Skip to main content
NCBI home page
Microbial Biotechnology logoLink to Microbial Biotechnology
. 2026 Aug 19;19(8):e70433. doi: 10.1111/1751-7915.70433

A Safe and Effective Bivalent Vaccine Candidate Against Duck Enteritis Virus and Duck‐Origin Novel Goose Parvovirus

Liu Chen 1,✉, Jionggang Hua 1, Weicheng Ye 1, Cun Zhang 1, Xinjin Li 1, Yinchu Zhu 1, Yuan Fu 1, Liang He 1, Suxin Huo 1, Zongxiao Wang 1,2, Zhuanli Wu 1, Tao Yun 1,✉
PMCID: PMC13487463  PMID: 42614003

ABSTRACT

Since 2015, duck‐origin novel goose parvovirus (NGPV) has caused severe economic losses to the Chinese duck industry, with no licensed vaccines or treatments available. Our previous study constructed a recombinant duck enteritis virus (rDEV) from an attenuated vaccine strain, which conferred full protection against virulent DEV challenge. NGPV VP2 is the major immunogenic structural antigen. In this study, we generated a recombinant virus rNGPV VP2‐Cre by inserting the NGPV VP2 gene into the rDEV genome. VP2 expression and virus‐like particle assembly were confirmed. Safety and efficacy were evaluated in ducklings. The results showed that rNGPV VP2‐Cre was safe, facilitated clearance of NGPV and provided strong protection against challenge with a highly virulent DEV strain. In summary, rNGPV VP2‐Cre represents a promising bivalent vaccine candidate for concurrent control of DEV and NGPV infections.

Keywords: bivalent vaccine, duck enteritis virus, duck origin‐novel goose parvovirus, immunoprotection, virus‐like particles

NGPV VP2 is expressed made DEV as vector and experessed NGPV VP2 could form virus‐like particles. rNGPV VP2‐Cre could facilitate clearance of NGPV and provided strong protection against highly virulent DEV.

graphic file with name MBT2-19-e70433-g011.jpg

1. Introduction

Short beak and dwarfism syndrome (SBDS), characterised by clinical signs such as diarrhoea, beak shrinkage, growth retardation, tongue exposure and osteoporosis, was first reported in mule ducks in southwestern France during 1971–1972 (Palya et al. 2009). Since 2015, outbreaks of SBDS have occurred in commercial flocks of young ducklings in China (Chen, Dou, et al. 2015; Chen et al. 2016; Wang et al. 2016). The causative agent of SBDS was identified as duck‐origin novel goose parvovirus (NGPV), a genetically variant strain related to Muscovy duck parvovirus (MDPV) and goose parvovirus (GPV). NGPV infection has gradually emerged in duck production regions of Shandong, Anhui, Fujian, Jiangsu, Guangdong, Guangxi, Sichuan, Jiangxi, Henan, Zhejiang, Hubei and Hebei provinces, as well as Beijing, Shanghai and Chongqing municipalities (Chen, Dou, et al. 2015; Chen et al. 2016; Wang et al. 2016, 2021; Chi and Lin 2024; Huang 2022; Qiao et al. 2024; Wei et al. 2024; Jiao et al. 2023; Zhao et al. 2019; Bian 2019). Most infected ducks exhibit stunted growth, which increases culling rates and reduces production quality in duck flocks. In addition to China, similar outbreaks have been reported in Vietnam, Poland and Egypt in recent years (Huong et al. 2024; Matczuk et al. 2020; Eid et al. 2024; Soliman et al. 2020). These outbreaks cause significant economic losses and threaten the sustainable development of the duck breeding industry.

NGPV is the etiological agent of SBDS. It is an icosahedral, nonenveloped virus measuring approximately 20–22 nm in diameter (Li 2017). The virus belongs to the genus Dependovirus within the subfamily Parvovirinae (Chen, Dou, et al. 2015; Wang et al. 2016). This classification is similar to that of MDPV and GPV. The genomes of MDPV, GPV and NGPV show limited sequence divergence and are approximately 5.1 kb in length. The genome of NGPV consists of a single‐stranded DNA (ssDNA) molecule containing two open reading frames (ORFs). These ORFs are flanked by identical inverted terminal repeats at both termini. ORF1 and ORF2 encode two nonstructural proteins (NS1 and NS2) and three structural proteins (VP1, VP2 and VP3). Among these proteins, VP2 exhibits the highest immunogenicity. In addition, VP3 is the most abundant capsid protein and accounts for approximately 80% of the total capsid protein content. VP3 contains the major antigenic determinant that induces production of neutralising antibodies (Yu et al. 2016).

Similar to pseudorabies virus (PRV), duck enteritis virus (DEV), which belongs to the family Alphaherpesviridae, is considered an attractive viral vector for vaccine development. Several characteristics support this application. Live attenuated DEV vaccines are widely used to prevent lethal DEV infections in major duck‐producing regions. The virus has a relatively narrow host range, which contributes to favourable biosafety. In addition, the DEV genome contains multiple noncoding regions suitable for insertion of foreign genes and has a large genetic carrying capacity. Successful use of DEV as a viral vector has already been demonstrated. For example, a DEV‐based bivalent viral vector vaccine expressing avian influenza virus H5 antigen (rDEVus78Ha strain) has been approved as a Class I new veterinary pharmaceutical by the Ministry of Agriculture and Rural Affairs of the People's Republic of China (Liu et al. 2011).

At present, no commercial vaccine is available for NGPV infection. Development of safe and effective vaccines, therefore, remains an urgent priority. In the present study, a recombinant DEV expressing the NGPV VP2 gene was generated using the infectious full‐length clone of the DEV vaccine strain pDEV‐EF1 (Chen et al. 2013; Chen, Yu, et al. 2015). The vaccine potential of the recombinant virus rNGPV VP2‐Cre, including safety, immunogenicity and protective efficacy, was subsequently evaluated in ducklings.

2. Materials and Methods

2.1. Viruses, Bacterial Strains and Plasmids

The bacterial strain pDEV‐EF1/GS1783, which harbours the full‐length infectious bacterial artificial chromosome (BAC) clone of the DEV vaccine strain, along with the corresponding viruses rE1 and rDEV‐Cre, was previously constructed and stored in our laboratory (Chen et al. 2013; Chen, Yu, et al. 2015). The DEV CHv strain (CVCC AV1221), a highly virulent strain, was obtained from the National Center for Veterinary Culture Collection (CVCC) (Beijing, China). A highly virulent NGPV ZJ strain was isolated from clinical samples. The plasmids pEP‐BGH‐end and pCAGGS‐NLS/Cre were kindly provided by Dr. N. Osterrieder (Freie Universität Berlin, Berlin, Germany).

2.2. Cell, Culture Condition and Cell Line Information

Chicken embryo fibroblasts (CEFs) were isolated from 9‐ to 11‐day‐old specific‐pathogen‐free (SPF) embryonated eggs (Ningbo Chunpai Agricultural Technology Co. Ltd., Ningbo, China) following standard procedures. The cells were cultured in Dulbecco's Modified Eagle Medium (DMEM) (Gibco‐BRL, Gaithersburg, MD, USA) supplemented with 8% fetal bovine serum (FBS) and antibiotics (100 U/mL penicillin and 100 μg/mL streptomycin).

CEF line information was as follows: (i) Metadata: Species Gallus gallus domesticus; mixed‐sex whole embryonic tissue; primary CEFs; no RRID (only assigned to immortalised cell lines). (ii) Source and acquisition: SPF fertilised eggs were obtained from the above supplier with official SPF quarantine certification. (iii) Authentication and contamination detection: (a) Species identification was performed via chicken COI barcoding, showing 100% match with Gallus gallus GenBank reference sequences. (b) Fresh primary CEFs are not listed as misidentified/contaminated lines in the ICLAC database. (c) All CEF batches tested negative for mycoplasma by rRNA‐targeted PCR before experiments.

