Microencapsulation of a novel Bacteroides thetaiotaomicron strain: a promising strategy to fortify intestinal barrier fortification in a weaned pig model

ABSTRACT

Porcine Bacteroides thetaiotaomicron LYH5 demonstrated in vitro antimicrobial activity, suggesting probiotic potential. Due to poor gastric juice tolerance, LYH5 was encapsulated via extrusion using sodium alginate (SA) and gellan gum. Box-Behnken design optimization yielded optimal parameters: SA 1.5%, gellan gum 0.4%, CaCl₂ 0.9%, bacteria:glue ratio 1:4, achieving an encapsulation rate of 84.22 ± 0.17%. Its effect on weaned piglet intestinal health was evaluated using 78 piglets (7.69 ± 0.52 kg) randomly assigned to four groups for 40 days: CON (control), T (basal diet + LYH5 live bacteria, 1 × 10¹⁰ CFU/mL), TJ (basal diet + LYH5 microcapsules, 1 × 10¹⁰ CFU/mL), J (basal diet + empty capsules). The results of this experiment showed that, compared with the control group, LYH5 microcapsules can improve the intestinal barrier function without affecting the growth performance of piglets, and provide ideas and references for a promising candidate for probiotic development.

IMPORTANCE

This study addresses the key bottleneck of poor gastric acid tolerance of probiotics via microencapsulation and provides a practical reference for a promising candidate for probiotic development.

INTRODUCTION

Bacteroides spp. represent the most abundant gram-negative bacteria in the human intestinal tract, with concentrations reaching 10⁹–10¹¹ CFU/g of feces (1). Notably, this genus is a core component of the monogastric animal gut microbiota, particularly enriched in the colonic mucus layer (2). In piglets, Bacteroides dominate the fecal microbiome before and after weaning, comprising over 90% of the bacterial community (3). According to our previous research, reduced abundance of Bacteroides has been observed in diarrheic weaned piglets, suggesting its potential as a microbial marker for diarrhea and its association with impaired carbohydrate/polysaccharide metabolism (4).

Among the Bacteroides species, Bacteroides thetaiotaomicron is particularly noteworthy. Bacteroides thetaiotaomicron is a strictly anaerobic bacterium (5). This species constitutes 6% of total fecal bacteria in healthy adults and 12% of the Bacteroides community (6). It has been widely used in genetic modification research and serves as a model organism for studying human health and diseases (7). Like other Bacteroides, B. thetaiotaomicron metabolizes polysaccharides to produce short-chain fatty acids (SCFAs), which are absorbed by the host (8). As a paradigm of polysaccharide utilization, it can exploit both dietary and host-derived polysaccharides, a trait that has enabled its partial application in pharmaceutical and food industries (9). Its genome-encoded proteins and secreted enzymes facilitate sugar capture in the colon, providing substrates for membrane-bound glycoside hydrolases to effectively utilize carbohydrates (10). Recent studies have shown that B. thetaiotaomicron DSM 2079 promotes the growth of butyric acid-producing bacteria via lactose metabolism (11), underscoring its role in juvenile intestinal health. While its effect on intestinal inflammation, particularly colitis, has been explored in preclinical models, such as reducing colonic lesions in interleukin 10 (IL-10) knockout mice (12), mechanistic studies remain limited.

Beyond the bacteria themselves, B. thetaiotaomicron metabolites play a critical role in host gut health. For instance, acetic acid produced by B. thetaiotaomicron VPI-5482 indirectly supports the growth of Faecalibacterium prausnitzii by serving as a substrate, highlighting inter-bacterial ecological balance and its importance for colonic epithelial homeostasis (13). Additionally, B. thetaiotaomicron-derived indoleacetic acid and indole propionic acid, agonists of the aryl hydrocarbon receptor (AHR), alleviate colonic inflammation by activating AHR and regulating CD4⁺ T cell differentiation (14). In LPS-challenged mice, its metabolic oleic acid reduces the expression of pro-inflammatory markers such as COX-2, tumor necrosis factor-α (TNF-α), IL-6, and IL-12 in macrophages (15).

Most NGPs are highly sensitive to oxygen, gastric acid, and bile salts, limiting their therapeutic application (16). Microencapsulation technology offers a solution, though its use in NGPs remains in its infancy. Furthermore, the functions of most probiotics exhibit significant strain-specificity (17) and host-specificity (18, 19), while research on NGPs suitable for weaned piglets remains extremely limited.

Given this, our study first isolated a potential probiotic Bacteroides strain from fresh feces of healthy weaned piglets. We then enhanced its tolerance to gastric juice and intestinal digestive fluids via microencapsulation technology and preliminarily evaluated its promoting effect on intestinal health in weaned piglets. Our work may provide novel insights into microbiota screening for human intestinal health research.

MATERIALS AND METHODS

Bacterial strains

B. thetaiotaomicron strain used in this study was isolated from fresh feces of healthy weaned piglets and deposited in the China Center for Type Culture Collection (CCTCC) under the accession number CCTCC no. M2021752 (http://www.cctcc.org/). Enterotoxigenic Escherichia coli ATCC 25922, Salmonella choleraesuis ATCC 527, and Staphylococcus aureus ATCC 25923 were maintained in our laboratory culture collection.

Identification of porcine B. thetaiotaomicron strain

Genomic DNA of B. thetaiotaomicron LYH5 was extracted using the protocol previously established by our research group (20). The bacterial 16S rDNA was amplified by PCR using universal primers 27F (5′-AGAGTTTGATCMTGGCTCAG-3′) and 1492R (5′-TACGGYTACCTTGTTACGACTT-3′) (21). The PCR program consisted of initial denaturation at 94°C for 5 min, 30 cycles of denaturation at 94°C for 30 s, annealing at 50°C for 30 s, extension at 72°C for 30 s, and a final extension at 72°C for 5 min. The amplified product was subjected to Sanger sequencing by Shanghai Majorbio Bio-pharm Technology Co., Ltd., and the obtained gene sequence was aligned with 16S rRNA sequences in NCBI GenBank (https://blast.ncbi.nlm.nih.gov/) to identify the most similar strain. Comparative sequences were selected primarily based on officially recorded taxonomic names and corresponding entries in the NCBI GenBank database. Priority was given to sequences designated as type strains to ensure taxonomic accuracy and reproducibility of the phylogenetic analysis. In addition, species names, strain identifiers, and source data from GenBank were considered to select strains that adequately represent the geographic, ecological, or phenotypic diversity of the target groups, whereas entries with ambiguous nomenclature or low sequence quality were excluded. For species with multiple candidates, representative sequences were chosen based on strain codes or isolation descriptions to avoid redundancy. Phylogenetic trees were constructed using the neighbor-joining method in MEGA12.

Genomic DNA of strain LYH5 was extracted and subjected to whole-genome sequencing on the Illumina NovaSeq platform. Quality-filtered reads were assembled de novo using SPAdes. Comprehensive bioinformatics analyses were performed using the Majorbio Cloud platform.

