‑cooled PBS. Lymphocytes were then isolated by density gradient centrifugation using lymphocyte separation medium. For antibody staining, 100 μL of cell suspension from each group was equally divided into two tubes: one for CD3‑CD4 double‑staining (1 μL each of mouse anti‑chicken CD3‑FITC and anti‑chicken CD4‑PE) and the other for CD3‑CD8 double‑staining (1 μL each of mouse anti‑chicken CD3‑FITC and anti‑chicken CD8‑PE). Staining was performed as described above, followed by flow cytometric analysis.

Effects of EnMIC and EnMAR2 vaccine immunization on mRNA levels of Th1/Th2 cytokines in lymphocytes of chicken spleen and cecal tonsils

To assess the impact of EnMIC and EnMAR2 vaccine immunization on Th1/Th2 cytokine mRNA expression, lymphocyte suspensions were prepared from chicken spleen and cecal tonsils. RNA was extracted and reverse transcribed into cDNA. Using this cDNA as the template, qPCR was performed to quantify mRNA levels of Th1 cytokines (IL-2 and IFN-γ) and the Th2 cytokine (IL-4) in lymphocytes. The qPCR primer sequences are listed in Table 2, with β-actin as the internal reference. Relative gene expression between experimental and control groups was calculated using the 2⁻ΔΔCT method.

Table 2.

Primers sequences for qPCR.

Gene Primers sequences (5`∼3`) Product length (bp)
β-actin F: GCCAACAGAGAGAAGATGACAC
R: GTAACACCATCACCAGAGTCCA		 140
IFN-γ F: ATCATACTGAGCCAGATTGTTTCG
R: TCTTTCACCTTCTTCACGCCAT		 140
IL-2 F: TTCATCTCGAGCTCTACACACCAA
R: TGTCATCTTCAGTTTCTTTCTTCAGAGT		 108
IL-4 F: AGCACTGCCACAAGAACCTG
R: CCTGCTGCCGTGGGACAT		 100
Open in a new tab

Observation on the immunoprotective effects of EnMIC and EnMAR2 vaccines

On the 7th day post-challenge, all experimental chickens were killed. The relative weight gain rate was calculated based on body weight at necropsy and body weight at the time of challenge. Survival rate, oocyst shedding, and intestinal lesion index were recorded for each group. Survival rate was defined as the percentage of chickens alive at necropsy relative to the total number challenged. Oocyst shedding was quantified as oocysts per gram of feces (OPG) using the McMaster counting method (Hodgson, 1970; Talebi et al., 2005). Cecal lesion severity was scored on a scale from 0 to 4 based on established criteria (Johnson and Reid, 1970). Based on the above parameters, the ACI was calculated using the following formula: ACI = (Relative weight gain rate + Survival rate) − (Lesion index + Oocyst index). Relative weight gain rate = (weight gain rate of each challenged group / weight gain rate of the unimmunized and unchallenged group) × 100; Survival rate = (survivors / total challenged) × 100; Lesion index= mean cecal lesion score (0–4 scale) multiplied by 10; Oocyst index = index (0, 5, 10, 20, or 40) converted from the relative oocyst output, where Relative oocyst output = (OPG of treatment group / OPG of unimmunized and challenged group) × 100%, and converted as follows: ≤1% gave 0; >1% to ≤25% gave 5; >25% to ≤50% gave 10; >50% to ≤75% gave 20; and >75% to ≤100% gave 40. The ACI evaluation criteria are as follows: an ACI >180 indicates excellent vaccine efficacy, 160–179 indicates good efficacy, 120–159 indicates poor efficacy, and <120 indicates inefficacy (McManus et al., 1968; Llalla et al., 2025; Lu et al., 2022; Hou et al., 2024). This comprehensive index was used to evaluate the immunoprotective effect induced by the vaccine.

Statistical analysis

Statistical analyses were performed using GraphPad Prism 6.0 (GraphPad Software, USA). Data are presented as mean ± standard deviation (SD). One‑way analysis of variance (ANOVA) followed by Dunnett’s test was used for group comparisons. For survival data, Kaplan‑Meier survival curves were constructed, and survival distributions were compared using the log‑rank (Mantel‑Cox) test. A p‑value < 0.05 was considered statistically significant.

Results

Gene amplification and plasmid construction

Using E. necatrix cDNA as the template, specific bands corresponding to EnMIC and EnMAR2 were successfully amplified. Agarose gel electrophoresis confirmed that the sizes of EnMIC and EnMAR2 were 1413 bp and 273 bp, respectively, matching the expected lengths (Fig. 1). Sequencing of the PCR products revealed 100% identity with the known reference sequences. The amplified fragments were then ligated into the pET‑32a vector, and the resulting constructs were transformed into DH5α competent cells. Recombinant plasmids were extracted and verified by double restriction enzyme digestion. Analysis of the digestion products by agarose gel electrophoresis showed bands corresponding to the expected sizes of EnMIC and EnMAR2 (Fig. 1). Finally, sequencing confirmed the correct insertion and integrity of both recombinant plasmids, indicating successful construction of the recombinant plasmids for EnMIC and EnMAR2.

Fig. 1.

Fig 1 dummy alt text

Open in a new tab

Amplification and identification of EnMIC and EnMAR2 recombinant plasmids by PCR.

Lane 1: Amplification product of the EnMIC gene; Lane 2: Double digestion result of the recombinant plasmid pET-32a-EnMIC; Lane 3: Amplification product of the EnMAR2 gene; Lane 4: Double digestion result of the recombinant plasmid pET-32a-EnMAR2

Expression, purification and characterization of recombinant proteins

The recombinant plasmids pET-32a-EnMIC and pET-32a-EnMAR2 were separately transformed into BL21 competent cells to induce the expression of recombinant proteins. The expressed proteins were then purified using a His‑tag affinity column. Analysis by SDS‑PAGE revealed clear single bands at approximately 77 kDa and 27 kDa, corresponding to the expected sizes of rEnMIC and rEnMAR2, respectively (Figs. 2 and 3, Lane 1). Western blot analysis further confirmed the identity of the purified proteins. Both recombinant proteins were recognized by serum from E. necatrix‑infected chickens (Figs. 2 and 3, Lane 2) and by anti‑His mouse monoclonal antibodies (Lane 4). No bands were detected when using negative chicken serum (Lane 3). These results validate the successful expression, purification, and antigenicity of the recombinant proteins.

Fig. 2.

Fig 2 dummy alt text

Open in a new tab

Purification and Western blot identification of the recombinant protein EnMIC.

Lane 1: Purified rEnMIC; Lane 2: Identification of rEnMIC using chicken anti-E. necatrix serum; Lane 3: Identification of rEnMIC using chicken negative serum; Lane 4: Identification of rEnMIC using His-tag mouse monoclonal antibody

Fig. 3.