2.3. Construction of the Recombinant Vector BGH‐NGPV VP2

The NGPV VP2 gene was synthesised after codon optimisation based on the codon usage preference of ducks, as shown in Supporting Information S1. Kpn I and Not I restriction sites were introduced at the 5′ and 3′ termini, respectively. Gene synthesis was performed by Sangon Corporation (Shanghai, China) according to the NGPV VP2 sequence (GenBank: ATX74763.1). The plasmid BGH‐NGPV VP2 was constructed by inserting the NGPV VP2 gene into the pEP‐BGH‐end vector using Kpn I and Not I restriction sites.

2.4. Generation of the Recombinant DEV BAC Clones Delivering the NGPV VP2 Gene

The recombinant BAC clone was generated by inserting the expression cassette pCMV‐NGPV VP2‐BGH‐pA into the intergenic region between DEV US7 and US8 through two‐step Red‐mediated recombination (en passant) (Tischer et al. 2006, 2010) (Figure 1). Specifically, to construct pNGPV VP2, the pCMV‐NGPV VP2‐BGH‐pA expression cassette flanked by homology arms corresponding to DEV US7 and US8 was amplified from BGH‐NGPV VP2 using Rec‐s and Rec‐as primers (Table 1). The purified PCR product (3505 bp) was electroporated into GS1783/pDEV‐EF1 competent bacteria. The transformed bacteria were incubated for 2 h at 32°C and plated on LB agar supplemented with chloramphenicol (CAM, 34 μg/mL) and kanamycin (KAN, 50 μg/mL). The cultures were incubated until colonies appeared. A CAM/KAN‐resistant clone (pkan‐NGPV VP2) was identified as a positive clone by PCR using jd‐F and jd‐R primers (Table 1). Confirmation was further performed by restriction fragment length polymorphism (RFLP) analysis after BamH I digestion. The confirmed clone was subjected to a second red recombination step to remove the kanamycin resistance gene. Colonies that were resistant to chloramphenicol but sensitive to kanamycin were selected. Subsequently, the recombinant clone (pNGPV VP2) was verified by RFLP analysis using BamH I digestion. Additional confirmation was obtained by sequencing PCR products (3001 bp) amplified with jd‐F and jd‐R primers (Table 1), which flank the inserted NGPV VP2 sequence.

FIGURE 1.

FIGURE 1

Open in a new tab

Construction of recombinant pDEV‐NGPV VP2. (A) A mini‐F vector (pHA2) was inserted into the intergenic region between UL15B and UL18 of the DEV vaccine strain. (B) The pCMV promoter driving GFP expression in pDEV‐vac was replaced with the pEF1 gene. (C) Schematic diagram of the recombinant virus showing insertion of the pCMV‐NGPV VP2‐BGH‐pA expression cassette into the intergenic region between DEV US7 and US8 through two‐step Red‐mediated recombination (en passant). The procedures shown in the dotted box (A, B) were reported previously (Chen et al. 2013).

TABLE 1.

Primers used in this study.

Primer Sequence
Rec‐s 5′‐TACTAATTTAAGTGTGCAGCCTGGTTAACTGTATT
ATGCGCGGAGCGATGTACGGGCCAGATA‐3′
Rec‐as 5′‐TCCGTAGTCTGGCCGGCAGTATGTTGGTGTTT
AGTACTCCAAACCCATAGAGCCCACCGCATCCCC‐3′
jd‐F 5′‐CTACCACAAGCGTCATCAACCA‐3′
jd‐R 5′‐TGTCCATTACCAAATCCGAAAA‐3′
18F 5′‐CGACGAGAGTATCAGCACTCATC‐3′
15R 5′‐ATCGACGAACAACTAAGAGTTTGC‐3′
Open in a new tab

Note: The bold sequences represent homologous regions corresponding to the intergenic insertion sites between DEV US7 and US8 and serve as homologous recombination arms.

2.5. Rescue of Recombinant Viruses

The pNGPV VP2 plasmid was isolated from bacteria using the alkaline lysis method. Subsequently, 2 μg of pNGPV VP2 was transfected into CEFs cultured in 6‐well plates using the calcium phosphate precipitation method as previously described (Chen et al. 2013). After transfection, the cells were cultured until fluorescent plaques appeared. The cultures were maintained until 70%–80% cytopathic effect (CPE) was observed. The virus harvested from these cells was designated rNGPV VP2. To eliminate the influence of additional BAC sequences containing xgpt and gfp genes, the redundant sequence was removed through site‐specific recombination between flanking loxP sites. This excision was performed by co‐transfecting 4 μg of pNGPV VP2 and 1 μg of the Cre recombinase expression plasmid pCAGGS‐NLS/Cre into CEF cultures. One day after transfection, the culture medium was replaced with DMEM containing 1.5% methylcellulose (Sigma‐Aldrich, St. Louis, MO, USA). Subsequently, several rounds of limiting dilution and plaque purification were performed. Typical DEV CPE lacking green fluorescent protein (GFP) expression was obtained. The accurate excision of redundant BAC sequences from rNGPV VP2‐Cre was confirmed by PCR amplification using the 18F/15R primer pair, followed by sequencing analysis.

2.6. Measurement of Viral Plaque Size

Plaque sizes of the recombinant virus rNGPV VP2 and the control virus rE1 were measured as described previously (Chen et al. 2013; Chen, Yu, et al. 2015). One hundred fluorescent plaques were randomly selected and photographed. Plaque sizes were measured using ImageJ software (version 1.42) (http://rsb.info.nih.gov/ij/). Statistical analysis was performed using a two‐tailed unpaired t‐test in GraphPad Prism 10 (San Diego, CA, USA).

2.7. Western Blot Analysis of NGPV VP2 Protein Expression

Expression of the NGPV VP2 protein was examined by Western blot analysis using an anti‐GPV VP2 monoclonal antibody (mAb) prepared in our laboratory (Chen et al. 2022). Specifically, CEFs were infected with rNGPV VP2 or rNGPV VP2‐Cre at a multiplicity of infection (MOI) of 1.0. When most cells exhibited CPE, the cells were harvested, washed with phosphate‐buffered saline (PBS) and lysed with sample buffer. The lysates were separated by 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS‐PAGE) and transferred onto a nitrocellulose (NC) membrane (Millipore, Boston, MA, USA). The membrane was blocked with PBST (PBS containing 0.05% Tween 20) supplemented with 10% skimmed milk for 2 h at 37°C. The membrane was incubated with the primary antibody (anti‐GPV VP2 mAb, 1:500 dilution), followed by a horseradish peroxidase (HRP)‐conjugated goat anti‐mouse IgG secondary antibody (Santa Cruz, CA, USA). The signal was detected using Western Blot Hyper HRP Substrate (Takara Co. Ltd., Tokyo, Japan). Chemiluminescence signals were visualised with a Molecular Imager ChemiDoc XRS+ imaging system (Bio‐Rad Laboratories, Hercules, CA, USA).

2.8. NGPV VP2 Protein Localisation

CEFs were seeded on glass slides in 12‐well plates. The next day, cells were infected with rNGPV VP2‐Cre at an MOI of 0.02. Immunofluorescence assay (IFA) was performed at 24 h post‐infection. After two washes with PBS (pH 7.2), the cells were fixed with ice‐cold methanol–acetone (1:1). Following three additional washes, the cells were blocked with 1% BSA in PBST for 1 h at 37°C. The cells were then incubated sequentially with anti‐GPV VP2 mAb (1:100 dilution) as the primary antibody and Cy3‐labelled goat anti‐mouse IgG (Beyotime, Shanghai, China) as the secondary antibody. Finally, cell nuclei were stained with DAPI solution (Beyotime, Shanghai, China). Fluorescence signals were visualised using an Eclipse TS2 inverted microscope (Nikon, Tokyo, Japan) and a laser scanning confocal microscope (Leica TCS‐SP5) (Leica, Heidelberg, Germany) equipped with a 100× oil immersion objective.