For morphological characterization, the isolated strain was streaked onto modified solid Gifu Anaerobic Medium (GAM) and anaerobically cultured at 37°C for 48 h, followed by scanning electron microscopy analysis performed by Chengdu Lilai Biotechnology Co., Ltd. Physiological and biochemical properties were evaluated via Gram staining, catalase test, gelatin liquefaction test, and motility test. Hemolytic activity was assessed by streaking the strain on sheep blood agar plates and observing hemolysis after 48 h of anaerobic incubation. Antibiotic resistance was determined using Oxoid antibiotic discs. The following 16 antibiotics were tested: amoxicillin, enrofloxacin, sulfadiazine, streptomycin, rifampin, polymyxin B, tetracycline, clindamycin, ampicillin, linezolid, cefepime, imipenem, clarithromycin, vancomycin, penicillin G, and gentamicin. Inhibition zones were measured after 48 h of anaerobic culture at 37°C. Resistance was interpreted according to European Food Safety Authority guidelines (22).

In vitro antimicrobial assays

Antimicrobial activity of the isolated strain was evaluated using the agar diffusion Oxford cup assay and metabolite co-culture assay. For the Oxford cup assay, the culture supernatants of the strain were prepared, and test pathogens (E. coli ATCC 25922, S. choleraesuis ATCC 527, and S. aureus ATCC 25923) were adjusted to 10⁻⁶–10⁻⁷ CFU/mL in Luria-Bertani (LB) broth, then mixed with molten LB agar (45°C) and poured into Petri dishes. After solidification, Oxford cups were placed on the agar surface, and 15 μL of the isolated strain fermentation broth was added to each cup. Plates were incubated at 37°C for 48 h under anaerobic conditions, and inhibition zone diameters were measured. For the metabolite co-culture assay, the fermentation broth of the strain was centrifuged at 12,000 × g for 10 min at 4°C, and the supernatant was extracted with ethyl acetate (1:1, vol/vol). The organic phase was collected, dried under nitrogen, resuspended in LB medium, and filtered through a 0.22 μm membrane. For the co-culture assay, 5 mL of purified metabolite was added to 95 mL of LB broth, which was subsequently inoculated with 1 mL of the revived bacterial culture. The control group consisted of 100 mL of LB broth inoculated with 1 mL of the same bacterial culture. All cultures were incubated aerobically at 37°C for 48 h; the OD₆₀₀ was measured every 2 h using a microplate reader after gentle mixing to compare bacterial growth in the presence and absence of the metabolite. Each group was tested in triplicate.

The antimicrobial activity of the LYH5 metabolites against the three pathogenic strains was evaluated using the broth microdilution method. The bacterial metabolites were freeze-dried at a concentration of 10¹⁰ CFU/mL of live bacteria and then serially twofold diluted with sterile Mueller-Hinton broth to obtain concentrations ranging from 1,280 to 2.5 mg/mL. Each dilution (100 μL) was mixed with an equal volume of the target bacterial suspension (approximately 1 × 10⁶ CFU/mL) in a 96-well microtiter plate. Growth controls (bacterial suspension without supernatant) and sterility controls (broth only) were included on each plate. After incubation at 37°C for 24 h, the optical density (OD₆₀₀) was measured using a microplate reader. The inhibition percentage was calculated as [1 − (net OD₆₀₀ of the treated well / net OD₆₀₀ of the growth control)] × 100%. The MIC was defined as the lowest concentration yielding a net OD₆₀₀ ≤ 0.05, and the MIC₉₀ was defined as the lowest concentration achieving ≥90% inhibition.

SCFAs, including acetic acid, propionic acid, butyric acid, valeric acid, and total SCFAs, in culture of the strain were quantified by gas chromatography (GC, Varian CP-3800, flame ionization detector) using a 10 μL manual injector, following our previously established method (20).

Outer membrane vesicles (OMVs) of the isolated strain were isolated by ultracentrifugation. Following 72 h anaerobic culture in modified GAM medium, the bacterial suspension was centrifuged at 150,000 × g for 30 min to remove cells, and the supernatant was filtered through a 0.22 μm membrane. The filtrate was centrifuged again, and the pellet was washed twice with phosphate-buffered saline (PBS), resuspended in PBS, aliquoted, and stored at −80°C. OMVs were visualized by scanning electron microscopy after negative staining with 2% uranyl acetate.

Tolerance test of isolated strain

To prepare simulated gastric fluid (SGF), 0.2% NaCl solution was prepared with sterilized deionized water, adjusted to pH 2.0 using 1 M HCl, and supplemented with 0.32% pepsin (wt/vol). To prepare simulated intestinal fluid (SIF), 6.8 g/L KH₂PO₄ solution was prepared, adjusted to pH 7.4 with NaOH, and supplemented with 10 mg/mL trypsin. Both fluids were stored at 4°C, filter-sterilized through 0.22 μm nylon membrane filters prior to use, and preheated to 37°C before experimentation.

Log-phase culture (1 mL) of the strain was inoculated into sterile anaerobic tubes containing 9 mL of preheated SGF or SIF. The mixtures were incubated at 37°C with shaking (220 rpm), and samples were collected at 0, 10, 20, 30, and 60 min. Bacterial viability was determined by serial dilution plating on modified GAM agar, with triplicate experiments for each time point.

Preparation of microcapsules

Sodium alginate (SA, Qingdao Mingyue Seaweed Group, China), gellan gum (Xinjiang Fufeng Biotechnology, China), and anhydrous calcium chloride (Chengdu Cologne Chemical Co., Ltd., China) were used. All materials were autoclaved at 121°C for 20 min. Cells of the isolated strain in the late logarithmic phase were harvested by centrifugation at 5,000 × g for 10 min at 4°C, washed twice with PBS by re-centrifugation, and resuspended in sterile saline to a concentration of 1 × 10¹⁰ CFU/mL.

Single-factor experiments were first conducted to determine the optimal ranges of SA, gellan gum, calcium chloride, and bacterial-to-gel ratio. The Box-Behnken design within the Design-Expert 10 software was employed for response surface methodology to optimize the microencapsulation conditions. A quadratic regression model was fitted to the experimental data, yielding the following equation:

$${\displaystyle {\displaystyle \begin{array}{rl}\text{Encapsulation efficiency}=& 82.9+0.91A-2.62B+5.26C-0.061D+1.04AB\\ & -15AC+0.17AD-1.25BC-0.36BD-0.26CD\\ & -8.48A^2-5.41B^2-3.54C^2-3.75D^2\end{array}}}$$ (1)

The experimental factor levels (Table 1) comprised 29 test points with five central repeats for error estimation.

TABLE 1.

Response factors and levels^a

Factor	Item	Level
		-1	0	1
A	SA	1%	1.5%	2%
B	Gellan gum	0.3%	0.4%	0.5%
C	CaCl2	0.7%	0.8%	0.9%
D	Bacteria-gum ratio	1:2	1:4	1:6

^a SA, sodium alginate.

Encapsulation efficiency was determined under aseptic and anaerobic conditions. Briefly, 1 g of freshly prepared wet microcapsules was weighed and suspended in 9 mL of sterile PBS (pH 7.0). The mixture was vortexed for 2 min to rupture the microcapsule wall and release the encapsulated bacteria. The homogenized suspension was then serially diluted 10-fold in sterile normal saline, and 100 μL aliquots from each dilution were spread-plated onto modified GAM agar. Plates were incubated anaerobically at 37°C for 48 h before colony enumeration. The encapsulation efficiency (A, %) was calculated as A = (a / b) × 100, where a represents the viable cell count (CFU) recovered from the microcapsule suspension, and b represents the viable count in the initial bacterial suspension prior to encapsulation. All determinations were performed in triplicate.