Fig 3 dummy alt text

Open in a new tab

Purification and Western blot identification of the recombinant protein EnMAR2.

Lane 1: Purified rEnMAR2; Lane 2: Identification of rEnMAR2 using chicken anti-E. necatrix serum; Lane 3: Identification of rEnMAR2 using chicken negative serum; Lane 4: Identification of rEnMAR2 using His-tag mouse monoclonal antibody

Capability of rEnMIC and rEnMAR2 to induce systemic immunity

To evaluate the systemic immune effects of the recombinant subunit vaccines rEnMIC and rEnMAR2 in chickens, we evaluated humoral immunity, cellular immune phenotypes, and Th1/Th2 cytokine expression. For humoral immunity, indirect ELISA showed that serum‑specific IgY levels in both the rEnMIC and rEnMAR2 groups were significantly higher than those in the PBS and pET‑32a tag protein control groups at 7 days post‑primary and post‑booster immunization (p < 0.05) (Fig. 4). This result indicates that both vaccines effectively elicited a humoral immune response. Regarding cellular immune phenotypes, flow cytometry analysis of splenic CD4⁺ and CD8⁺ T lymphocytes revealed no significant differences between any vaccine group and the controls at 7 days after the first immunization (p > 0.05). However, at 7 days post‑booster immunization, only the rEnMIC group showed a significantly increased proportion of CD4⁺ T cells compared to the pET‑32a tag protein group (p < 0.05) (Fig. 5). Further analysis Th1/Th2 cytokine (IL‑2, IFN‑γ, IL‑4) mRNA expression in splenic lymphocytes by qPCR. After the first immunization, no significant differences were found between vaccine and control groups. Following the booster immunization, mRNA levels of IL-2, IFN-γ and IL-4 in the rEnMIC group were significantly higher than those in the control groups (p < 0.05). In the rEnMAR2 group, IL‑2 and IL‑4 mRNA levels were significantly elevated. IFN‑γ mRNA in this group showed no difference compared with the PBS control but was significantly higher than in the pET‑32a tag protein group (p < 0.05) (Fig. 6). In summary, both rEnMIC and rEnMAR2 effectively stimulate humoral immunity. Following the booster immunization, rEnMIC demonstrated more pronounced effects in promoting CD4⁺ T cell proliferation and Th1/Th2 cytokine expression, whereas rEnMAR2 exhibited a selective induction of cytokines.

Fig. 4.

Fig 4 dummy alt text

Open in a new tab

Effect of rEnMIC and rEnMAR2 vaccine immunization on serum-specific IgY levels in chickens.

Note: Different letters indicate significant differences (p < 0.05).

Fig. 5.

Fig 5 dummy alt text

Open in a new tab

Effects of EnMIC and EnMAR2 vaccines on the proportions of T lymphocyte subsets in chicken spleen.

A: Proportion of CD4+ T lymphocyte subsets in chicken spleen 7 days after the first immunization; B: Proportion of CD8+ T lymphocyte subsets in chicken spleen 7 days after the first immunization; C: Proportion of CD4+ T lymphocyte subsets in chicken spleen 7 days after the second immunization; D: Proportion of CD8+ T lymphocyte subsets in chicken spleen 7 days after the second immunization; 1: PBS group; 2: pET‑32a tag protein group; 3: rEnMIC group; 4: rEnMAR2 group.

Fig. 6.

Fig 6 dummy alt text

Open in a new tab

Effects of rEnMIC and rEnMAR2 vaccine immunization on the transcriptional levels of Th1/Th2 cytokines in splenic lymphocytes of chickens.

Note: Different letters indicate significant differences (p < 0.05)

Capability of rEnMIC and rEnMAR2 to induce mucosal immunity

To systematically evaluate the impact of the recombinant subunit vaccines EnMIC and EnMAR2 on intestinal mucosal immunity in chickens, we evaluated mucosal humoral immunity, intestinal T‑cell subset distribution, and local cytokine expression. For mucosal humoral immunity, indirect ELISA results showed that on day 7 after the primary immunization, intestinal antigen‑specific IgA levels in the rEnMIC group were significantly higher than those in both the PBS and pET‑32a tag protein groups (p < 0.05). In contrast, IgA levels in the rEnMAR2 group were significantly elevated only compared with the PBS group (p < 0.05). Following the booster immunization, IgA levels in both vaccine groups were significantly higher than in all control groups (p < 0.05) (Fig. 7). These findings indicate that both vaccines elicited an intestinal mucosal antibody response. Regarding intestinal T‑cell subsets, flow cytometry analysis revealed no significant differences in the cecal tonsil CD4⁺/CD8⁺ T cell ratio among groups after the primary immunization. However, after the booster, the proportion of CD4⁺ T cells in the rEnMIC group was significantly increased compared to the PBS group (p < 0.05). Conversely, the proportion of CD8⁺ T cells in the rEnMAR2 group was significantly lower than in other groups (p < 0.05) (Fig. 8). This suggests that booster vaccination modulated intestinal T‑cell subset distribution, with distinct patterns for the two vaccines. Further qPCR detection of local Th1/Th2 cytokine (IL‑2, IFN‑γ, IL‑4) mRNA expression showed that after the first immunization, IL‑2 and IFN‑γ mRNA levels in the rEnMIC and rEnMAR2 groups were significantly down‑regulated compared with the PBS group (p < 0.05), while IL‑4 remained unchanged. After the booster, IFN‑γ and IL‑2 mRNA levels in both vaccine groups were significantly lower than in the pET‑32a tag protein group and PBS group (p < 0.05). In IL-4, only rEnMIC was significantly lower than the pET-32a tag protein group (p < 0.05), with no significant differences among the other groups (Fig. 9). In summary, both rEnMIC and rEnMAR2 effectively stimulated intestinal mucosal humoral immunity. Following the booster immunization, EnMIC tended to promote CD4⁺ T‑cell accumulation, whereas EnMAR2 suppressed the CD8⁺ T‑cell response. Both vaccines modulated local cytokines by inhibiting Th1‑type factors, especially IFN‑γ.

Fig. 7.

Fig 7 dummy alt text

Open in a new tab

Effect of rEnMIC and rEnMAR2 vaccine immunization on intestinal antigen-specific IgA levels in chickens.

Note: Different letters indicate significant differences (p < 0.05).

Fig. 8.

Fig 8 dummy alt text

Open in a new tab

Effects of EnMIC and EnMAR2 vaccines on the proportions of T lymphocyte subsets in chicken cecal tonsil.