2.9. Electron Microscopy

2.9.1. Transmission Electron Microscopy (TEM)

CEFs infected with rNGPV VP2‐Cre at an MOI of 0.01 were processed for sectioning at 48 h post‐infection. TEM was performed following the method described previously (Chen et al. 2021).

2.9.2. Immuno‐Electron Microscopy (IEM)

IEM was performed according to the method described previously (Shang et al. 2023). In brief, rNGPV VP2‐Cre‐infected CEFs were fixed at 48 h post‐infection with 4% paraformaldehyde in PHEM buffer (pH 6.9) containing 60 mM PIPES (piperazine‐N,N′‐bis(2‐ethanesulfonic acid)), 25 mM HEPES (4‐(2‐hydroxyethyl)‐1‐piperazineethanesulfonic acid), 10 mM EGTA (ethylene glycol‐bis(β‐aminoethyl ether)‐N,N,N′,N′‐tetraacetic acid) and 2 mM MgSO4 for 4 h at room temperature. CEFs were embedded in 10% (wt/vol) gelatin, cryoprotected overnight in 2.3 M sucrose containing 20% polyvinylpyrrolidone, frozen in liquid nitrogen and cryosectioned at −120°C using a Leica EM FCS cryoultramicrotome (Leica, Heidelberg, Germany). Thawed 90‐nm sections were quenched with 20 mM glycine for 5 min. After blocking with 3% BSA in PBS for 30 min, immunogold labeling was performed using GPV VP2 mAb (1:100 in 1% BSA) followed by 10‐nm gold‐conjugated protein A. The sections were stained with 1.8% methylcellulose and 0.4% uranyl acetate and observed using an HT7700 transmission electron microscope (HITACHI, Tokyo, Japan).

2.10. Evalution of Genetic Stablity of Recombinant Virus

The resuced rNGPV VP2‐Cre was labelled as first‐generation virus, and then the virus was re‐infected with CEFs to prepare the next generation of the virus until the virus was uploaded to the 20th passage. DNA was extracted from the 1st, 5th, 10th and 20th passages of each virus according to the instructions of the Animal Virus DNA/RNA Extraction Kit (Magnetic Bead) (Compurify Biotech Co. Ltd., Changzhou, Jiangsu, China) and PCR identification with jd‐F and jd‐R primers (Table 1) was performed. A multi‐step growth curve of virus titers at passages 1, 5, 10 and 20 for each virus was determined on CEFs. All experiments were repeated 3 times. Expression of VP2 proteins from different passages‐infected cells was analysed by Western blot.

2.11. Quantitation of Viral DNA

To determine viral DNA in swabs or tissues of experimental ducklings, SYBR real‐time PCR was performed as previously described (Shang et al. 2023). Briefly, viral DNA (vDNA) was isolated from NGPV‐infected swabs or tissues of ducklings using the Animal Virus DNA/RNA Extraction Kit (Magnetic Bead) (Compurify Biotech Co. Ltd., Changzhou, Jiangsu, China). One microliter of purified vDNA was diluted in nuclease‐free H2O and added to a 20 μL reaction mixture. The reaction mixture contained 10 μL qPCR SYBR Green Master Mix (Vazyme, Shanghai, China), 0.2 μL NGPV NS‐F primer (5′‐TACAATGGAACACAGAATWCC‐3′), 0.2 μL NGPV NS‐R primer (5′‐TCAGACACAACAGGAACWA‐3′) and 8.6 μL ddH2O. The NGPV NS‐F and NGPV NS‐R primers target the SF3 domain of the NGPV NS helicase gene. PCR conditions included an initial denaturation at 95°C for 30 s, followed by 40 cycles of denaturation at 95°C for 10 s and annealing/extension at 50°C for 30 s.

2.12. Determination of Serum IgG Antibodies

IgG antibody titers against NGPV VP2 were determined using an indirect enzyme‐linked immunosorbent assay (iELISA) based on VP2 protein. The VP2 protein was expressed and purified with a His‐tag using a prokaryotic Escherichia coli expression system. The iELISA was performed according to the following procedure. Purified VP2 protein diluted in 0.05 M carbonate–bicarbonate buffer (CBS, pH 9.6) was added to 96‐well microplates (Thermo Fisher, Waltham, MA, USA) at a final concentration of 50 ng/well. The microplates were incubated overnight at 4°C and blocked with PBST containing 10% (w/v) skimmed milk and 10% BSA for 1 h at 37°C. Subsequently, 100 μL of 1:100 diluted serum samples, positive sera and negative sera were added to the corresponding wells. After incubation at 37°C for 1 h, the plates were washed three times with PBST. The wells were then incubated with 100 μL of HRP‐conjugated goat anti‐duck IgG (1:2000 dilution) (Kirkegaard and Perry Laboratories Inc., Gaithersburg, MD, USA). Finally, 100 μL tetramethylbenzidine (TMB) (Tiangen Biotech, Beijing, China) was added for colour development at 37°C for 10 min. The reaction was terminated by adding 50 μL of 2 M hydrochloric acid. The optical density (OD) at 450 nm was measured using a FlexA‐200 microplate reader (Aosheng, Zhejiang, China).

2.13. Determination of Neutralising Antibody Levels in Serum

Virus‐neutralising (VN) antibodies were measured as previously described (Zhou et al. 2022). In brief, serum samples were heat‐inactivated at 56°C for 30 min. The inactivated sera were subjected to twofold serial dilution and mixed with culture medium containing NGPV ZJ at a dose of 200 ELD50 (50% embryo lethal dose) in equal volumes. After incubation at 37°C for 1 h, the mixtures were inoculated into 9‐day‐old embryonated Cherry Valley duck eggs. The eggs were incubated at 37°C with 50% humidity for 7 days. Mortality of duck embryos was recorded for each dilution, and the 50% neutralisation endpoint for each sample was calculated using the Reed–Muench method.

2.14. Animal Experiments

This study was approved by the Animal Care and Use Committee of ZAAS (permit number 2021ZAASLA66). The study was conducted in accordance with the Guidelines for Experimental Animals issued by the Ministry of Science and Technology of the People's Republic of China (Beijing, China). Throughout the study, all animals were maintained in a segregated facility. This arrangement reduced the risk of cross‐infection and ensured the reliability of the experimental results.

In the safety test, 50 healthy 2‐day‐old female mallard ducks (Anas platyrhyncha) were purchased from a commercial hatchery in Huzhou. Ducklings without prior immunisation were housed in SPF animal isolators equipped with negative‐pressure ventilation. Before the challenge, serum samples and anal swabs were collected to confirm the absence of NGPV and MDPV antigens and antibodies. Ducklings were randomly assigned to five groups (Groups 1–5) with 10 birds per group (n = 10). Groups 1 and 2 were intramuscularly immunised with 1 × 106 TCID50 of rNGPV VP2‐Cre and rDEV‐Cre, respectively. Groups 3 and 4 received 1 × 105 TCID50 of rNGPV VP2‐Cre and rDEV‐Cre, respectively. Group 5 served as the unvaccinated control and received 1 mL of culture medium. Clinical signs and mortality were monitored daily for 14 days after immunisation.