Wet microcapsules prepared under optimal conditions were lyophilized for 48 h, mounted on conductive tape, and observed by scanning electron microscopy (Quanta 450, FEI).

Viability of free and encapsulated strain in SGF

One gram of wet microcapsules was weighed and added to 9 mL of SGF, followed by incubation at 37°C with shaking (220 rpm) for 30, 60, 90, and 120 min. As a control, 1 mL of free (unencapsulated) bacterial suspension was added to 9 mL of SGF, and samples were collected at the same time points under identical conditions. All experiments were performed in triplicate.

In vitro simulated release assay

One gram of wet microcapsules was weighed and transferred to 9 mL of SIF, then incubated at 37°C with shaking (220 rpm). Samples were collected at 1, 2, 3, and 4 h. For the control group, 1 mL of free bacterial suspension was added to 9 mL of SIF, and sampling followed the same protocol. Each treatment was repeated three times.

Animal and experimental procedure

A total of 78 healthy 24-day-old piglets with similar body weights were selected and subjected to a 3 day pre-feeding period. One piglet died of illness during pre-feeding. To account for the potential stress or adverse effects associated with oral gavage in the treatment groups, we proactively allocated 20 piglets to each treatment group to ensure adequate final sample size, while the control group was assigned 17 piglets. The final group allocation for the formal trial was as follows: control group (CON, n = 17), T group (basal diet + unencapsulated strain at 1 × 10¹⁰ CFU/mL, n = 20), TJ group (basal diet + microcapsules of the strain at 1 × 10¹⁰ CFU/g, n = 20), and J group (basal diet + empty capsules, n = 20). The J group was included to exclude any potential effects of the capsule material itself on the measured parameters. The T group received a suspension of the strain (saline-based) every other day, while TJ and J groups were supplemented with 1 g of microcapsules or empty capsules, respectively. All groups maintained identical viable strain counts, with supplements administered after feeding. Piglets were fed a corn-soybean meal basal diet free of antibiotics and growth-promoting zinc, meeting the National Research Council (23) nutrient requirements (Table S1). Piglets were fed three times daily (at 8:00 a.m., 2:00 p.m., and 8:00 p.m.) with ad libitum access to water. The experiment adhered to animal welfare guidelines, with controlled environmental conditions (24°C–26°C, 55%–65% humidity). The experiment lasted 40 days.

Individual body weights were recorded at the start and end of the trial, with daily feed intake documented to calculate average daily feed intake (ADFI), average daily gain (ADG), and feed-to-gain ratio (F:G). Diarrhea was scored three times daily (at 8:00, 12:00, and 16:00) using a 0–3 scale, where 0 = formed feces, 1 = soft feces, 2 = sticky/liquid feces, and 3 = watery feces. The diarrhea index was calculated as follows:

$${\displaystyle {\displaystyle \mathrm{D}\mathrm{i}\mathrm{a}\mathrm{r}\mathrm{r}\mathrm{h}\mathrm{e}\mathrm{a}\mathrm{i}\mathrm{n}\mathrm{d}\mathrm{e}\mathrm{x}=\frac{\mathrm{s}\mathrm{u}\mathrm{m}\mathrm{o}\mathrm{f}\mathrm{d}\mathrm{i}\mathrm{a}\mathrm{r}\mathrm{r}\mathrm{h}\mathrm{e}\mathrm{a}\mathrm{s}\mathrm{c}\mathrm{o}\mathrm{r}\mathrm{e}\mathrm{s}}{\mathrm{n}\mathrm{u}\mathrm{m}\mathrm{b}\mathrm{e}\mathrm{r}\mathrm{o}\mathrm{f}\mathrm{p}\mathrm{i}\mathrm{g}\mathrm{l}\mathrm{e}\mathrm{t}\mathrm{s}\times \mathrm{e}\mathrm{x}\mathrm{p}\mathrm{e}\mathrm{r}\mathrm{i}\mathrm{m}\mathrm{e}\mathrm{n}\mathrm{t}\mathrm{a}\mathrm{l}\mathrm{d}\mathrm{a}\mathrm{y}\mathrm{s}\times \mathrm{d}\mathrm{a}\mathrm{i}\mathrm{l}\mathrm{y}\mathrm{a}\mathrm{s}\mathrm{s}\mathrm{e}\mathrm{s}\mathrm{s}\mathrm{m}\mathrm{e}\mathrm{n}\mathrm{t}\mathrm{s}}}}$$ (2)

Rectal fecal samples were collected on days 36–39, fixed with 10% sulfuric acid, preserved with toluene, and stored at −20°C. The apparent nutrient digestibility was determined using a classical analytical method (24). On day 40, piglets were fasted overnight. Five pigs per group were randomly selected, anesthetized with sodium pentobarbital (200 mg/kg), and euthanized. Intestinal segments were isolated: mid-jejunum fixed in 4% paraformaldehyde for histomorphology, and proximal colon placed in Carnoy’s fixative for mucus/goblet cell analysis. Jejunal and colonic mucosal scrapings were collected, snap-frozen in liquid nitrogen, and stored at −80°C for gene expression analysis. Colonic digesta were collected, flash-frozen in liquid nitrogen, and stored at −80°C for microbial enumeration and SCFA analysis.

Determination of blood biochemical indices

Serum concentrations of cytokines, including IL-10 and TNF-α, and immunoglobulins (IgA and IgG) were measured using porcine-specific ELISA kits (Porcine ELISA KIT, Quanzhou Ruixin Bio-technology Co., Ltd.). These assays were performed according to the manufacturer’s instructions, with strict adherence to protocol specifications.

Intestinal histomorphological analysis

The collected jejunum was fixed in 4% paraformaldehyde solution and processed for paraffin sectioning through dehydration, clearing, and embedding. Sections were cut at 5 μm thickness, stained, mounted, and observed under an inverted microscope (ECLIPSE TS100, Nikon, Japan). For each slide, 10 non-overlapping fields of view were randomly selected to measure villus height and crypt depth, from which the villus-crypt ratio was calculated.

Colon samples fixed in Carnoy’s solution (ethanol:chloroform:acetic acid = 6:3:1, vol/vol) and stored at 4°C were dehydrated with absolute ethanol (two times, 40–60 min each), cleared with xylene, and embedded in paraffin. Paraffin sections were stained with Alcian blue-nuclear fast red (AB-PAS) to visualize the mucus layer, then observed using an Olympus FV1000 laser confocal microscope (Olympus, Japan). Images of colonic goblet cells were captured with a Cap Studio-SC600C camera, and cell counts were performed using ImageJ software.

Quantification of intestinal barrier related genes and specific bacterial populations

Total RNA was extracted from ileal mucosa using RNAiso Plus (Takara Bio Inc., Japan), and RNA concentration and purity were assessed with a nanospectrophotometer (NanoDrop 2000, Thermo Fisher Scientific, USA). Subsequently, cDNA was synthesized from RNA using a reverse transcription kit (HiScript IV All-in-One Ultra RT SuperMix for qPCR, Vazyme, China). The genes analyzed included zonula occludens-1 (ZO-1), claudin-1 (claudin-1), and occludin, with specific primers listed in Table 2. Real-time PCR was performed on a QuantStudio 5 (Thermo Fisher Scientific, USA) using a reaction mixture containing 5 μL of SYBR Premix Ex Taq, 0.4 μL each of forward and reverse primer, 1 μL of cDNA, and 3.2 μL of RNase-free water. β-Actin and GAPDH served as reference genes for calculating relative gene expression levels via the 2^△△Ct method.