A: Proportion of CD4+ T lymphocyte subsets in chicken cecal tonsil 7 days after the first immunization; B: Proportion of CD8+ T lymphocyte subsets in chicken cecal tonsil 7 days after the first immunization; C: Proportion of CD4+ T lymphocyte subsets in chicken cecal tonsil 7 days after the second immunization; D: Proportion of CD8+ T lymphocyte subsets in chicken cecal tonsil 7 days after the second immunization; 1: PBS group; 2: pET‑32a tag protein group; 3: rEnMIC group; 4: rEnMAR2 group.

Fig. 9.

Fig 9 dummy alt text

Open in a new tab

Effects of rEnMIC and rEnMAR2 vaccine immunization on transcriptional levels of Th1/Th2 cytokines in cecal tonsil lymphocytes of chickens.

Note: Different letters indicate significant differences (p < 0.05).

Protective efficacy of EnMIC and EnMAR2 against E. necatrix in chickens

To evaluate the potential of EnMIC and EnMAR2 as novel vaccine candidates, we prepared the recombinant proteins as subunit vaccines and assessed their immunoprotective effects through immunization and challenge experiments. As shown in Table 3, the rEnMAR2 group achieved 100% survival following E. necatrix challenge, while the rEnMIC group showed a survival rate of 93.33%. Kaplan‑Meier survival analysis further revealed that the unimmunized challenged control group had the lowest survival rate (40%, 6/15 survived), whereas both vaccine groups exhibited significantly higher survival rates (p < 0.05 vs. challenged control). The pET‑32a tag protein group (46.67%) did not differ significantly from the challenged control (p > 0.05), confirming that the observed protection was antigen‑specific (Fig. 10). The rEnMIC group exhibited significantly higher average weight gain compared with the unimmunized and challenged group (p < 0.05). In contrast, the rEnMAR2 group had higher weight gain than the unimmunized and challenged group, but the difference was not significant (p > 0.05). Moreover, both the rEnMIC and rEnMAR2 groups showed significantly lower average lesion index and oocyst output than the unimmunized and challenged group (p < 0.05). These results indicate that the recombinant subunit vaccines EnMIC and EnMAR2 effectively reduced weight loss, intestinal damage, and oocyst shedding, providing good protection against E. necatrix infection, with ACI values of 168.92 and 166.60, respectively (Table 3).

Table 3.

Protective efficacy of EnMIC and EnMAR2 against E. necatrix in chicken.

Group survival rate (%) Average body weight gains (g) Relative body weight gain rate (%) Lesion score Lesion index Oocyst shedding (× 106) Oocyst index Anticoccidial
Index (ACI)
Unimmunized and Unchallenged 100.00 41.93 ± 4.13a 100 0 ± 0a 0 0 ± 0a 0 200.00
Unimmunized and
Challenged		 40.00 21.91 ± 8.07b 54.49 3.33 ± 0.98b 33.3 3.50 ± 1.81b 40 21.19
pET‑32a tag protein 46.67 31.89 ± 5.96b 81.77 3.07 ± 1.63bc 30.7 2.65 ± 0.63b 40 57.74
rEnMIC 93.33 38.53 ± 3.24a 97.59 1.20 ± 1.15c 12.0 0.88 ± 0.37c 10 168.92
rEnMAR2 100.00 35.46 ± 5.62ab 92.90 2.13 ± 0.92bc 21.3 0.64 ± 0.27c 5 166.60
Open in a new tab

Note: Different letters in the same column indicate significant differences (p < 0.05), while the same letters indicate no significant differences (p < 0.05).

Fig. 10.

Fig 10 dummy alt text

Open in a new tab

Kaplan‑Meier survival curves of chickens following oral challenge with E. necatrix oocysts.

Survival distributions were compared using the log‑rank (Mantel‑Cox) test. Different letters indicate significant differences (p < 0.05).

Discussion

For decades, chemoprophylaxis has served as the primary control strategy against avian coccidiosis in poultry production (Chapman, 2009; Kadykalo et al., 2018). However, long-term misuse of anticoccidial drugs has led to the widespread emergence of drug‑resistant strains, and concerns over drug residues and food safety have driven the search for alternative strategies, with immunization‑based approaches gaining increasing attention (Chapman and Jeffers, 2014; Venkatas et al., 2019). Although live vaccines (both virulent and attenuated) are available, their high production costs, safety risks associated with oocyst shedding, and limited scalability hinder their widespread adoption (Blake et al., 2014; David et al., 2014). Therefore, there is an urgent need for novel, safe, and cost‑effective vaccines, such as subunit or DNA vaccines. An effective subunit vaccine relies on the identification of appropriate immunogens. Accumulating evidence indicates that antigens involved in critical steps of host‑cell invasion, particularly microneme proteins, are promising vaccine candidates (Kundu et al., 2017; Lin et al., 2017; Tian et al., 2017). Indeed, several invasion‑related molecules have been successfully evaluated for their immunoprotective efficacy against Eimeria infection. For example, immunization with a recombinant subunit vaccine incorporating EtMIC8-EGF conferred moderate protective efficacy (ACI: 169.7) in chickens, eliciting humoral immunity and upregulating cellular immune responses (Zhao et al., 2021). Yan et al. (2018) investigated the protective efficacy of EtMIC2 as a DNA vaccine and demonstrated that immunization with pcDNA3.1(+)-EtMIC2 significantly increased the average body weight gain of chickens while reducing the mean lesion index and oocyst output (Yan et al., 2018). These successful cases support the concept that targeting invasion‑essential molecules can effectively interrupt the parasite’s life cycle and induce protective immunity. Among the highly pathogenic Eimeria species, E. necatrix exhibits a unique life cycle that distinguishes it from other chicken Eimeria species. Unlike E. tenella, whose sporozoites directly invade and complete the entire life cycle in the cecum, or E. acervulina and E. maxima, which reside in the duodenum and jejunum respectively (Burrell et al., 2019; López‑Osorio et al., 2020; Tewari et al., 2011), E. necatrix sporozoites first invade the jejunum and undergo two generations of schizogony there. The released second‑generation merozoites then migrate from the mid‑jejunum to the cecum, where they specifically invade cecal epithelial cells to complete subsequent schizogony and gametogony, ultimately producing oocysts. This site‑specific cecal invasion by second‑generation merozoites is essential for completing the E. necatrix life cycle; however, the molecular basis underlying this tissue tropism has long remained poorly understood. In a previous study, we identified a key microneme protein that mediates this cecum‑specific invasion, designated EnMIC (XM_013583258.1), along with its essential adhesive domain EnMAR2 (data unpublished). Given that EnMIC and EnMAR2 are critical for the specific adhesion of second‑generation merozoites to cecal tissues, we hypothesized that an immune response targeting these molecules could block cecal colonization and thereby interrupt the life cycle of E. necatrix. To test this hypothesis, the present study evaluated the immunoprotective efficacy of recombinant EnMIC and EnMAR2 as subunit vaccines. Our results demonstrated that both rEnMIC and rEnMAR2 significantly induced humoral and cellular immune responses, as evidenced by elevated serum IgY, intestinal IgA, increased CD4⁺ T cell proportions (for rEnMIC), and upregulated cytokine transcripts (IL‑2, IFN‑γ, IL‑4). More importantly, following challenge with E. necatrix, vaccinated chickens exhibited significantly better weight gain, lower intestinal lesion index, and reduced oocyst output compared to non‑immunized infected controls, with anticoccidial index (ACI) values of 168.92 and 166.60, respectively. Consistent with the aforementioned successful examples of invasion‑related molecule‑based vaccines, our findings further validate that invasion‑essential molecules like EnMIC and EnMAR2 can serve as effective vaccine candidates against E. necatrix infection.