In the efficacy test, 120 healthy 2‐day‐old female mallard ducks, free of NGPV and GPV antigens and antibodies, were randomly allocated to four groups (Groups 1–4) with 30 birds per group (n = 30). Birds in Groups 1 and 2 were intramuscularly immunised with 1 × 105 TCID50 rNGPV VP2‐Cre (A) and 1 × 104 TCID50 rNGPV VP2‐Cre (B), respectively. Group 3 served as the unvaccinated control and received 1 mL PBS, whereas Group 4 remained untreated (NC). Ten ducklings from each group were randomly selected and marked for subsequent collection of anal swabs, throat swabs and serum samples. The remaining 20 ducklings were reserved for tissue collection (heart, liver, spleen, lung, kidney and intestine) for viral titre determination. At 8 days post‐immunisation (d.p.i), serum samples were collected from the 10 marked ducklings in Groups 1–3, labelled A (8 d.p.i), B (8 d.p.i) and PBS (8 d.p.i). Subsequently, all ducklings were challenged with 105.5 EID50 of the NGPV ZJ strain. Anal and throat swabs were collected at 1, 3, 5 and 7 days post‐challenge (d.p.c) from the marked ducklings. Serum samples were collected at 16 d.p.c, labelled A+NGPV (16 d.p.c), B+NGPV (16 d.p.c) and PBS+NGPV (16 d.p.c). Tissues from five ducklings in each group were collected at 1, 3, 5 and 7 d.p.c. Duodenum samples collected at 5 d.p.c were used for histological analysis. After fixation in 4% paraformaldehyde, paraffin embedding, sectioning and haematoxylin and eosin (H&E) staining, the duodenum sections were examined microscopically. At 47 days after the NGPV challenge, the remaining ducklings in Groups 1 and 2 were boost‐immunised with 1 × 105 TCID50 and 1 × 104 TCID50 of rNGPV VP2‐Cre, respectively. Fourteen days after the booster immunisation, all ducks in Groups 1–3 were challenged intramuscularly with 100 × DLD50 of the highly virulent DEV CHv strain. Clinical signs and mortality were monitored daily for 14 days after challenge.

2.15. Statistical Analysis

All experiments were performed in triplicate or more (n ≥ 3 per group). Data are presented as mean ± standard deviation (SD). Statistical analysis was performed using GraphPad Prism 10.0 software (San Diego, CA, USA). An unpaired two‐tailed Student t‐test and one‐way analysis of variance (ANOVA) were used for comparisons between two groups and among multiple groups, respectively. Differences were considered statistically significant when p < 0.05. Statistical significance * is indicated as follows: *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001; ns, not significant.

3. Results

3.1. Identification of BAC Mutants Recombinants Carrying NGPV VP2

pNGPV VP2 and the corresponding intermediate pkan‐NGPV VP2 were extracted and digested with BamH I, followed by electrophoretic analysis. The RFLP pattern obtained after BamH I digestion matched the predicted pattern based on the reference sequence of the DEV vaccine strain (GenBank: KF487736.1) (Figure 2A) (Yang et al. 2013). Furthermore, PCR products amplified from recombinant BAC DNA using jd‐F/jd‐R primers showed the expected size and sequencing results matched the predicted sequence (Figure 2B). These results indicate that the NGPV VP2 gene was correctly inserted into the target region of the DEV genome.

FIGURE 2.

FIGURE 2

Open in a new tab

Identification of recombinant BAC clones by RFLP (A) and PCR (B). (A) Analysis of recombinant BAC clones by BamH I digestion. DNA marker: 15,000, 10,000, 7500, 5000, 2500 and 1000 bp. Lane 1, pE1; lane 2, pkan‐NGPV VP2; lane 3, pNGPV VP2. (B) Identification of BAC clones by PCR amplification. Lane 1, pE1 (641 bp); lane 2, pkan‐NGPV VP2 (4465 bp); lane 3, pNGPV VP2 (3408 bp).

3.2. Rescue of Recombinant Viruses

Fluorescent plaques appeared in CEFs 48 h after transfection of pNGPV VP2. Cells were harvested when 70%–80% of cells exhibited fluorescence. The recovered virus was designated rNGPV VP2 (Figure 3B). rE1 is the parental virus, as control(Figure 3A). To generate rNGPV VP2‐Cre without redundant BAC sequences, pCAGGS‐NLS/Cre and pNGPV VP2 were co‐transfected into CEFs. When typical DEV CPE appeared, plaques without green fluorescence were obtained after several rounds of limiting dilution and plaque purification. The purified virus was designated rNGPV VP2‐Cre (Figure 3C). PCR analysis confirmed deletion of the mini‐F sequence from rNGPV VP2‐Cre (data not shown).

FIGURE 3.

FIGURE 3

Open in a new tab

Rescue of recombinant viruses (100×). (A) rE1. (B) rNGPV VP2. (C) rNGPV VP2‐Cre. (A) rE1, the parental strain was constructed and stored in our laboratory; (B) rNGPV VP2 was rescued by transfecting pNGPV VP2 into CEFs using the calcium phosphate precipitation method. (C) rNGPV VP2‐Cre was generated by excision of the mini‐F sequence from rNGPV VP2 through co‐transfection of pCAGGS‐NLS/Cre and pNGPV VP2 into CEFs, followed by selection of plaques lacking GFP fluorescence.

3.3. Comparison of Plaque Size Between rNGPV VP2 and Parental Virus

Plaque areas of recombinant virus rNGPV VP2 and parental virus rE1 were compared at 2 d.p.i. Plaques formed by rNGPV VP2 were approximately 4.05% smaller than those of rE1. However, the difference was not statistically significant (p = 0.223) (Figure 4).

FIGURE 4.

FIGURE 4

Open in a new tab

Plaque size comparison of recombinant virus rNGPV VP2 and parental virus rE1 in CEFs. Plaque areas of 100 plaques for each virus were measured using ImageJ 1.42 software. Statistical analysis was performed using a two‐tailed unpaired t‐test (n = 100 per group). ns, not significant.

3.4. Expression and Localisation Analysis of NGPV VP2 in rNGPV VP2‐Cre‐Infected CEFs

VP2 protein expression in CEFs infected with rNGPV VP2‐Cre was firstly examined by Western blot analysis. Results showed that a specific protein band at approximately 72 kDa was detected in cells infected with rNGPV VP2‐Cre. This band was absent in cells infected with the control virus rDEV‐Cre (Figure 5). The observed molecular weight matched the predicted size of VP2.

FIGURE 5.

FIGURE 5

Open in a new tab

Western blot detection of NGPV VP2 expression in recombinant virus‐infected CEFs. CEFs infected with rNGPV VP2, rNGPV VP2‐Cre or rE1 were collected for Western blot analysis using anti‐GPV VP2 mAb as the primary antibody, with DEV US3 protein as a viral protein control. M, EasySee Western marker (90, 75, 60, 40 kDa); lane 1, rE1; lane 2, rNGPV VP2; lane 3, rNGPV VP2‐Cre.

Using GPV VP2 mAb (1:500) as the primary antibody, VP2 expression in rNGPV VP2‐Cre‐infected CEFs was examined by IEM and formation of virus‐like particles (VLPs) was examined by TEM. The IEM results showed VP2 expression, indicated by electron‐dense gold particles in Figure 6A. The TEM results revealed VLPs with circular or hexagonal morphology. These particles had diameters of approximately 20–25 nm and resembled NGPV virions (Figure 6B). IFA results showed that NGPV VP2 was distributed throughout infected cells (Figure 7). These results confirm expression of VP2 in rNGPV VP2‐Cre‐infected cells.

FIGURE 6.

FIGURE 6

Open in a new tab

Detection of VP2 expression in rNGPV VP2‐Cre‐infected CEFs by IEM (A) and observation of VLP formation by TEM (B). Thin sections of CEF monolayers infected with rNGPV VP2‐Cre were examined by IEM and TEM. Immunogold staining using GPV VP2 mAb indicates VP2 protein expression. Representative micrographs are shown. Scale bars, 200 nm.

FIGURE 7.

FIGURE 7

Open in a new tab

IFA analysis of NGPV VP2 expression and localisation in CEFs. CEFs infected with rNGPV VP2‐Cre or rE1 were fixed and analysed by IFA using anti‐GPV VP2 mAb as the primary antibody and Cy3‐labelled goat anti‐mouse IgG as the secondary antibody. Cell nuclei were stained with DAPI. Red fluorescence indicates VP2 protein localisation.