TABLE 2.

Primer sequences and amplicon lengths for real-time PCR analysis^a

Gene	Primer sequence (5′−3′)	Product length (bp)	Accession number
β-Actin	F: TCCATCGTCCACCGCAAATG	114	DQ178122
	R: TTCAGGAGGCTGGCATGAGG
GAPDH	F: CGTCCCTGAGACACGATGGT	220	NM_001206359.1
	R: CCCGATGCGGCCAAAT
ZO-1	F: CAGCCCCCGTACATGGAGA	114	XM_005659811
	R: GCGCAGACGGTGTTCATAGTT
Claudin-1	F: TCTTAGTTGCCACAGCATGG	106	NM001244539
	R: CCAGTGAAGAGAGCCTGACC
Occludin	F: CTACTCGTCCAACGGGAAAG	158	NM_001163647.2
	R: ACGCCTCCAAGTTACCACTG

^a GAPDH, glyceraldehyde-3-phosphate dehydrogenase; ZO-1, zonula occludens 1; ZO-2, zonula occludens 2.

For bacterial quantification in colonic digesta, samples were thawed on ice, and 0.2 g of each sample was used to extract total DNA with the TIANamp Stool DNA Kit (Tiangen Biochemical Technology [Beijing] Co., Ltd., China) according to the manufacturer’s protocol. Quantitative real-time PCR (qPCR) was performed to assess the abundance of Bacteroides, Lactobacillus, Bifidobacterium, and Escherichia coli using specific primers (Table 3).

TABLE 3.

Primer sequences and amplicon lengths for bacterial quantification

Target gene/organism	Primer sequence (5′−3′)	Product length (bp)
Total bacteria	F: AGAGTTTGATCCTGGCTCAG	200
	R: ATTACCGCGGCTGCTGG
Bacteroides	F: CGATGGATAGGGGTTCTGAGAGGA	238
	R: GCTGGCACGGAGTTAGCCGA
Lactobacillus spp.	F: ACTCCTACGGGAGGCAGCAG	126
	R: CAACAGTTACTCTGACACCCGTTCTTC
Bifidobacterium	F: TCGCGTC(C/T)GGTGTGAAAG	243
	R: CCACATCCAGC(A/G)TCCAC
E. coli	F: CATGCCGCGTGTATGAAGAA	96
	R: CGGGTAACGTCAATGAGCAAA

Statistical analysis

All data were first sorted using Microsoft Excel 2019 and then analyzed with the one-way ANOVA module in SPSS 27.0 after confirming normality. Intergroup comparison between two groups was performed using Student’s t-test, while multiple group comparisons were conducted with the Bonferroni post hoc test. Data are presented as mean ± standard error of the mean (SEM), and statistical significance was set at P < 0.05.

RESULTS

Identification of B. thetaiotaomicron strain

The 16S rDNA sequence of the isolated strain showed 99.79% similarity to B. thetaiotaomicron strain JCM 5827 (NCBI GenBank), consistent with intraspecies divergence among different strains. This porcine isolate was therefore designated B. thetaiotaomicron LYH5 (hereinafter referred to as LYH5), as shown in the phylogenetic tree (Fig. 1A).

Fig 1.

Taxonomic identification and physiological characterization of LYH5. (A) Phylogenetic tree of LYH5 based on 16S rRNA sequence. (B) Colony morphology of LYH5 on modified GAM solid medium. (C) Gram staining of LYH5 (G^- rods). (D) Hemolytic activity assay of LYH5 on sheep blood agar (non-hemolytic phenotype). (E) Scanning electron microscopy image of LYH5 cells. (F) Growth curves of E. coli ATCC 25922 and E. coli ATCC 25922 with LYH5 metabolites. (G) Growth curves of S. aureus ATCC 25923 and S. aureus ATCC 25923 with LYH5 metabolites. (H) Growth curves of S. choleraesuis ATCC 527 and S. choleraesuis ATCC 527 with LYH5 metabolites. (I) SCFAs profile of LYH5 in modified GAM medium. Totals, total SCFAs; AA, acetic acid; PA, propionic acid; IVA, isovaleric acid; IBA, iso-butyric acid; BA, butyric acid.

Genomic analysis revealed that LYH5 harbors an extremely low abundance of canonical virulence factors (VFDB) and lacks core clinical antibiotic resistance determinants (CARD/ResFinder). The genome encodes a robust arsenal of carbohydrate-active enzymes (CAZymes) and a large repertoire of secondary metabolite biosynthetic gene clusters. Genes associated with tolerance to environmental stressors such as heavy metals and surfactants (BacMet) were also detected (Fig. 2).

Fig 2.

Comprehensive genomic annotation and functional analysis of Bacteroides thetaiotaomicron LYH5. (A) KEGG pathway enrichment. (B) COG functional classification. (C) GO annotations. (D) Heatmap of gene presence/absence across 16 databases. (E) Virulence classification. (F) Drug resistance classification. (G) CAZyme functional class distribution.

Morphologically, LYH5 formed round, yellow colonies on solid medium and was identified as a gram-negative rod (Fig. 1B and C). Physiological characterization revealed catalase-negative, gelatin liquefaction-negative, and non-motile phenotypes (Table S2). Safety evaluations showed non-hemolytic activity (Fig. 1D) and broad antibiotic sensitivity (Table S3).

In vitro bacteriostatic properties of B. thetaiotaomicron LYH5 metabolites

The agar diffusion Oxford cup assay (Fig. S1) showed no inhibition zones against E. coli ATCC 25922, S. choleraesuis ATCC 527, and S. aureus ATCC 25923, indicating that viable LYH5 cells do not directly inhibit the growth of these pathogens. However, when co-cultured with extracted LYH5 metabolites (Fig. 1F through H), E. coli exhibited significantly reduced growth rates compared to untreated controls (P = 0.029).

MIC assays revealed that LYH5 metabolites exhibited concentration-dependent inhibitory activity against all three pathogenic strains (Table 4). At 1,280 mg/mL, the inhibition rates were 92.1% for S. aureus (MIC₉₀), 65.1% for E. coli, and 68.7% for S. choleraesuis. The MIC for all three strains exceeded 1,280 mg/mL.

TABLE 4.