In humoral immunity, serum‑specific IgY antibody levels serve as a key indicator for evaluating systemic immune responses (Salmon, et al., 2012). In this study, both the rEnMIC and rEnMAR2 immunization groups showed significantly higher serum‑specific IgY levels than the control group after primary and secondary immunization. This result indicates that both recombinant proteins effectively activated systemic humoral immunity. Simultaneously, mucosal immunity plays a critical role in defending against intestinal pathogen infections. Intestinal antigen‑specific IgA antibodies act as the first line of local immune protection (Saková, et al., 2006). Our results revealed that intestinal antigen‑specific IgA levels also increased significantly in immunized chickens after both immunizations. This finding aligns with studies using oral delivery systems expressing coccidial antigens to induce intestinal IgA responses (Lee, et al., 2026). The synergistic elevation of serum IgY and intestinal IgA establishes a dual humoral immune barrier against E. necatrix. Notably, although the antibody titers appeared moderate in terms of absolute OD values (Fig. 4, Fig. 7), the vaccinated chickens still exhibited strong protection against E. necatrix challenge (ACI > 160). This is not contradictory, as protective immunity against Eimeria is primarily cell‑mediated (Th1 CD4⁺ T cells and IFN‑γ), not antibody‑dependent (Lillehoj et al., 1996; Yun et al., 2000). Indeed, a poor correlation between serum antibody titers and protection against Eimeria has been well documented (Tajima et al., 2003).

Regarding cellular immunity, cytokines play a crucial role in the immune response and anti-infection process of chicken coccidiosis, particularly Th1 and Th2 cytokines (IL-2, IFN-γ, and IL-4) (Chapman, 2014; Dalloul, et al., 2006). In this study, secondary immunization significantly elevated the mRNA levels of IL-2, IFN-γ, and IL-4 in splenic lymphocytes. This indicates that the vaccine successfully induced coordinated expression of Th1-type cytokines (IL-2, IFN-γ) and the Th2-type cytokine IL-4. Thus, the vaccine likely triggered a mixed adaptive immune response. Among these cytokines, IFN-γ is a key Th1-type cytokine that effectively activates effector cells such as macrophages. It plays a central role in combating intracellular parasitic infections (Lillehoj et al., 1998). In contrast, cytokine mRNA levels in cecal lymphocytes showed an opposite trend to the systemic immune response. This distinct local profile suggests that the intestinal mucosal immune system may operate under regulatory mechanisms that differ from those in the systemic compartment. It is well recognized that the mucosal immune system must balance pathogen defense with tolerance to food antigens and commensal flora, and that excessive or persistent effector T-cell responses can cause pathological damage to the intestinal mucosa (Zhou et al., 2025). Although the functional significance of the observed local cytokine downregulation remains to be elucidated, it is plausible that this response reflects a mucosal adaptation aimed at limiting local immunopathology. Increasing evidence highlights that gut microbiota and mucosal barrier integrity are critical determinants of intestinal immune protection (Su et al., 2023; Chen et al., 2022; Chen et al., 2025), implying that the local cytokine profile may also be shaped by microbiota-mediated immune regulation. Alternatively, it might be associated with the establishment of local immune homeostasis following antigenic stimulation. However, further investigations, such as phenotypic analysis of regulatory T cells or local cytokine neutralization assays are required to verify these hypotheses.

T cell-driven cellular immunity is a key component of acquired immunity, playing a central role in the body’s defense against chicken coccidial infection and in maintaining immune balance (Dalloul et al., 2006). In this study, flow cytometry was used to analyze changes in T lymphocyte subset proportions (CD4⁺/CD8⁺) in the spleen and cecum of immunized chickens. In the spleen, at 7 days after secondary immunization, only the rEnMIC group showed a significantly higher proportion of CD4⁺ T lymphocytes compared with the pET‑32a empty vector group. This indicates that rEnMIC can more effectively promote helper T cell expansion following booster immunization. In cecal mucosal immune tissue, no significant difference in the CD4⁺/CD8⁺ ratio was observed among groups after primary immunization. However, different patterns emerged after secondary immunization. The proportion of CD4⁺ T lymphocytes in the rEnMIC group was significantly higher than that in the PBS control group. In contrast, the proportion of CD8⁺ T lymphocytes in the rEnMAR2 group were significantly lower than in the other groups. These results suggest that rEnMIC and rEnMAR2 may induce distinct but potentially equally effective immune profiles. Specifically, rEnMIC appears to elicit a stronger CD4⁺ T cell-biased response in both systemic and mucosal compartments, which is important for coordinating antibody production and immune memory. In contrast, rEnMAR2, while showing less pronounced CD4⁺ T-cell and systemic cytokine responses, still achieved comparable protective efficacy in terms of survival rate, weight gain, and oocyst shedding (Table 3). Two mechanistic questions arise from these differential immune profiles. First, why does the short adhesive domain rEnMAR2 perform almost as well as the full‑length EnMIC? The EnMAR2 domain serves as the functional core of EnMIC, mediating the specific adhesion of second‑generation merozoites to cecal epithelial cells. Immunization with rEnMAR2 alone targets this critical adhesion interface and is sufficient to substantially block parasite attachment and confer protective immunity. This is consistent with previous reports demonstrating that MAR‑containing antigens from other Eimeria species can induce protective efficacy comparable to their full‑length counterparts (Huang et al., 2018; Zhang et al., 2023; Zhao et al., 2020). Although the MAR domain alone confers considerable protection, the full‑length EnMIC shows a slightly higher anticoccidial index (168.92 vs. 166.60), suggesting that other regions may contribute to a minor extent—for instance, by stabilizing protein conformation or facilitating host molecule interactions. Thus, while the adhesion domain harbors key protective epitopes, the remaining regions are not entirely dispensable. Second, why does rEnMIC induce stronger CD4⁺ T‑cell proliferation while rEnMAR2 shows lower CD8⁺ T‑cell counts? Notably, this lower CD8⁺ proportion was tissue‑specific: CD8⁺ levels remained comparable to controls in the spleen but were significantly reduced in the cecal tonsils. This indicates localized modulation rather than systemic immunosuppression, likely reflecting differential T‑cell trafficking or retention in mucosal compartments. We propose that rEnMAR2, as a smaller antigen, may be preferentially processed via the MHC class II pathway, favoring a CD4⁺‑biased response without substantial CD8⁺ recruitment to mucosal sites. Crucially, this localized reduction did not compromise protection (ACI: 166.60; 100% survival), suggesting that rEnMAR2 confers immunity through CD8‑independent mechanisms, such as CD4⁺ T‑cell help and mucosal IgA. Collectively, these findings suggest that rEnMIC and rEnMAR2 achieve protection through different but equally effective immunological strategies—rEnMIC via robust CD4⁺ T‑cell activation, and rEnMAR2 potentially through enhanced local barrier functions or innate immune activation. Epitope mapping and functional analysis of T‑cell subsets are warranted to further delineate these mechanisms.