3.5. Evalution of Genetic Stablity of Recombinant Virus

The genetic stability of recombinant rNGPV VP2‐Cre was evaluated by serial viral passaging. Three detection methods were adopted for validation: PCR to verify stable integration of the VP2 gene into the DEV genome, Western blot to examine VP2 protein expression in cells infected with viruses at different passages and determination of virus growth curve. Combined PCR and Western blot data confirmed sustained VP2 insertion within the DEV genome (Figure S1a,b). In addition, viral titers showed no obvious fluctuations at passages 1, 5, 10 and 20 (Figure S1c).

3.6. Animal Experiments

In the safety test, similar to the rDEV‐Cre immunisation groups, ducks immunised with rNGPV VP2‐Cre at doses of 1 × 106 TCID50/mL or 1 × 105 TCID50/mL showed no illness or mortality during the 14‐day observation period after immunisation (Table 2).

TABLE 2.

Safety evaluation of rNGPV VP2‐Cre immunisation in ducklings.

Group Group name Viruses Dose/Volume Morbidity (%) Mortality (%)
1 Recombinant virus rNGPV VP2‐Cre 1 × 106 TCID50/1 mL 0 0
2 Parental virus rDEV‐Cre 1 × 106 TCID50/1 mL 0 0
3 Recombinant virus rNGPV VP2‐Cre 1 × 105 TCID50/1 mL 0 0
4 Parental virus rDEV‐Cre 1 × 105 TCID50/1 mL 0 0
5 Control DMEM 1 mL 0 0
Open in a new tab

In the efficacy test, immunisation and challenge schedules for the duck assay followed the schematic diagram shown in Figure 8. Eight days after primary immunisation with rNGPV VP2‐Cre, ducklings were challenged with a highly virulent NGPV strain. Clinical symptoms in 10‐day‐old ducks infected with NGPV were not obvious. Therefore, virus shedding in anal and throat swabs and viral loads in tissues were used as evaluation indicators. The qPCR results showed that immunisation with both doses of rNGPV VP2‐Cre significantly reduced virus shedding and viral loads after challenge compared with the control groups. The high‐dose immunised group showed more efficient viral clearance. At 5 d.p.c, the virus was no longer detected in anal or throat swabs from immunised ducks (Figure 9A). At 5 d.p.c and 7 d.p.c, viral loads in all examined tissues from immunised groups were lower than those in the control group (Figure 9B–D).

FIGURE 8.

FIGURE 8

Open in a new tab

Schematic diagram of the vaccine efficacy experiment in ducklings.

FIGURE 9.

FIGURE 9

Open in a new tab

Detection of virus shedding in swabs (A) and viral loads in tissues (B–D) by qPCR. Two‐day‐old ducklings were immunised with 1 × 105 TCID50 rNGPV VP2‐Cre (Group 1, labelled A), 1 × 104 TCID50 rNGPV VP2‐Cre (Group 2, labelled B) or culture medium (Group 3, labelled PBS). Group 4 remained untreated (labelled NC). Eight days after immunisation, ducklings in Groups 1–3 were challenged with the highly virulent NGPV ZJ strain. Viral DNA in anal swabs, throat swabs and tissues (heart, liver, spleen, lung, kidney and intestinal tract, including duodenum, jejunum, ileum, cecum, colon and rectum) was measured by qPCR at 1, 3, 5 and 7 d.p.c. Statistical analysis was performed using ordinary one‐way ANOVA followed by Tukey multiple comparisons test (n = 10). *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001; ns, not significant.

The tissue sections were evaluated by a veterinary pathologist. And the microscopic lesions were divided into 5‐grade severities as previously described (Ning et al. 2018): no change (0 point), very mild (1 point), mild (2 points), moderate (3 points), marked (4 points). Briefly, scoring criteria were based on the extent of mucosal epithelial degeneration, necrosis, exfoliation and the degree of inflammatory cell infiltration within the lamina propria. Histopathological evaluation of duodenal tissues harvested at 5 days post‐challenge (d.p.c.) showed that the high‐dose immunisation group (1 × 105 TCID50) developed only minimal intestinal lesions with a score of 1 (Figure 10C), indicating effective mitigation of intestinal lesions triggered by NGPV infection. In contrast, the low‐dose immunisation group (1 × 104 TCID50) exhibited limited protective efficacy, with a lesion score of 3 (Figure 10D). The untreated normal control group (0 point) (Figure 10A) and unimmunised challenged group (lesion score = 4; Figure 10B) served as reference groups for comparison.

FIGURE 10.

FIGURE 10

Open in a new tab

Histopathological analysis of the duck intestine. Duodenum samples were collected from immunised and control ducks at 5 d.p.c and examined by histopathological analysis after haematoxylin and eosin (H&E) staining. Scale bar, 100 μm. And the microscopic lesions were evaluated using a 5‐point severity scoring system. A: the untreated normal control group; B: the unimmunised challenged group; C: the high‐dose immunisation and challgenged group; D: the low‐dose immunisation and challgenged group.

Two weeks after the second immunisation with rNGPV VP2‐Cre, ducklings were challenged with a highly virulent DEV strain. During the challenge period, clinical symptoms and mortality were monitored. Results showed that ducks immunised with rNGPV VP2‐Cre were completely protected against challenge with highly virulent DEV (Figure 11).

FIGURE 11.

FIGURE 11

Open in a new tab

Protective efficacy of rNGPV VP2‐Cre against lethal DEV challenge. Four groups of 2‐day‐old ducklings were vaccinated intramuscularly with 1 × 105 TCID50 rNGPV VP2‐Cre (Group 1, labelled A), 1 × 104 TCID50 rNGPV VP2‐Cre (Group 2, labelled B) or culture medium (Group 3, labelled PBS). Group 4 remained untreated (labelled NC). Eight days after immunisation, ducklings in Groups 1–3 were challenged with the highly virulent NGPV ZJ strain. At 47 d.p.c, ducklings in Groups 1 and 2 received booster immunisation with 1 × 105 TCID50 or 1 × 104 TCID50 rNGPV VP2‐Cre, respectively. Fourteen days after the booster immunisation, all ducks in Groups 1–3 were challenged intramuscularly with 100 × DLD50 of the highly virulent DEV CHv strain. Group 4 remained untreated, and clinical signs and mortality were monitored for 14 days after challenge. Statistical analysis was performed using ordinary one‐way ANOVA followed by Dunnett multiple comparisons test (n = 10). ns, not significant.

NGPV VP2‐specific antibody levels were measured by iELISA (Figure 12A) and VN assays (Figure 12B). VP2‐specific antibodies were not detected in sera at 8 d.p.i after immunisation. However, antibody levels increased significantly at 16 d.p.c after NGPV challenge (Figure 12).

FIGURE 12.

FIGURE 12

Open in a new tab

Detection of VP2‐specific antibody titers by iELISA (A) and virus neutralisation test (B). (A) Serum samples from ducklings were collected and analysed by iELISA using recombinant VP2 protein. NC (2 days), 2‐day‐old control ducklings; PBS (8 d.p.i), ducklings injected with DMEM and sampled at 8 d.p.i; A (8 d.p.i), ducklings immunised with 1 × 105 TCID50 rNGPV VP2‐Cre and sampled at 8 d.p.i; B (8 d.p.i), ducklings immunised with 1 × 104 TCID50 rNGPV VP2‐Cre and sampled at 8 d.p.i; PBS+NGPV (16 d.p.c), DMEM‐injected ducklings challenged with highly virulent NGPV and sampled at 16 d.p.c; A+NGPV (16 d.p.c), ducklings immunised with 1 × 105 TCID50 rNGPV VP2‐Cre, then challenged with NGPV and sampled at 16 d.p.c; B+NGPV (16 d.p.c), ducklings immunised with 1 × 104 TCID50 rNGPV VP2‐Cre, then challenged with NGPV and sampled at 16 d.p.c. (B) Serum samples were analysed by the virus neutralisation (VN) test. Statistical analysis was performed using ordinary one‐way ANOVA followed by Tukey multiple comparisons test (n = 10). ns, not significant.