Inhibitory activity of LYH5 metabolites against three pathogenic strains determined by broth microdilution^a

Parameter	E. coli		S. choleraesuis		S. aureus
	Net OD600	Inhibition (%)	Net OD600	Inhibition (%)	Net OD600	Inhibition (%)
Concentration (mg/mL)
1,280	0.297	65.1	0.251	68.7	0.054	92.1
640	0.787	7.6	0.720	10.4	0.549	19.3
320	0.751	11.8	0.636	20.8	0.634	6.8
160	0.713	16.2	0.633	21.2	0.692	−1.8
80	0.687	19.3	0.631	21.4	0.604	11.1
40	0.696	18.3	0.607	24.4	0.583	14.2
20	0.696	18.3	0.607	24.4	0.575	15.5
10	0.718	15.7	0.616	23.4	0.556	18.2
5	0.762	10.5	0.644	19.9	0.541	20.5
2.5	0.766	10	0.677	15.7	0.572	15.8
Growth control	0.852	–b	0.803	–	0.68	–
Sterility control	0.061	–	0.058	–	0.059	–
MIC (mg/mL)	>1,280	–	>1,280	–	>1,280 (MIC₉₀ = 1,280)	–

^a Inhibition (%) was calculated as [1 − (net OD₆₀₀ of the treated well / net OD₆₀₀ of the growth control)] × 100%. MIC was defined as the lowest concentration yielding net OD₆₀₀ ≤ 0.05. MIC₉₀ was defined as the lowest concentration achieving ≥90% inhibition. Growth control and sterility control values represent net OD₆₀₀ after subtraction of the medium blank.

^b –, not applicable.

GC analysis (Fig. 1I) revealed that LYH5 produced approximately 4.8585 mg/mL of total SCFAs in modified GAM medium after 72 h. Acetic acid was the most abundant SCFA, followed by propionic acid, isovaleric acid, isobutyric acid, and butyric acid.

Scanning electron microscopy of LYH5 OMVs isolated via ultracentrifugation confirmed the presence of intact, well-structured vesicles (Fig. S2), indicating that LYH5 actively secretes OMVs under experimental conditions.

Response surface design and characterization of B. thetaiotaomicron LYH5 microcapsules

Based on single-factor test results (Fig. S3), the Box-Behnken design was used to optimize microencapsulation conditions, with SA (A), gellan gum addition (B), calcium chloride concentration (C), and bacteria-to-gel ratio (D) as independent variables and unit mass encapsulation efficiency as the response variable (Table 5).

TABLE 5.

Box-Behnken design matrix and experimental results for optimization of LYH5 microencapsulation parameters^a

Run no.	A	B	C	D	Encapsulation efficiency (%)
1	1	0	−1	0	65.66
2	0	1	−1	0	66.78
3	1	0	0	−1	70.97
4	0	1	0	1	71.30
5	0	0	−1	−1	69.22
6	0	0	−1	1	70.26
7	1	0	0	1	70.62
8	0	−1	0	1	78.09
9	−1	0	1	0	76.70
10	0	−1	0	−1	77.57
11	−1	−1	0	0	69.57
12	1	0	1	0	78.05
13	−1	0	−1	0	67.30
14	0	0	0	0	84.70
15	0	0	0	0	83.13
16	1	1	0	0	69.73
17	0	0	1	−1	80.70
18	−1	0	0	1	68.70
19	0	0	0	0	82.26
20	0	−1	−1	0	70.09
21	−1	0	0	−1	69.74
22	0	−1	1	0	82.30
23	1	−1	0	0	71.50
24	0	0	1	1	80.71
25	0	0	0	0	83.19
26	0	0	0	0	81.24
27	0	1	0	−1	72.21
28	−1	1	0	0	63.65
29	0	1	1	0	73.98

^a A: SA concentration, B: gellan gum concentration, C: calcium chloride concentration, D: bacteria-to-gel ratio. Levels of each factor are coded as −1, 0, and 1, representing low, medium, and high values, respectively (see Table 1 for actual concentrations).

ANOVA for the response surface model is shown in Table S4. Response surface plots (Fig. 3A through F) exhibited downward-opening arches, indicating a maximum encapsulation efficiency. The optimal theoretical parameters were determined as SA 1.481%, gellan gum 0.391%, calcium chloride 0.854%, and bacterial-to-gel ratio 1:4.255, predicting an 84.77% encapsulation efficiency. For practical application, parameters were adjusted to SA 1.5%, gellan gum 0.4%, calcium chloride 0.9%, and bacterial-to-gel ratio 1:4. Under these conditions, validation experiments showed an average encapsulation efficiency of 84.22 ± 0.17%, highly consistent with the predicted value, confirming the feasibility of response surface methodology for process optimization.

Fig 3.

Response surface analysis of process parameters for LYH5 microencapsulation. (A) Relationship between the embedding rate and the concentrations of gellan gum and SA. (B) Relationship between the embedding rate and the concentrations of CaCl₂ and SA. (C) Relationship between the embedding rate and the concentrations of the bacteria-binder ratio and SA. (D) Relationship between the embedding rate and the concentrations of CaCl₂ and gellan gum. (E) Relationship between the embedding rate and the concentrations of gellan gum and the bacteria-binder ratio. (F) Relationship between the embedding rate and the concentrations of CaCl₂ and the bacteria-binder ratio. The 3D surface plots and corresponding contour plots provide a comprehensive visualization of the relationships and interactions among these variables.

Tolerance and release kinetics of B. thetaiotaomicron LYH5 and its microcapsules in simulated gastrointestinal fluids

Uncapsulated LYH5 showed rapid viability decline in SGF, with survival rates dropping to 12% after 1 h (Fig. 4A). In contrast, viability remained stable in SIF, maintaining 71% survival after 1 h. Microencapsulated LYH5 exhibited significantly enhanced SGF tolerance (Fig. 4B). Uncapsulated LYH5 showed survival rates of 18% at 60 min and 6% at 120 min, whereas microencapsulated LYH5 retained 65% viability after 120 min. Enteric-coated microcapsules demonstrated controlled bacterial release in SIF (Fig. 4C). Viable cell counts increased from 2.94 lg(CFU/g) at 1 h to 3.61 lg(CFU/g) at 4 h, indicating sustained release in the intestinal environment.

Fig 4.

Tolerance and release kinetics of LYH5 microcapsules in simulated gastrointestinal fluids. (A) Viability assay of LYH5 in SGF. (B) Comparative survival rates of uncapsulated and microencapsulated LYH5 in SGF. (C) Time-dependent release kinetics of LYH5 microcapsules in SIF.

Impact of B. thetaiotaomicron LYH5 microcapsules on phenotypic parameters of weaned piglets

During the entire experimental period, dietary supplementation with LYH5 microcapsules did not affect ADG, ADFI, F:G, or the diarrhea index in weaned piglets compared to the CON group (P > 0.05, Table 6). The TJ group exhibited a trend toward lower F:G relative to the CON group (P = 0.071).

TABLE 6.

Growth performance and diarrhea incidence in weaned piglets^a

Item	Group				P-value
	CON	T	TJ	J
Initial weight (kg)	7.73 ± 0.13	7.68 ± 0.13	7.68 ± 0.13	7.67 ± 0.11	0.989
Final weight (kg)	24.51 ± 0.55	23.21 ± 0.55	24.19 ± 0.47	24.07 ± 0.56	0.362
ADG (g/day)	413.35 ± 11.97	388.04 ± 13.70	412.68 ± 10.71	409.89 ± 13.21	0.327
ADFI (g/day)	766.09 ± 21.24	732.55 ± 16.08	726.70 ± 15.71	716.85 ± 19.10	0.276
F:G	1.83 ± 0.02	1.94 ± 0.09	1.78 ± 0.05	1.76 ± 0.03	0.095
Diarrhea index	0.28 ± 0.04	0.36 ± 0.05	0.27 ± 0.04	0.23 ± 0.04	0.211

^a CON, control group; T, basal diet + LYH5 live bacteria; TJ group, basal diet + LYH5 microcapsule; J group, basal diet + empty capsule. Data are presented as mean ± SEM. ADG, average daily gain; ADFI, average daily feed intake; F:G, feed-to-gain ratio.