Beyond adaptive immunity, the intestinal microbiota and mucosal barrier integrity are critical determinants of host resistance to Eimeria infection. The inflammatory response triggered by parasite invasion can disrupt the epithelial barrier, leading to increased permeability, bacterial translocation, and exacerbated local inflammation (Su et al., 2023; Chen et al., 2022; Chen et al., 2025). Therefore, an effective anticoccidial vaccine may confer protection not only through direct anti‑parasite immune responses but also by preserving mucosal barrier integrity and limiting microbiota dysbiosis. While the present study did not directly examine these parameters, the observed reduction in intestinal lesion index and oocyst output in vaccinated chickens suggests that rEnMIC and rEnMAR2 immunization may contribute to the preservation of intestinal homeostasis following E. necatrix challenge. Future studies incorporating 16S rRNA sequencing of cecal microbiota and assessment of tight junction protein expression will be valuable to elucidate whether the protective effects are mediated, in part, through microbiota‑dependent or barrier‑protective mechanisms.

In this study, we immunized chickens with the recombinant subunit vaccines EnMIC and EnMAR2 to systematically evaluate their immunoprotective effects against E. necatrix infection. The results showed that both vaccines significantly improved weight gain in infected chickens, substantially reduced intestinal lesions, and effectively inhibited oocyst shedding, resulting in favorable anticoccidial indices (ACI values of 168.92 and 166.60, respectively). To contextualize the level of protection achieved, we compared these values with those reported for other recombinant vaccine candidates against E. necatrix. For example, rEnMIC3, another microneme protein from E. necatrix, confers an ACI of 171.32 at a dose of 200 µg (Feng et al., 2026). A tetravalent recombinant subunit vaccine (TEIN) incorporating antigens from four Eimeria species achieved an ACI of 180.61 against E. necatrix (Ma et al., 2026). A novel recombinant glutathione peroxidase (rEnGPX) from E. necatrix conferred moderate protection with an ACI of 161.81(Wang et al., 2025). A recombinant attenuated Salmonella Enteritidis vaccine expressing the EnGAM59 gametocyte antigen achieved ACI values of 157.7 and 157.9 following oral and intramuscular administration, respectively (Liu et al., 2025). Collectively, the ACI values for rEnMIC (168.92) and rEnMAR2 (166.60) in the present study were comparable to, and in some cases exceeded, those of other recently reported recombinant vaccine candidates. Overall, both EnMIC and EnMAR2 represent highly promising candidate antigens for anticoccidial vaccine development.

In conclusion, our results provide an affirmative answer to the core scientific question: EnMIC and its EnMAR2 domain serve as key mediators for the invasion of the cecum by second-generation merozoites of E. necatrix. When used as recombinant subunit vaccines, they effectively induce protective immunity. By eliciting systemic and mucosal antibody responses, a balanced Th1/Th2 cellular response, and CD4⁺ T‑cell expansion, they establish a synergistic immune protection network that significantly reduces weight loss, intestinal pathology, and oocyst output upon challenge. Thus, EnMIC and EnMAR2 are not only functional invasion molecules but also promising vaccine candidates against avian coccidiosis.

Author contributions

Xiaokai Song conceived and designed the study, and revised the manuscript. Shilin Xin performed the experiments and wrote the initial draft. Fengwan Zhang and Yifan Zhang participated in the animal experiments. Mingmin Lu revised the manuscript. Chen Chen, Lixin Xu, Ruofeng Yan and Xiangrui Li provided guidance and support. All authors contributed to the writing of the manuscript and approved the final version.

Disclosures

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgments

This research was funded by the National Natural Science Foundation of China (Grant No. 32573391).