4. Discussion

Viral vector vaccines have been validated as powerful tools to contain viral pandemics. Adenovirus‐vectored COVID‐19 vaccines stand as a prominent success case, conferring 94% vaccine efficacy (VE) against symptomatic infection following two‐dose immunisation. This vaccine platform has played an indispensable role in curbing the global COVID‐19 pandemic (Brüssow 2023).

Currently, only a limited number of studies have investigated vaccines against NGPV. To date, only inactivated vaccines (Zhou et al. 2022) and subunit vaccines (Shang et al. 2023; Ning et al. 2018; Zhang et al. 2024; Xiao et al. 2022) have been preliminarily evaluated. Similar to the subunit vaccine based on NGPV VP2 expressed in the insect‐baculovirus system (Xiao et al. 2022) the VP2 antigen delivered by the DEV vector can also self‐assemble into VLPs. VLPs are widely recognised to have multiple advantages in vaccine development. VLPs closely resemble the structure of natural virions but lack viral genetic material, which makes them highly immunogenic while maintaining a favourable safety profile.

Compared with inactivated vaccines and subunit vaccines, which usually require two to three rounds of immunisation, viral vector vaccines provide several advantages. First, viral vector vaccines can induce both humoral and cellular immune responses. They also generate strong and relatively long‐lasting immunity without requiring additional adjuvants. Second, ducklings younger than three weeks are the most susceptible to NGPV infection. The immune responses generated by subunit and inactivated vaccines in very young ducklings may not develop rapidly enough to prevent infection. In contrast, viral vector vaccines can provide earlier immune stimulation and faster protection in this highly susceptible population. Third, viral vector vaccines may simultaneously protect against two pathogens, which reduces immunisation frequency and overall vaccination cost in commercial duck production.

In the present study, NGPV detected in anal and throat swabs of the group immunised with 1 × 105 TCID50 rNGPV VP2‐Cre became undetectable at 5 d.p.c., and viral loads in tissues were markedly reduced; notably, VP2‐specific antibodies were not detected in ducklings at 8 days after primary immunisation with rNGPV VP2‐Cre, yet the vaccinated groups exhibited rapid viral clearance upon NGPV challenge. Several explanations may account for the low VP2 antibody levels detected at 8 d.p.i. as well as this discrepancy between undetectable serum VP2 antibodies and effective viral clearance. First, the humoral immune system of 2‐day‐old ducklings is still immature and the primary immune response may be dominated by cell‐mediated immunity; Like other herpesviruses vector, DEV has been confirmed to be capable of inducing robust CD8+ T‐cell responses and secretion of cytokines such as IFN‐γ (Kumar et al. 2022; Zhao et al. 2026), which maybe be critical for clearing intracellular parvovirus infections. And the recombinant virus may still stimulate sufficient cellular immune response to confer protection against NGPV infection. Second, an 8‐day period after immunisation may be insufficient for ducklings to produce detectable high‐titre serum IgG. Third, we cannot exclude a potential contribution of mucosal immunity (e.g., secretory IgA) in the early clearance of NGPV from the digestive tract (Yang et al. 2009), although this was beyond the scope of the current study. Additional studies are therefore required to clarify the immune mechanisms responsible for protection and further evaluate the immune responses induced by this vaccine candidate; future investigations will specifically focus on evaluating the cell‐mediated immune responses elicited by rNGPV VP2‐Cre, including antigen‐specific T‐cell proliferation, cytokine profiling (e.g., IFN‐γ, IL‐4) and CTL activity against VP2, to fully elucidate its protective mechanisms.

During the design of the animal experiments, the age‐dependent susceptibility of ducklings to NGPV infection was carefully considered. Ducklings between one and three weeks of age are the most susceptible to infection, so vaccine efficacy against NGPV was evaluated eight days after primary immunisation. In addition, to observe clinical manifestations of SBDS after challenge with highly virulent NGPV, the booster immunisation was postponed until the ducks were 47 days old. This timing was selected because the duration of immunity induced by the DEV vaccine is approximately one month. Nevertheless, the optimal vaccination schedule (including how many doses? At what time schedule? Homologous or heterologous booster) requires further investigation and refinement in future studies (Brüssow 2023).

Since NGPV infection can cause intestinal barrier damage and diarrhoea in ducks (Liu et al. 2024), intestinal pathological examinations were also performed. These analyses showed that immunisation with 1 × 105 TCID50 rNGPV VP2‐Cre significantly reduced intestinal lesions caused by NGPV infection, further supporting the protective effect of this recombinant vaccine. Of course, the present evaluation of protective efficacy in this study was centred on viral clearance and acute intestinal injury within 14 days post‐challenge, without longitudinal tracking of productive performance parameters such as body weight gain, beak development and final culling rate. Given that the hallmark of SBDS is growth retardation and dwarfism, we fully recognise that long‐term monitoring is the ‘gold standard’ for verifying the vaccine's ability to reduce economic losses. Such studies are already planned in our ongoing research programme, with the aim of determining whether a single immunisation can effectively protect commercial meat‐type ducks until market age.

Furthermore, the GPV VP2 monoclonal antibody showed cross‐reactivity with NGPV VP2, which is likely due to the high sequence homology between these proteins. Based on this cross‐reactivity, it is reasonable to speculate that rNGPV VP2‐Cre may also provide protective effects against both DEV and GPV infections and possibly against Muscovy duck parvovirus (MDPV). This possibility is supported by the findings of Gan et al. (2024). Their study reported that the SBDS subunit vaccine (rBac‐JS01 VP2 strain), a recombinant baculovirus expressing SBDSV VP2 protein, provided effective and durable cross‐protection against GPV and partial cross‐protection against MDPV, although the protective efficacy against MDPV was somewhat lower than that observed against GPV (Gan et al. 2024). Of course, further independent GPV and MDPV challenge experiments are needed before confirmed this view.

Our study demonstrated that the rNGPV VP2‐Cre with 104 TCID50 dose conferred limited intestinal protection, whereas the 105 TCID50 dose was clearly effective, defines a critical floor for the minimum effective dose (MED) under experimental conditions. Given the potential for dosing inconsistencies in the field, a substantial safety margin must be incorporated into the commercial vaccination protocol. We recommend a minimum field dose of no < 2 × 105 TCID50 per bird. This also highlights the importance of developing thermostable lyophilised formulations to maintain vaccine potency and companion on‐site quality control tools (e.g., rapid test cards) to ensure adequate vaccine delivery to each duckling. Another problem that may arise in clinical application is that commercial duck flocks frequently carry maternally derived antibodies (MDA) against DEV and/or parvoviruses. The presence of MDA represents a potential confounding factor for live vectored vaccines, as they may neutralise the vaccine virus during initial replication or interfere with antigen presentation. This is an urgent subject for investigation. Future studies will employ commercial ducklings with defined MDA titers to evaluate whether vaccine efficacy is significantly compromised, and to explore strategies such as increasing the immunisation dose or employing mucosal routes of delivery to circumvent MDA interference.

5. Conclusion

In conclusion, this study successfully constructed a recombinant duck enteritis virus (DEV) designated rNGPV VP2‐Cre, which harbours the novel goose parvovirus (NGPV) VP2 gene. The expressed VP2 protein was capable of self‐assembling into virus‐like particles. Additionally, the recombinant virus rNGPV VP2‐Cre demonstrated favourable safety profiles in ducklings, facilitated efficient clearance of NGPV and conferred complete protection against challenge with a highly virulent DEV strain. Collectively, these findings indicate that rNGPV VP2‐Cre serves as a promising bivalent vaccine candidate for the concurrent prevention and control of both DEV and NGPV infections in waterfowl.