For apparent nutrient digestibility, LYH5 microcapsules did not impact nutrient digestibility in weaned piglets (P > 0.05, Table S5), though the T group showed a tendency for increased crude protein digestibility (P = 0.093).

Regarding blood biochemical indices (Table S6), serum free fatty acid levels in the TJ group trended higher than those in the CON group (P = 0.083), but no significant differences were observed in other blood parameters across treatment groups (P > 0.05).

Impact of B. thetaiotaomicron LYH5 microcapsules on serum cytokines and immunoglobulins

Serum IgG concentration in the CON group was significantly lower than that in the TJ and J groups (P < 0.05, Fig. 5A), with the TJ group exhibiting the highest level at 1.73 g/L. The T group showed a trend toward increased serum IL-10 concentration compared to the CON group (P = 0.092, Fig. 5D). No differences were observed in serum IgA and TNF-α levels across groups (P > 0.05, Fig. 5B and C).

Fig 5.

LYH5 microcapsules modulate serum cytokines and immunoglobulins in weaned piglets. (A) Serum IgG. (B) Serum IgA. (C) Serum TNF-α. (D) Serum IL-10. Data are presented as mean ± SEM. Statistical significance: *P < 0.05.

Effects of B. thetaiotaomicron LYH5 microcapsules on jejunal morphology and colonic mucus layer in weaned piglets

Compared to the CON group, the TJ group exhibited greater jejunal villus height (P < 0.001) and villus height-to-crypt depth ratio (P < 0.001, Fig. 6A through D). No significant differences were noted between the J and CON groups (P > 0.05). The TJ group also showed a thicker colonic mucus layer than both the CON group (P < 0.001) and T group (P = 0.024, Fig. 6E), along with a trend toward increased colonic goblet cell counts (P = 0.048, Fig. 6F).

Fig 6.

LYH5 microcapsules improve jejunal morphology and colon mucus layer thickness in weaned piglets. (A) Jejunal histomorphology (HE staining). (B) Villus height. (C) Crypt depth. (D) Villus height-to-crypt depth ratio. (E) Colonic mucus layer thickness. (F) Colonic goblet cell count. Data are shown as mean ± SEM. Statistical significance: *P < 0.05, **P < 0.01, ***P < 0.001.

Effects of B. thetaiotaomicron LYH5 microcapsules on intestinal barrier-related gene expression and certain bacterial groups in colonic digesta of weaned piglets

In the jejunum, the T group exhibited upregulated ZO-1 expression compared to the CON group (P = 0.005, Fig. 7A), along with trends toward increased claudin-1 (P = 0.012, Fig. 7C) and occludin (P = 0.071, Fig. 7D), while jejunal ZO-2 expression remained unchanged across all groups (P > 0.05, Fig. 7B). In the colon, the TJ group showed higher ZO-2 (P = 0.007 vs CON, P = 0.003 vs T, Fig. 7F) and claudin-1 (P = 0.012 vs CON, P = 0.003 vs T, Fig. 7G) expression than both the CON and T groups.

Fig 7.

LYH5 microcapsules modulate tight junction gene expression in the jejunum and colon of weaned piglets. (A) Relative mRNA expression of ZO-1 in the jejunum. (B) Relative mRNA expression of ZO-2 in the jejunum. (C) Relative mRNA expression of claudin-1 in the jejunum. (D) Relative mRNA expression of occludin in the jejunum. (E) Relative mRNA expression of ZO-1 in the colon. (F) Relative mRNA expression of ZO-2 in the colon. (G) Relative mRNA expression of claudin-1 in the colon. (H) Relative mRNA expression of occludin in the colon. Data are presented as mean ± SEM. Statistical significance: *P < 0.05, **P < 0.01.

Results of qPCR targeting specific bacterial groups (Table 7) showed that total bacterial counts in the J group were lower than those in the CON (P = 0.048), T (P = 0.010), and TJ (P = 0.039) groups. Bacteroides and Lactobacillus numbers were similar across all groups (P > 0.05), while the TJ group had higher Bifidobacterium counts than both the T (P = 0.005) and CON (P = 0.029) groups. E. coli numbers in the T (P = 0.016) and TJ (P = 0.029) groups were lower than those in the CON group.

TABLE 7.

Quantification of bacterial groups in colonic digesta of weaned piglets [lg (copies)/g wet digesta]^a

Item	Group				P-value
	CON	T	TJ	J
Total bacteria	14.15±0.07a	14.31±0.11a	14.30±0.15a	13.91 ± 0.09b	0.046
Bacteroides	8.41 ± 0.19	8.60 ± 0.12	8.66 ± 0.16	8.58 ± 0.08	0.642
Lactobacillus	11.19 ± 0.15	11.22 ± 0.15	11.78 ± 0.34	11.30 ± 0.29	0.244
Bifidobacterium	10.83±0.11a	10.44 ± 0.17b	11.08±0.07a	10.86±0.12a	0.008
E. coli	12.02±0.27a	11.21 ± 0.14b	11.33 ± 0.11b	11.83 ± 0.27a,b	0.027

^a CON, control group; T, basal diet+LYH5 live bacteria; TJ group, basal diet +LYH5 microcapsule; J group, basal diet + empty capsule. Data are presented as mean ± SEM; values with different superscript letters within the same row indicate significant difference (P < 0.05).

DISCUSSION

Despite the growing interest in Bacteroides species as probiotics, previous studies have primarily focused on their immunomodulatory and gut microbiota-modulating effects, with limited investigation into their biosafety and functional metabolites for practical applications in livestock nutrition. In this study, LYH5 was identified as a novel B. thetaiotaomicron strain based on 16S rRNA sequence analysis, morphological characteristics, and physiological-biochemical properties. The absence of hemolytic activity and sensitivity to most antibiotics further support its potential as a safe probiotic candidate. Genomic analysis revealed that LYH5 harbors an extremely low abundance of canonical virulence factors and lacks core clinical antibiotic resistance determinants, suggesting a minimal risk of pathogenicity or horizontal resistance gene transfer. Furthermore, its genome is enriched in CAZymes and secondary metabolite biosynthetic gene clusters, indicating strong adaptability to the gut environment and a capacity for natural product biosynthesis. However, the overall genomic architecture suggests that LYH5’s metabolic machinery is primarily oriented toward nutrient acquisition and environmental sensing rather than host invasion, a profile consistent with that of commensal Bacteroides species. These findings align with previous investigations on Bacteroides species, which have been widely recognized for their probiotic potential in improving gut health and modulating immune responses (12, 25). The high biosafety and functional attributes of LYH5 render it a promising candidate for oral supplementation in livestock.