References

  1. Attree E., Sanchez-Arsuaga G., Jones M., Xia D., Marugan-Hernandez V., Blake D., Tomley F. Controlling the causative agents of coccidiosis in domestic chickens; an eye on the past and considerations for the future. CABI. Agric. Biosci. 2021;2(1):37. doi: 10.1186/s43170-021-00056-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Arianne B.J., Blake D., Beard J., Beharry A., Serrette L., Soleyn A., Sookhoo J., Blake L., Brown G., Oura C. Molecular identification of Eimeria species in broiler chickens in Trinidad. West Indies. Vet Sci. 2018;5(1):12. doi: 10.3390/vetsci5010012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Blake D.P., Knox J., Dehaeck B., Huntington B., Rathinam T., Ravipati V., Ayoade S., Gilbert W., Adebambo A.O., Jatau I.D., Raman M., Parker D., Rushton J., Tomley F.M. Re-calculating the cost of coccidiosis in chickens. Vet. Res. 2020;51(1):115. doi: 10.1186/s13567-020-00837-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Blake D.P., Tomley F.M. Securing poultry production from the ever-present Eimeria challenge. Trends. Parasitol. 2014;30(1):12–19. doi: 10.1016/j.pt.2013.10.003. [DOI] [PubMed] [Google Scholar]
  5. Bremner, A. 2018. Innate responses and biomarkers of resistance to Eimeria infection in the chicken.
  6. Burrell A., Tomley F.M., Vaughan S., Marugan-Hernandez V. Life cycle stages, specific organelles and invasion mechanisms of Eimeria species. Parasitology. 2019;147(3):263–278. doi: 10.1017/S0031182019001562. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Carruthers V., Boothroyd J.C. Pulling together: an integrated model of Toxoplasma cell invasion. Curr. Opin. Microbiol. 2007;10(1):83–89. doi: 10.1016/j.mib.2006.06.017. [DOI] [PubMed] [Google Scholar]
  8. Chapman H.D. A landmark contribution to poultry science—prophylactic control of coccidiosis in poultry. Poult. Sci. 2009;88(4):813–815. doi: 10.3382/ps.2008-00316. [DOI] [PubMed] [Google Scholar]
  9. Chapman H.D. Milestones in avian coccidiosis research: a review. Poult. Sci. 2014;93(3):501–511. doi: 10.3382/ps.2013-03634. [DOI] [PubMed] [Google Scholar]
  10. Chapman H.D., Jeffers T.K. Vaccination of chickens against coccidiosis ameliorates drug resistance in commercial poultry production. Int. J. Parasitol. Drugs Drug Resist. 2014;4(3):214–217. doi: 10.1016/j.ijpddr.2014.10.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Chen X., Chen C., Fu X. Hypoglycemic effect of the polysaccharides from Astragalus membranaceus on type 2 diabetic mice based on the "gut microbiota-mucosal barrier". Food Funct. 2022;13(19):10121–10133. doi: 10.1039/d2fo02300h. [DOI] [PubMed] [Google Scholar]
  12. Chen F., Wang Y., Wang K., Chen J., Jin K., Peng K., Chen X., Liu Z., Ouyang J., Wang Y., Zhang X., Zou H., Zhou J., He B., Lin Q. Effects of Litsea cubeba essential oil on growth performance, blood antioxidation, immune function, apparent digestibility of nutrients, and fecal microflora of pigs. Front. Pharmacol. 2023;14 doi: 10.3389/fphar.2023.1166022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Chen X., Chen C., Ma C., Kang W., Wu J., Fu X. Dendrobium officinale polysaccharide attenuates type 2 diabetes in mice model by modulating gut microbiota and alleviating intestinal mucosal barrier damage. Food Sci. Hum. Wellness. 2025;14(1):112–123. [Google Scholar]
  14. Chengat Prakashbabu B., Thenmozhi V., Limon G., Kundu K., Kumar S., Garg R., Clark E.L., Srinivasa Rao A.S.R., Raj D.G., Raman M., Banerjee P.S., Tomley F.M., Guitian J., Blake D.P. Eimeria species occurrence varies between geographic regions and poultry production systems and may influence parasite genetic diversity. Vet. Parasitol. 2017;233:62–72. doi: 10.1016/j.vetpar.2016.12.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Clarke L., Fodey T.L., Crooks S.R.H., Moloney M., O'Mahony J., Delahaut P., O'Kennedy R., Danaher M. A review of coccidiostats and the analysis of their residues in meat and other food. Meat. Sci. 2014;97(3):358–374. doi: 10.1016/j.meatsci.2014.01.004. [DOI] [PubMed] [Google Scholar]
  16. Dalloul R.A., Lillehoj H.S. Poultry coccidiosis: recent advancements in control measures and vaccine development. Expert. Rev. Vaccines. 2006;5(1):143–163. doi: 10.1586/14760584.5.1.143. [DOI] [PubMed] [Google Scholar]
  17. David M.W., Nicholas S.C. Strategies for anti-coccidial prophylaxis. Parasitology. 2014;141(11):1379–1389. doi: 10.1017/S0031182014000195. [DOI] [PubMed] [Google Scholar]
  18. Feng Q., Yan D., Xue N., Liu D., Cai W., Zhou Y., Hou Z., Xu J., Tao J. Molecular characterization and immunoprotective potential of microneme protein 3 from Eimeria necatrix. Parasit. Vectors. 2026;19(1):253. doi: 10.1186/s13071-026-07418-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Fitz-Coy S., Edgar S. Pathogenicity and control of Eimeria mitis infections in broiler chickens. Avian Dis. 1992;36(1):44–48. [PubMed] [Google Scholar]
  20. Gao Y., Sun P., Hu D., Tang X., Zhang S., Shi F., Yan X., Yan W., Shi T., Wang S., Zou J., Yin G., Liu X., Dong H., Suo X. Advancements in understanding chicken coccidiosis: from Eimeria biology to innovative control strategies. One Health A. 2024;2(1) [Google Scholar]
  21. Gore T.C., Long P.L. The biology and pathogenicity of a recent field isolate of Eimeria praecox Johnson, 1930. J Protozool. 1982;29(1):82–85. doi: 10.1111/j.1550-7408.1982.tb02884.x. [DOI] [PubMed] [Google Scholar]
  22. Gussem M.D. WPSA; 2007. Coccidiosis in Poultry: Review on Diagnosis, Control, Prevention and Interaction with Overall Gut Health. [Google Scholar]
  23. Hein H. Pathogenic effects of Eimeria necatrix in young chickens. Exp. Parasitol. 1971;30(3):321–330. doi: 10.1016/0014-4894(71)90095-6. [DOI] [PubMed] [Google Scholar]
  24. Hodgson J.N. Coccidiosis: oocyst counting technique for coccidiostat evaluation. Exp. Parasitol. 1970;28(1):99–102. doi: 10.1016/0014-4894(70)90073-1. [DOI] [PubMed] [Google Scholar]
  25. Holdsworth P.A., Conway D.P., McKenzie M.E., Dayton A.D., Chapman H.D., Mathis G.F., Skinner J.T., Mundt H.C., Williams R.B. World Association for the Advancement of Veterinary Parasitology (WAAVP) guidelines for evaluating the efficacy of anticoccidial drugs in chickens and turkeys. Vet. Parasitol. 2004;121(3–4):189–212. doi: 10.1016/j.vetpar.2004.03.006. [DOI] [PubMed] [Google Scholar]