Author Contributions

Weicheng Ye: formal analysis. Suxin Huo: investigation, validation. Xinjin Li: investigation, validation, formal analysis. Zongxiao Wang: investigation, validation. Liu Chen: methodology, data curation, writing – original draft, writing – review and editing, funding acquisition. Jionggang Hua: formal analysis. Liang He: formal analysis. Yuan Fu: investigation, validation. Cun Zhang: conceptualization, supervision. Zhuanli Wu: investigation, validation, formal analysis. Yinchu Zhu: software. Tao Yun: methodology, data curation, writing – review and editing.

Funding

This work was supported by the National Natural Science Foundation of China (Grant 32473008) and the Zhejiang Provincial Natural Science Foundation of China (Grant LGN22C010005).

Ethics Statement

These experiments were approved by the relevant committees of Zhejiang Academy of Agricultural Sciences (ZAAS).

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Figure S1: (a–c) Evaluation of genetic stability of the recombinant virus rNGPV VP2‐Cre originating from 1st, 5th, 10th and 20th passages by PCR amplification (a), Western blot analysis (b) and virus growth curves analysis (c). (a) Identification of VP2 gene insertion in DEV genome by PCR amplification. (b) Detection of VP2 expression in rNGPV VP2‐Cre of different passage (1st, 5th, 10th and 20th) infected CEFs by Western blot analysis. (c) Multi‐step growth curve. Comparison of the in vitro growth of rNGPV VP2‐Cre originating from different passage (1st, 5th, 10th and 20th), and the parent rE1 as reference. The virus titers were determined at different times (0, 2, 12, 24, 36, 48, 60 and 72 h) after inoculation of approximately 0.02 MOI of cell‐free viruses of rE1, 1st rNGPV VP2‐Cre, 5th rNGPV VP2‐Cre, 10th rNGPV VP2‐Cre and 20th rNGPV VP2‐Cre. The multi‐step growth curves were computed from three independent experiments.

MBT2-19-e70433-s001.docx (1.1MB, docx)

Acknowledgements

We thank Xijiao Song from the Central Laboratory of Zhejiang Academy of Agricultural Sciences for technical support. The authors also thank the reviewers who provided valuable comments during the review process. This study was supported by the National Natural Science Foundation of China (32473008) and the Zhejiang Provincial Natural Science Foundation of China (LGN22C010005). The funding agencies had no role in study design, data collection, data analysis, interpretation of results or manuscript preparation.

Contributor Information

Liu Chen, Email: haoliuzi@126.com.

Tao Yun, Email: yt-t@163.com.

Data Availability Statement

All data generated or analysed during this study are included in this published article and its Supporting Information files.