In nature, all organisms rely on their innate immune defense system, encompassing pattern recognition receptors, cytokines, complement cascades, and host defense peptides (HDPs) (26). HDPs, often termed “natural antimicrobial peptides,” exhibit broad-spectrum antibacterial activity against various pathogens (27, 28). Dietary components such as SCFAs, probiotics, and prebiotics can enhance endogenous HDP synthesis without inducing inflammation or compromising barrier integrity (29). The antimicrobial activity of LYH5 was evaluated in vitro. Ethyl acetate-extracted metabolites from LYH5 exhibited pronounced effects against E. coli, suggesting that its antimicrobial activity is mediated by metabolites (e.g., acetic acid), which may disrupt pathogen cell membranes (30) or interfere with metabolic pathways (31). Broth microdilution assays further revealed that LYH5 metabolites exhibited concentration-dependent inhibitory activity against all three pathogens tested. Although the MIC values exceeded 1,280 mg/mL for all three strains, a clear inhibitory trend was observed, particularly against the gram-positive S. aureus, for which the metabolites achieved an MIC₉₀ of 1,280 mg/mL. The moderate potency observed in vitro may be partly attributable to the complexity of the cell-free supernatant, which likely contains multiple bioactive components that may act synergistically. Alternatively, the primary antimicrobial mechanism of LYH5 may rely on indirect modulation of the gut environment rather than direct pathogen killing. The enhanced efficacy against S. aureus suggests that the antimicrobial metabolites may preferentially target gram-positive bacteria, a finding consistent with the known activity of certain SCFAs and other bacterially derived compounds. These findings imply that LYH5 may produce HDPs with biological activity, warranting further mechanistic investigation.

Tolerance to gastric and intestinal fluid is a critical criterion for probiotic evaluation. In this study, the survival rate of LYH5 decreased significantly after SGF treatment, indicating poor resistance to the low pH and digestive enzymes of the stomach. By contrast, its survival rate remained stable after SIF treatment, demonstrating its capacity for intestinal adaptability. Given its intolerance to SGF, practical application of LYH5 may require protective strategies, such as appropriate embedding techniques, to ensure its release in the intestine and subsequent physiological effects. Screening and optimizing embedding conditions for this strain thus paves the way for its translational application in livestock production.

Embedding technology has been widely used in the food and feed industry. Previous research indicates that a 1% SA concentration offers suboptimal protection for probiotics due to inadequate tolerance (32). Moreover, SA-based microcapsules typically exhibit a porous surface, rendering them vulnerable to the low-pH gastric environment. To mitigate this limitation, SA is often combined with other wall materials (33). For instance, Lactobacillus helveticus and Lactobacillus delbrueckii microcapsules formulated with 2% SA and a 0.2% gellan gum mixture have demonstrated sufficient bacterial activity to meet the industry-standard dosage range of 10⁶–10⁷ CFU/g (34). Additionally, spherical microcapsules have been shown to outperform non-spherical counterparts in maintaining integrity within SGF, as non-spherical structures tend to rupture prematurely and release their contents (35). Notably, the LYH5 microcapsules prepared in this study, utilizing SA and gellan gum as wall materials, exhibited a pore-free, uniform, and spherical morphology, suggesting enhanced stability.

Despite the emergence of advanced microcapsule fabrication techniques, the traditional extrusion method employed herein offers distinct advantages, including technical simplicity, cost-effectiveness, and high encapsulation efficiency. Given LYH5’s inherent susceptibility to SGF, microencapsulation serves as a crucial strategy to preserve bacterial activity during gastrointestinal transit. Studies have demonstrated that microcapsules prepared via extrusion, such as Salmonella phage microcapsules, can achieve high microencapsulation efficiency, withstand low-pH conditions, and facilitate targeted release in SIF (36). Correspondingly, the LYH5 microcapsules achieved an encapsulation rate of approximately 84.22%, exhibited notable tolerance to SGF, and enabled effective release in SIF. These findings underscore the practical utility of the developed microcapsules, providing a viable solution for translating LYH5 into livestock probiotic application.

While previous research has predominantly explored the impact of Bacteroides on physiological phenotypes within obesity models, findings have been equivocal. Epidemiological studies in both adult and pediatric populations have consistently reported reduced gut Bacteroides abundance in obese individuals (37, 38). Conversely, recent investigations have revealed a positive correlation between B. thetaiotaomicron levels and body mass index across both metabolically healthy and unhealthy obesity phenotypes (39), challenging the simplistic notion of a negative association between Bacteroides and obesity. Mechanistic studies further underscore the metabolic benefits of specific Bacteroides strains. For example, Bacteroides uniformis 7771 administration mitigated metabolic dysfunction in obese mice by reducing serum triglycerides, cholesterol, and glucose levels (40), while Bacteroides supplementation reversed weight loss associated with intestinal disease (12). Notably, our study did not detect significant effects of LYH5 microcapsules on the growth performance or apparent nutrient digestibility of healthy weaned piglets. This discrepancy may be attributed to the contrasting experimental contexts. Prior research predominantly utilized disease models (e.g., obesity or enteritis), highlighting strain-specific anti-inflammatory properties, whereas our study focused on healthy subjects. Nevertheless, the absence of adverse effects on piglet growth validates a crucial prerequisite for LYH5’s potential use as a probiotic.

Immunoglobulins, a class of structural globulins secreted by lymphocytes, mediate diverse immune functions, including antimicrobial activity, antiviral defense, immune modulation, and complement activation (41, 42). Among these, IgG represents the most abundant immunoglobulin in animal serum, constituting 75%–80% of total antibodies (43). Previous investigations have demonstrated that dietary probiotic supplementation can elevate serum IgG concentrations in piglets (44), potentially reducing intestinal pathogen colonization and preventing enteric diseases (45). Extracellular vesicles (EVs) derived from human B. thetaiotaomicron have been shown to maintain immune homeostasis by interacting with innate immune cells and eliciting anti-inflammatory responses (46). Intriguingly, our study identified OMV production by the porcine-derived B. thetaiotaomicron strain, suggesting a potential role in modulating host immune function. However, further validation in pathological models is essential to elucidate the immunomodulatory mechanisms of LYH5-derived EVs.

IL-10 is a pivotal cytokine in the regulation of inflammation and immune responses, serving as a key modulator of host inflammatory reactions during infections with diverse pathogens (47). It exerts its immunomodulatory effects by inhibiting the synthesis of pro-inflammatory factors and chemotaxis while simultaneously promoting the secretion of anti-inflammatory cytokines (48). Previous investigations have established associations between increased gut Bacteroidetes abundance and elevated serum levels of immunoglobulins and cytokines, alongside reduced TNF-α concentrations in piglets (49, 50). For instance, oral administration of Bacteroides vulgatus FTJS7K1 upregulated IL-10 expression in LPS-induced mice (51). In line with these findings, our study demonstrated that dietary supplementation with porcine-derived B. thetaiotaomicron LYH5 microcapsules or live bacterial solutions significantly increased serum IgG levels in weaned piglets. Moreover, the live bacterial solution exhibited a trend toward enhancing IL-10 production, suggesting that LYH5 may promote immune function in piglets. However, additional research using pathological models is warranted to elucidate the precise mechanisms underlying LYH5-mediated immune enhancement.