  26. Hou Y., Han B., Lin Z., Liu Q., Liu Z., Si H., Hu D. Effects of six natural compounds and their derivatives on the control of coccidiosis in chickens. Microorganisms. 2024;12(3):601. doi: 10.3390/microorganisms12030601. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Huang X., Liu J., Tian D., Li W., Zhou Z., Huang J., Song X., Xu L., Yan R., Li X. The molecular characterization and protective efficacy of microneme 3 of Eimeria mitis in chickens. Vet. Parasitol. 2018;258:114–123. doi: 10.1016/j.vetpar.2018.06.020. [DOI] [PubMed] [Google Scholar]
  28. Llalla Vidal T.M., Boobphahom S., Tongkamsai S., Flavel M. Effect of Polygain™ supplementation on growth performance, lesion severity, and oocyst shedding in eimeria-challenged broiler chickens. Animals. (Basel) 2025;15(21):3130. doi: 10.3390/ani15213130. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Lu M., Wei W., Xu W., Polyakov N.E., Dushkin A.V., Su W. Preparation of DNC solid dispersion by a mechanochemical method with glycyrrhizic acid and polyvinylpyrrolidone to enhance bioavailability and activity. Polymers. (Basel) 2022;14(10):2037. doi: 10.3390/polym14102037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Johnson J., Reid W.M. Anticoccidial drugs: lesion scoring techniques in battery and floor-pen experiments with chickens. Exp. Parasitol. 1970;28(1):30–36. doi: 10.1016/0014-4894(70)90063-9. [DOI] [PubMed] [Google Scholar]
  31. Jorgensen W.K., Stewart N.P., Jeston P.J., Molloy J.B., Dalgliesh R.J. Isolation and pathogenicity of Australian strains of Eimeria praecox and Eimeria mitis. Aust. Vet. J. 1997;75(8):592–595. doi: 10.1111/j.1751-0813.1997.tb14201.x. [DOI] [PubMed] [Google Scholar]
  32. Kadykalo S., Roberts T., Thompson M., Wilson J., Lang M., Espeisse O. The value of anticoccidials for sustainable global poultry production. Int. J. Antimicrob. Agents. 2018;51(3):304–310. doi: 10.1016/j.ijantimicag.2017.09.004. [DOI] [PubMed] [Google Scholar]
  33. Kibria K.M.K., Ferdous J., Sardar R., Panda A., Gupta D., Mohmmed A., Malhotra P. A genome-wide analysis of coatomer protein (COP) subunits of apicomplexan parasites and their evolutionary relationships. BMC. Genomics. 2019;20(1):98. doi: 10.1186/s12864-019-5463-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Kundu K., Garg R., Kumar S., Mandal M., Tomley F.M., Blake D.P., Banerjee P.S. Humoral and cytokine response elicited during immunisation with recombinant Immune Mapped protein-1 (EtIMP-1) and oocysts of Eimeria tenella. Vet. Parasitol. 2017;244:44–53. doi: 10.1016/j.vetpar.2017.07.025. [DOI] [PubMed] [Google Scholar]
  35. Lee Y., Panebra A., Park I., Lillehoj H.S. Orally-delivered Bacillus subtilis carrying Eimeria profilin gene protects against Eimeria tenella infection in chickens. Poult. Sci. 2026;105(2) doi: 10.1016/j.psj.2025.106245. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Lillehoj H.S., Trout J.M. Avian gut-associated lymphoid tissues and intestinal immune responses to Eimeria parasites. Clin. Microbiol. Rev. 1996;9(3):349–360. doi: 10.1128/cmr.9.3.349. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Lillehoj H.S., Choi K.D. Recombinant chicken interferon-gamma-mediated inhibition of Eimeria tenella development in vitro and reduction of oocyst production and body weight loss following Eimeria acervulina challenge infection. Avian Dis. 1998;42(2):307–314. [PubMed] [Google Scholar]
  38. Lin R.Q., Lillehoj H.S., Lee S.K., Oh S., Panebra A., Lillehoj E.P. Vaccination with Eimeria tenella elongation factor-1α recombinant protein induces protective immunity against E. tenella and E. maxima infections. Vet. Parasitol. 2017;243:79–84. doi: 10.1016/j.vetpar.2017.06.003. [DOI] [PubMed] [Google Scholar]
  39. Liu D., Feng Y., Zhang Y., Wang F., Zhang X., Hou Z., Kang X., Xu J., Pan Z., Tao J. Development and evaluation of a recombinant attenuated Salmonella Enteritidis vaccine expressing the EnGAM59 gametocyte antigen of Eimeria necatrix for coccidiosis control. Acta Parasitol. 2025;70(4):160. doi: 10.1007/s11686-025-01100-4. [DOI] [PubMed] [Google Scholar]
  40. Longlong Z., Li Z., Fan T., Chen W., Xiaoling L., Rui B., Nairui H., Mingxue Z. Prevention and control of chicken coccidiosis construction of recombinant Lactococcus lactis expressing chicken IL-4 and IL-2 fusion protein and its immune synergistic effect on chicken coccidia live vaccine. Poult. Sci. 2023;102(4) doi: 10.1016/j.psj.2023.102530. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. López-Osorio S., Chaparro-Gutiérrez J.J., Gómez-Osorio L.M. Overview of poultry Eimeria life cycle and host-parasite interactions. Front. Vet. Sci. 2020;7:384. doi: 10.3389/fvets.2020.00384. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Ma X., Zhang X., Li J., Gong P., Wang X., Li X., Zhang X., Zhang T., Cheng S., Zhang N. A tetravalent recombinant subunit vaccine provides protection against mixed challenges with four Eimeria species in chickens. Animals. (Basel) 2026;16(7):1087. doi: 10.3390/ani16071087. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. McManus E.C., Campbell W.C., Cuckler A.C. Development of resistance to quinoline coccidiostats under field and laboratory conditions. J. Parasitol. 1968;54(6):1190–1193. [PubMed] [Google Scholar]
  44. Morris G.M., Woods W.G., Richards D.G., Gasser R.B. Investigating a persistent coccidiosis problem on a commercial broiler–breeder farm utilising PCR-coupled capillary electrophoresis. Parasitol. Res. 2007;101:583–589. doi: 10.1007/s00436-007-0516-9. [DOI] [PubMed] [Google Scholar]
  45. Saidi A., Gaboriaud P., Lalmanach A.-C., Vanderlynden L., Fessard A., Vettori P., Fort G., Guabiraba R., Schouler C., Laurent F., Guitton E., Lecaille F., Bussière F.I., Lalmanach G. Upregulation of gut cathepsin L during Eimeria tenella infection. Res. Vet. Sci. 2021;140:109–116. doi: 10.1016/j.rvsc.2021.08.013. [DOI] [PubMed] [Google Scholar]
  46. Saková K., Sak B., Ditrich O., Kváč M. Humoral response of chicken infected with the microsporidium Encephalitozoon hellem. Parasitol. Res. 2006;98:488–492. doi: 10.1007/s00436-005-0089-4. [DOI] [PubMed] [Google Scholar]