References

  1. Bian, G. Z. 2019. Studies on the Biological Characteristics and Beak Teratogenic Mechanism of Novel Goose Parvovirus [in Chinese.] (Doctoral diss.). South China Agricultural University. [Google Scholar]
  2. Brüssow, H. 2023. “Do We Need Nasal Vaccines Against COVID 19 to Suppress the Transmission of Infections?” Microbial Biotechnology 16, no. 1: 3–14. 10.1111/1751-7915.14181. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Chen, H. , Dou Y., Tang Y., et al. 2015. “Isolation and Genomic Characterization of a Duck‐Origin GPV‐Related Parvovirus From Cherry Valley Ducklings in China.” PLoS One 10: e0140284. 10.1371/journal.pone.0140284. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Chen, H. , Dou Y., Tang Y., et al. 2016. “Experimental Reproduction of Beak Atrophy and Dwarfism Syndrome by Infection in Cherry Valley Ducklings With a Novel Goose Parvovirus‐Related Parvovirus.” Veterinary Microbiology 183: 16–20. 10.1016/j.vetmic.2015.11.034. [DOI] [PubMed] [Google Scholar]
  5. Chen, L. , Ni Z., Hua J., et al. 2021. “Simultaneous Tracking of Capsid VP26, Envelope Protein gC Localization in Living Cells Infected With Double Fluorescent Duck Enteritis Virus.” Virus Research 297: 198393. 10.1016/j.virusres.2021.198393. [DOI] [PubMed] [Google Scholar]
  6. Chen, L. , Ni Z., Hua J. G., et al. 2022. “Preparation and Identification of Monoclonal Antibody Against Goose Parvovirus VP2 Protein.” [In Chinese.] Animal Husbandry & Veterinary Medicine 54: 85–89. [Google Scholar]
  7. Chen, L. , Yu B., Hua J., et al. 2013. “Construction of a Full‐Length Infectious Bacterial Artificial Chromosome Clone of Duck Enteritis Virus Vaccine Strain.” Virology Journal 10: 328. 10.1186/1743-422X-10-328. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Chen, L. , Yu B., Ni Z., et al. 2015. “Construction and Characterization of a Recombinant Duck Enteritis Virus Expressing E Protein of Duck Tembusu Virus.” [In Chinese.] Acta Agriculturae Zhejiangensis 27: 1889–1895. [Google Scholar]
  9. Chi, L. , and Lin H.. 2024. “Effects of Xuzhou Strain of a Novel Goose Parvovirus (NGPV XZ‐01 Strain) on the Growth and Development of Mule Ducks.” [In Chinese.] Heilongjiang Animal Science and Veterinary Medicine 64: 126–128. [Google Scholar]
  10. Eid, A. A. M. , Lebdah M. A., Helal S. S., et al. 2024. “Short Beak and Dwarfism Syndrome Among Pekin Ducks: First Detection, Full Genome Sequencing, and Immunohistochemical Signals of Novel Goose Parvovirus in Tongue Tissue.” Veterinary Pathology 61: 829–838. 10.1177/03009858241249108. [DOI] [PubMed] [Google Scholar]
  11. Gan, H. Q. , Wu S., Fu Q. Y., et al. 2024. “Cross Protection Analysis of Duck Short Beak and Dwarfism Syndrome Subunit Vaccine Against Goose Parvovirus and Muscovy Duck Parvovirus.” [In Chinese.] Chinese Journal of Veterinary Medicine 60: 75–83. 10.20157/j.cnki.zgsyzz.2024.09.010. [DOI] [Google Scholar]
  12. Huang, H. L. 2022. Identification of a Novel Goose Parvovirus Guangdong Isolate and Its Structural Protein VP3 Gene Expression [In Chinese.] (Master's thesis). Foshan University. [Google Scholar]
  13. Huong, N. T. , Hieu D. V., Bich N. T., et al. 2024. “Isolation and Genetic Characterization of Waterfowl Parvovirus in Ducks in Northern Vietnam.” Veterinary World 17: 981–987. 10.14202/vetworld.2024.981-987. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Jiao, F. C. , Zhang X., Li Y. X., et al. 2023. “Whole Genome Amplification and Phylogenetic Analysis of Novel Goose Parvovirus Xinyang Strain.” [In Chinese.] Animal Husbandry & Veterinary Medicine 55: 112–119. [Google Scholar]
  15. Kumar, J. , Dandapat S., Panickan S., et al. 2022. “Expression Profiles of Toll Like Receptors, MHC and Cytokine Genes Along With Viral Load in Organs of Ducklings Infected With an Indian Isolate of Duck Enteritis Virus.” Microbial Pathogenesis 165: 105502. 10.1016/j.micpath.2022.105502. [DOI] [PubMed] [Google Scholar]
  16. Li, Q. 2017. Identification of Novel Duck Parvovirus DS15 Strain and Expression of VP2 Protein in Insect Cells [In Chinese.] (Master's thesis). Gansu Agricultural University. [Google Scholar]
  17. Liu, J. , Chen P., Jiang Y., et al. 2011. “A Duck Enteritis Virus‐Vectored Bivalent Live Vaccine Provides Fast and Complete Protection Against H5N1 Avian Influenza Virus Infection in Ducks.” Journal of Virology 85: 10989–10998. 10.1128/JVI.05420-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Liu, M. , Li L., Zhang W., et al. 2024. “Bone Lesions and Intestinal Barrier Disruption Caused by the Isolated Novel Goose Parvovirus Infection in Ducks.” Microbial Pathogenesis 194: 106825. 10.1016/j.micpath.2024.106825. [DOI] [PubMed] [Google Scholar]
  19. Matczuk, A. K. , Chmielewska‐Władyka M., Siedlecka M., Bednarek K. J., and Wieliczko A.. 2020. “Short Beak and Dwarfism Syndrome in Ducks in Poland Caused by Novel Goose Parvovirus.” Animals 10: 2397. 10.3390/ani10122397. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Ning, K. , Liang T., Wang M., Dong Y., Qu S., and Zhang D.. 2018. “Pathogenicity of a Variant Goose Parvovirus, From Short Beak and Dwarfismsyndrome of Pekin Ducks, in Goose Embryos and Goslings.” Avian Pathology 4, no. 47: 391–399. 10.1080/03079457.2018.1459040. [DOI] [PubMed] [Google Scholar]
  21. Palya, V. , Zolnai A., Benyeda Z., Kovács E., Kardi V., and Mató T.. 2009. “Short Beak and Dwarfism Syndrome of Mule Duck Is Caused by a Distinct Lineage of Goose Parvovirus.” Avian Pathology 38: 175–180. 10.1080/03079450902737839. [DOI] [PubMed] [Google Scholar]
  22. Qiao, D. D. , Liu T. J., Chen Q. G., et al. 2024. “Whole Genome Amplification and Genetic Evolution Analysis of Novel Goose Parvovirus Isolated From Shandong and Guangxi.” [In Chinese.] China Poultry 46: 44–55. 10.16372/j.issn.1004-6364.2024.06.007. [DOI] [Google Scholar]
  23. Shang, Y. , Ma Y., Tang S., et al. 2023. “Virus‐Like Particles Based on the Novel Goose Parvovirus (NGPV) VP2 Protein Protect Ducks Against NGPV Challenge.” Vaccine 11: 1768. 10.3390/vaccines11121768. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Soliman, M. A. , Erfan A. M., Samy M., Mahana O., and Nasef S. A.. 2020. “Detection of Novel Goose Parvovirus Disease Associated With Short Beak and Dwarfism Syndrome in Commercial Ducks.” Animals 10: 1833. 10.3390/ani10101833. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Tischer, B. K. , Smith G. A., and Osterrieder N.. 2010. “En Passant Mutagenesis: A Two Step Markerless Red Recombination System.” In In Vitro Mutagenesis Protocols, edited by Braman J., 421–430. Humana. [DOI] [PubMed] [Google Scholar]
  26. Tischer, B. K. , von Einem J., Kaufer B., and Osterrieder N.. 2006. “Two‐Step Red‐Mediated Recombination for Versatile High‐Efficiency Markerless DNA Manipulation in Escherichia coli .” BioTechniques 40: 191–197. 10.2144/000112096. [DOI] [PubMed] [Google Scholar]
  27. Wang, S. , Cheng X., Chen S., et al. 2016. “Identification of a Novel Goose Parvovirus (GPV) Recombinant Associated With Short Beak and Dwarfism Syndrome in Mainland China, 2015.” Infection, Genetics and Evolution 41: 289–291. 10.1016/j.meegid.2016.04.013. [DOI] [PubMed] [Google Scholar]
  28. Wang, Y. , Sun J., Zhang D., Guo X., Shen W., and Li Y.. 2021. “Genetic Characterization and Phylogenetic Analysis of Duck‐Derived Waterfowl Parvovirus in Anhui Province, Eastern China.” Archives of Virology 166: 2011–2016. 10.1007/s00705-021-05110-1. [DOI] [PubMed] [Google Scholar]
  29. Wei, L. , Xiong R. Y., Wang S. Y., Liang H., Long D. M., and Yang G. L.. 2024. “Isolation and Identification of a Duck‐Derived Novel Goose Parvovirus and Prokaryotic Expression of VP2 Protein.” [In Chinese.] Heilongjiang Animal Science and Veterinary Medicine 12: 59–63. 10.13881/j.cnki.hljxmsy.2023.10.0222. [DOI] [Google Scholar]
  30. Xiao, S. , Wang S., Jiang D., et al. 2022. “VP2 Virus‐Like Particles Elicit Protective Immunity Against Duckling Short Beak and Dwarfism Syndrome in Ducks.” Transboundary and Emerging Diseases 69: 570–578. 10.1111/tbed.14021. [DOI] [PubMed] [Google Scholar]
  31. Yang, C. , Li J., Li Q., et al. 2013. “Complete Genome Sequence of an Attenuated Duck Enteritis Virus Obtained by In Vitro Serial Passage.” Genome Announcements 1: e00685‐13. 10.1128/genomeA.00685-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Yang, X. , Cheng A., Wang M., et al. 2009. “Intestinal Mucosal Immune Response Against Virulent Duck Enteritis Virus Infection in Ducklings.” Research in Veterinary Science 87, no. 2: 218–225. 10.1016/j.rvsc.2009.02.009. [DOI] [PubMed] [Google Scholar]
  33. Yu, K. , Ma X., Sheng Z., et al. 2016. “Identification of Goose‐Origin Parvovirus as a Cause of Newly Emerging Beak Atrophy and Dwarfism Syndrome in Ducklings.” Journal of Clinical Microbiology 54: 1999–2007. 10.1128/JCM.03244-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Zhang, Q. , Sun Y., Sun Y., Zhang H., and Yang R.. 2024. “Expression of VP2 Protein of Novel Goose Parvovirus in Baculovirus and Evaluation of Its Immune Effect.” Microbial Pathogenesis 195: 106751. 10.1016/j.micpath.2024.106751. [DOI] [PubMed] [Google Scholar]
  35. Zhao, G. W. , Huang T., Wu D., et al. 2019. “Diagnosis and Characterization of Duck Beak Atrophy and Dwarfism Syndrome in Chongqing of China.” Veterinary Research Forum 10: 169–172. 10.30466/vrf.2019.98874.2359. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Zhao, Y. , Ma Q., Jiao C., et al. 2026. “Recombinant Duck Enteritis Virus Harboring the Hemagglutinin Genes of Influenza Virus Rapidly Induces Specific Cellular Immunity in Ducks.” Journal of Virology 100, no. 2: e0201425. 10.1128/jvi.02014-25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Zhou, J. , Li C., Tang A., et al. 2022. “Immunogenicity of an Inactivated Novel Goose Parvovirus Vaccine for Short Beak and Dwarfism Syndrome in Cherry Valley Ducks.” Archives of Virology 167: 881–889. 10.1007/s00705-021-05352-z. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1: (a–c) Evaluation of genetic stability of the recombinant virus rNGPV VP2‐Cre originating from 1st, 5th, 10th and 20th passages by PCR amplification (a), Western blot analysis (b) and virus growth curves analysis (c). (a) Identification of VP2 gene insertion in DEV genome by PCR amplification. (b) Detection of VP2 expression in rNGPV VP2‐Cre of different passage (1st, 5th, 10th and 20th) infected CEFs by Western blot analysis. (c) Multi‐step growth curve. Comparison of the in vitro growth of rNGPV VP2‐Cre originating from different passage (1st, 5th, 10th and 20th), and the parent rE1 as reference. The virus titers were determined at different times (0, 2, 12, 24, 36, 48, 60 and 72 h) after inoculation of approximately 0.02 MOI of cell‐free viruses of rE1, 1st rNGPV VP2‐Cre, 5th rNGPV VP2‐Cre, 10th rNGPV VP2‐Cre and 20th rNGPV VP2‐Cre. The multi‐step growth curves were computed from three independent experiments.

MBT2-19-e70433-s001.docx (1.1MB, docx)

Data Availability Statement

All data generated or analysed during this study are included in this published article and its Supporting Information files.

Articles from Microbial Biotechnology are provided here courtesy of Wiley

RESOURCES