The integrity of intestinal morphology is fundamental to maintaining normal digestive and absorptive functions, with villus height and crypt depth serving as critical biomarkers for assessing intestinal health. As extensively documented, a higher villus height-to-crypt depth ratio typically correlates with enhanced nutrient digestion and absorption capabilities (52). Given the incomplete intestinal development in weaned piglets, interventions that improve intestinal morphology can promote their physiological functions. Despite the growing interest in NGPs, limited research has explored their impact on intestinal morphology. Existing studies have shown strain-specific effects. In a neonatal rat model of necrotizing enterocolitis induced by Cronobacter sakazakii, treatment with Bacteroides fragilis ZY-312 mitigated intestinal injury by preserving villus height (53), while other B. fragilis strains, such as FSHCM14E1 and NCTC9343, restored colon morphology in mice with DSS-induced colitis (54). Conversely, B. fragilis JSWX11BF failed to alleviate DSS-induced colitis (53), highlighting the variability in probiotic efficacy. Notably, our study revealed that feeding LYH5 microcapsules, but not unencapsulated live bacteria or empty capsules, significantly increased jejunal villus height and improved the villus height-to-crypt depth ratio in healthy weaned piglets. These results suggest that microencapsulation is essential for LYH5 to exert its beneficial effects on intestinal morphology, providing novel insights into the application of Bacteroides as probiotics in swine nutrition.

The intestinal chemical barrier, a pivotal component of the gut mucosal system, is primarily composed of the mucus layer, gastric acid, lysozyme, bile salts, mucoproteins, and antimicrobial peptides (55). These components synergistically exert bactericidal effects and safeguard against the invasion of toxic substances. Goblet cells, specialized epithelial cells lining the intestinal and other mucosal surfaces, are integral to maintaining this barrier by secreting mucus, which forms a protective gel layer overlying the epithelium (56). Previous studies have underscored the role of Bacteroides strains in modulating goblet cell function and mucus production. For instance, oral administration of B. vulgatus 7K1 increases the number of goblet cells in the colons of DSS-treated mice (57). Similarly, B. fragilis ZY-312 enhances mucus secretion and intestinal barrier integrity in mice via the signal transducer and activator of transcription (STAT3) signaling pathway (58). Moreover, treatment with B. ovatus ATCC 8483 promotes the proliferation of intestinal epithelial cells, goblet cell differentiation, and mucin production in DSS-induced mice, outperforming traditional fecal transplantation in efficacy (59).

In the current study, dietary supplementation with LYH5 microcapsules increased the thickness of the colonic mucus layer in healthy weaned piglets and demonstrated a trend toward augmenting the number of colonic goblet cells. Compared with unencapsulated live bacterial solutions, microcapsules exerted more pronounced effects, indicating that the LYH5 strain has the potential to fortify the intestinal chemical barrier of weaned piglets.

Complementing the chemical barrier, the intestinal physical barrier is fundamental to gut homeostasis. Composed of intact intestinal epithelial cells and intercellular tight junctions, it serves as the structural basis for maintaining the selective permeability of the intestinal epithelium and preserving barrier integrity (60). Tight junctions are complex molecular assemblies comprising transmembrane proteins (occludin, claudins) and intracellular adaptor proteins (ZO-1, ZO-2, ZO-3) that regulate paracellular transport (61). Although research on Bacteroides-mediated physical barrier maintenance remains limited, emerging evidence suggests strain-specific benefits. For example, B. fragilis ZY-312 reduces the morbidity and mortality of Clostridium difficile-infected mice and restores the expression levels of ZO-1 and MUC-2 in the intestinal epithelium (62). The same strain also protects against Cronobacter sakazakii infection by upregulating ZO-1 expression and mitigating intestinal damage (53). Our findings revealed differential effects of LYH5 on the physical barrier: the live bacteria more effectively enhanced the gene expression of jejunal tight-junction proteins in healthy weaned piglets, whereas only LYH5 microcapsules promoted tight-junction protein gene expression in the colon. These discrepancies likely stem from the unique properties of the microencapsulation process.

B. thetaiotaomicron predominantly colonizes the posterior intestine of pigs, where it exerts beneficial effects on gut homeostasis. Given that LYH5 microcapsules exhibit slow-release characteristics in intestinal fluid, their distribution activity may vary along the gastrointestinal tract, potentially resulting in reduced release in the jejunum and enhanced release in the colon. Intriguingly, quantification of colonic bacteria did not reveal an expected increase in Bacteroides abundance. This discrepancy may be primarily attributed to the dynamic equilibrium of the gut microbiota in healthy animals, where potential elution mechanisms likely counteract the accumulation of exogenous probiotic strains. To precisely elucidate the colonization patterns of LYH5 within the piglet intestine, future investigations should leverage advanced techniques such as metagenomic sequencing or fluorescence in situ hybridization, which offer higher taxonomic resolution and spatial localization capabilities. Notably, the colonic digesta of the treatment groups (TJ and T) exhibited a significant reduction in E. coli counts compared to the control group. This finding provides additional evidence supporting the probiotic properties of LYH5, as the strain likely exerts antimicrobial effects through the production of metabolites or modulation of the gut microenvironment. These results align with previous in vitro observations of LYH5’s inhibitory activity against E. coli and underscore its potential to improve gut health by suppressing pathogenic bacteria in the porcine intestine.

Several limitations of this study should be acknowledged. First, the absence of inactivated bacterial controls precludes a definitive distinction between probiotic (live-cell) and postbiotic (metabolite-driven) effects. Second, while OMVs were visualized, their functional contribution to the observed immunological effects was not directly assessed. Third, the in vitro mechanisms underlying the barrier-protective effects remain to be fully elucidated, particularly regarding the host-microbe signaling pathways involved. Finally, our findings are based on a short-term trial in healthy piglets. Long-term safety, colonization dynamics, and efficacy under disease challenge conditions await further investigation. Addressing these questions in future studies will help consolidate the translational potential of microencapsulated LYH5 as a probiotic candidate for livestock.

Conclusion

In conclusion, microencapsulation with sodium alginate and gellan gum effectively enhanced the gastric tolerance of the porcine-derived B. thetaiotaomicron LYH5 strain, ensuring its viability following gastric transit. Dietary supplementation with LYH5 microcapsules in weaned piglets significantly elevated serum IgG levels, upregulated intestinal tight-junction gene expression, and strengthened the colonic mucus barrier by promoting goblet cell proliferation, all without compromising growth performance or nutrient digestibility. Collectively, these findings demonstrated that microencapsulation is a feasible strategy to unlock the probiotic potential of acid-sensitive Bacteroides strains for improving intestinal health in young livestock. Further studies are warranted to elucidate the underlying host-microbe interactions using multi-omics approaches, evaluate the therapeutic efficacy in enteric disease models such as post-weaning diarrhea, and assess the scalability and cost-effectiveness of this encapsulation system for practical farm applications.

DATA AVAILABILITY

The whole-genome sequence of B. thetaiotaomicron LYH5 has been deposited in the CNCB database under accession number CRA044927. The corresponding author will provide raw data supporting the findings of this study upon reasonable request.

ETHICS APPROVAL

All experimental procedures and animal care practices in this study adhered strictly to the Guide for the Care and Use of Laboratory Animals established by the Institutional Animal Care and Use Committee of Sichuan Agricultural University. Furthermore, all animal protocols were approved by the same committee under the permit number DKY-B20131704.

SUPPLEMENTAL MATERIAL

The following material is available online at https://doi.org/10.1128/aem.00503-26.

Supplemental material. aem.00503-26-s0001.docx.

Fig. S1 to S4; Tables S1 to S6.

ASM does not own the copyrights to Supplemental Material that may be linked to, or accessed through, an article. The authors have granted ASM a non-exclusive, world-wide license to publish the Supplemental Material files. Please contact the corresponding author directly for reuse.