  47. Salmon H., Vega C.G., Bok M., Vlasova A.N., Chattha K.S., Fernández F.M., Wigdorovitz A., Parreño V.G., Saif L.J. IgY antibodies protect against human rotavirus induced diarrhea in the neonatal gnotobiotic piglet disease model. PLoS. One. 2012;7(8) doi: 10.1371/journal.pone.0042788. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Sharman P.A., Smith N.C., Wallach M.G., Katrib M. Chasing the golden egg: vaccination against poultry coccidiosis. Parasite Immunol. 2010;32(8):590–598. doi: 10.1111/j.1365-3024.2010.01209.x. [DOI] [PubMed] [Google Scholar]
  49. Soldati D., Meissner M. Toxoplasma as a novel system for motility. Curr. Opin. Cell Biol. 2004;16:32–40. doi: 10.1016/j.ceb.2003.11.013. [DOI] [PubMed] [Google Scholar]
  50. Song H., Yan R., Xu L., Song X., Shah M., Zhu A.A.H., Li X. Efficacy of DNA vaccines carrying Eimeria acervulina lactate dehydrogenase antigen gene against coccidiosis. Exp. Parasitol. 2010;126(2):224–231. doi: 10.1016/j.exppara.2010.05.015. [DOI] [PubMed] [Google Scholar]
  51. Su M., Tang T., Tang W., Long Y., Wang L., Liu M. Astragalus improves intestinal barrier function and immunity by acting on intestinal microbiota to treat T2DM: a research review. Front. Immunol. 2023;14 doi: 10.3389/fimmu.2023.1243834. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Tajima O., Onaga H., Nakamura T. An enzyme-linked immunosorbent assay with the recombinant merozoite protein as antigen for detection of antibodies to Eimeria necatrix. Avian Dis. 2003;47(2):309–318. doi: 10.1637/0005-2086(2003)047[0309:AEIAWT]2.0.CO;2. [DOI] [PubMed] [Google Scholar]
  53. Talebi A., Mulcahy G. Partial protection against Eimeria acervulina and Eimeria tenella induced by synthetic peptide vaccine. Exp. Parasitol. 2005;110:342–348. doi: 10.1016/j.exppara.2005.03.026. [DOI] [PubMed] [Google Scholar]
  54. Tewari A.K., Maharana B.R. Control of poultry coccidiosis: changing trends. J. Parasit. Dis. 2011;35:10–17. doi: 10.1007/s12639-011-0034-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Tian L., Li W., Huang X., Tian D., Liu J., Yang X., Liu L., Yan R., Xu L., Li X., Song X. Protective efficacy of coccidial common antigen glyceraldehyde 3-phosphate dehydrogenase (GAPDH) against challenge with three eimeria species. Front. Microbiol. 2017;8:1245. doi: 10.3389/fmicb.2017.01245. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Tomley F.M., Soldati D.S. Mix and match modules: structure and function of microneme proteins in apicomplexan parasites. Trends. Parasitol. 2001;17:81–88. doi: 10.1016/s1471-4922(00)01761-x. [DOI] [PubMed] [Google Scholar]
  57. Travis J., J., David S.L. Aldolase forms a bridge between cell surface adhesins and the actin cytoskeleton in apicomplexan parasites. Mol. Cell. 2003;11(4):885–894. doi: 10.1016/s1097-2765(03)00113-8. [DOI] [PubMed] [Google Scholar]
  58. Venkatas J., Adeleke M.A. A review of Eimeria antigen identification for the development of novel anticoccidial vaccines. Parasitol. Res. 2019;118(6):1701–1710. doi: 10.1007/s00436-019-06338-2. [DOI] [PubMed] [Google Scholar]
  59. Vrba V., Blake D.P., Poplstein M. Quantitative real-time PCR assays for detection and quantification of all seven Eimeria species that infect the chicken. Vet. Parasitol. 2010;174(3–4):183–190. doi: 10.1016/j.vetpar.2010.09.006. [DOI] [PubMed] [Google Scholar]
  60. Wang F., Ye Z., Liu Y., Wang L., Su S., Hou Z., Xu J., Tao J., Liu D. Characterization of the novel glucose-methanol-choline (GMC) oxidoreductase EnOXIO1 in Eimeria necatrix. Vet. Parasitol. 2023;321 doi: 10.1016/j.vetpar.2023.110002. [DOI] [PubMed] [Google Scholar]
  61. Wang F., Peng Y., Ye Z., Feng Y., Zhang Y., Xu J., Tao J., Liu D. A novel glutathione peroxidase (EnGPX) from Eimeria necatrix contributes to oocyst wall biogenesis and confers protective immunity in chickens. Vet. Parasitol. 2025;339 doi: 10.1016/j.vetpar.2025.110588. [DOI] [PubMed] [Google Scholar]
  62. Williams R.B., Marshall R.N., Pagès M., Dardi M., del Cacho E. Pathogenesis of Eimeria praecox in chickens: virulence of field strains compared with laboratory strains of E. praecox and Eimeria acervulina. Avian Pathol. 2009;38(5):359–366. doi: 10.1080/03079450903186028. [DOI] [PubMed] [Google Scholar]
  63. Williams R.B. Anticoccidial vaccines for broiler chickens: pathways to success. Avian Pathol. 2002;31(4):317–353. doi: 10.1080/03079450220148988. [DOI] [PubMed] [Google Scholar]
  64. Yan M., Cui X., Zhao Q., Zhu S., Huang B., Wang L., Zhao H., Liu G., Li Z., Han H., Dong H. Molecular characterization and protective efficacy of the microneme 2 protein from Eimeria tenella. Parasite. 2018;25:60. doi: 10.1051/parasite/2018061. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Yun C.H., Lillehoj H.S., Lillehoj E.P. Intestinal immune responses to coccidiosis. Dev. Comp. Immunol. 2000;24(2–3):303–324. doi: 10.1016/s0145-305x(99)00080-4. [DOI] [PubMed] [Google Scholar]
  66. Zhao N., Lv J., Lu Y., Jiang Y., Li H., Liu Y., Zhang X., Zhao X. Prolonging and enhancing the protective efficacy of the EtMIC3-C-MAR against Eimeria tenella through delivered by attenuated Salmonella typhimurium. Vet. Parasitol. 2020;279 doi: 10.1016/j.vetpar.2020.109061. [DOI] [PubMed] [Google Scholar]
  67. Zhao N., Ming S., Sun L., Wang B., Li H., Zhang X. Identification and characterization of Eimeria tenella microneme protein (EtMIC8) Microbiol. Spectr. 2021;9(1) doi: 10.1128/spectrum.00228-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Zhang Y., Lu M., Zhang Z., Huang X., Huang J., Liu J., Huang J., Song X., Xu L., Yan R., Li X. The microneme adhesive repeat domain of MIC3 protein determined the site specificity of Eimeria acervulina, Eimeria maxima, and Eimeria mitis. Front. Immunol. 2023;14 doi: 10.3389/fimmu.2023.1291379. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Zhou X., Wu Y., Zhu Z., Lu C., Zhang C., Zeng L., Xie F., Zhang L., Zhou F. Mucosal immune response in biology, disease prevention and treatment. Signal. Transduct. Target. Ther. 2025;10(1):7. doi: 10.1038/s41392-024-02043-4. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES