Skip to main content
NCBI home page
Wiley Open Access Collection logoLink to Wiley Open Access Collection
. 2026 Aug 19;40(9):e71034. doi: 10.1002/jbt.71034

miR‐138‐5p Inhibits Aortic Valve Interstitial by Targeting SLC39A14 and Activating Nrf2 Signaling

Fei Yan 1,✉, Ying Zhao 1, Yuanyuan Wu 1, Dubiao Xian 1, Lei Shi 1, Yunheng Liang 1, Ning Wang 1, Ruiling He 1, Hongwang Cui 2, Zhihao Xie 3
PMCID: PMC13489016  PMID: 42616574

ABSTRACT

This study explored the role of miR‐138‐5p in calcific aortic valve disease (CAVD), focusing on its regulation of osteogenic differentiation in human aortic valve interstitial cells (hAVICs) and underlying mechanisms. Aortic valve tissues from CAVD patients and controls were analyzed for miR‐138‐5p expression using qRT‐PCR. hAVICs were cultured in osteogenic medium (OM) and transfected with miR‐138‐5p mimics or inhibitors. Calcification was evaluated via ALP and Alizarin Red staining. Western blot assessed osteogenic markers (RUNX2, ALP, OPN, BMP‐2). Dual‐luciferase assays confirmed miR‐138‐5p targeting of SLC39A14. The role of SLC39A14 and the Nrf2 pathway was examined through overexpression experiments and Western blot for Nrf2, HO‐1, and NQO1. ML385 was used to inhibit Nrf2. miR‐138‐5p was significantly downregulated in CAVD tissues and OM‐induced hAVICs. Overexpression of miR‐138‐5p inhibited calcification, reducing ALP activity, nodule formation, and osteogenic marker expression. Inhibition of miR‐138‐5p promoted calcification. SLC39A14, upregulated in CAVD, was validated as a direct target of miR‐138‐5p. Its overexpression promoted calcification, which was reversed by co‐transfection with miR‐138‐5p. Mechanistically, miR‐138‐5p was associated with activation of the Nrf2 pathway, as evidenced by increased Nrf2 nuclear translocation and HO‐1/NQO1 expression, whereas SLC39A14 overexpression showed the opposite effect. Nrf2 inhibition with ML385 diminished the anti‐calcific effect of miR‐138‐5p. miR‐138‐5p inhibits hAVIC calcification, at least in part through regulation of SLC39A14 and the Nrf2 pathway, highlighting a potentially important regulatory mechanism in CAVD and a candidate therapeutic target for valve calcification.

Keywords: calcific aortic valve disease (CAVD), MicroRNA‐138‐5p (miR‐138‐5p), Nrf2 pathway, osteogenic differentiation, SLC39A14

Nrf2 Pathway Inhibition Attenuates miR‐138‐5p's Anti‐Calcification Effects in OM‐Induced hAVICs. A. ALP staining for ALP activity assessment in NC‐mimic, miR‐mimic, and miR‐mimic + ML385 groups. B. Alizarin Red staining for osteogenesis and calcium nIn osteogenic medium‐induced human aortic valve interstitial cells (hAVICs), miR‐138‐5p targets SLC39A14 to promote Nrf2 nuclear translocation, upregulate HO‐1 and NQO1, and suppress osteogenic markers RUNX2, OPN, ALP, and BMP‐2, thereby reducing calcification and highlighting the miR‐138‐5p/SLC39A14/Nrf2 axis in CAVD.

graphic file with name JBT-40-e71034-g003.webp

1. Introduction

Calcific aortic valve disease (CAVD) represents the most prevalent form of valvular heart disease among elderly populations, affecting 2–4% of individuals over 65 years of age and nearly 3% of those over 75 years old with severe aortic stenosis (AS) [1, 2]. As the global population ages, CAVD imposes a substantial burden on public health and healthcare systems due to increased cardiovascular morbidity and mortality. Severe AS, characterized by extensive fibrocalcification and valve stiffening, significantly reduces median survival to less than 2 years without valve replacement interventions, such as surgical aortic valve replacement (SAVR) or transcatheter aortic valve replacement (TAVR) [3, 4]. Despite this significant clinical burden, there are currently no effective pharmacological treatments for CAVD, largely because the molecular mechanisms driving valvular calcification remain incompletely understood [5].

The pathophysiology of CAVD is primarily driven by the osteogenic differentiation of aortic valve interstitial cells (VICs), which transition from a quiescent fibroblast‐like phenotype to an osteoblast‐like state in response to pathological stimuli such as pro‐inflammatory cytokines, mechanical stress, and oxidative damage [6]. This transdifferentiation is characterized by increased expression of osteogenic markers, including alkaline phosphatase (ALP), Runt‐related transcription factor 2 (Runx2), osteopontin (OPN), and bone morphogenetic protein‐2 (BMP‐2) [7, 8]. Thus, preventing or attenuating VIC osteogenic differentiation has been proposed as a potential strategy to slow the progression of CAVD [9].

MicroRNAs (miRNAs), a class of small non‐coding RNAs that regulate gene expression by modulating mRNA stability and translation, have emerged as important regulators in cardiovascular diseases, including atherosclerosis and cardiac hypertrophy [10, 11]. Among these, several miRNAs have been implicated in the regulation of VIC osteogenic differentiation, such as miR‐101‐3p, miR‐21‐5p, miR‐26a, miR‐30b, and miR‐195 [12, 13, 14]. For instance, miR‐21‐5p promotes calcification by targeting anti‐calcific genes, whereas miR‐26a and miR‐30b inhibit osteogenic differentiation through modulation of calcification‐related signaling pathways. These observations highlight the important regulatory role of miRNAs in valvular calcification.

Among these regulatory miRNAs, miR‐138‐5p has recently attracted attention as a potential modulator of osteogenic differentiation. Previous studies have shown that miR‐138‐5p can suppress osteogenic differentiation of human aortic valve interstitial cells by targeting RUNX2 and modulating the Wnt/β‐catenin signaling pathway [15]. In addition, miR‐138‐5p has been implicated in oxidative stress regulation and skeletal metabolism in other biological contexts [16]. Given that oxidative stress is recognized as a key contributor to VIC calcification, these observations raise the possibility that miR‐138‐5p may influence valvular calcification through mechanisms related to cellular redox regulation. However, whether miR‐138‐5p regulates VIC osteogenic differentiation through alternative downstream targets linked to oxidative stress signaling remains largely unexplored. In particular, the potential involvement of the SLC39A14‐mediated metal homeostasis pathway and its relationship with Nrf2 activation has not previously been investigated in the context of CAVD.

A signaling pathway that has been reported to be closely linked to oxidative stress responses is the nuclear factor erythroid 2‐related factor 2 (Nrf2) pathway [17], which represents a major regulator of cellular antioxidant defense. Activation of Nrf2 has been shown to promote the expression of downstream antioxidant genes such as heme oxygenase‐1 (HO‐1) and NAD(P)H quinone dehydrogenase‐1 (NQO1), which protect cells from oxidative damage [18]. Current literature suggests that activation of the Nrf2 pathway may inhibit osteogenic differentiation and reduce calcification in vascular and valvular cells. However, whether miR‐138‐5p regulates VIC calcification through modulation of oxidative stress signaling pathways remains unclear.

In this study, we hypothesized that miR‐138‐5p suppresses osteogenic differentiation of VICs by regulating SLC39A14 and subsequent modulation of Nrf2 signaling. To test this hypothesis, we used an in vitro calcification model of human aortic valve interstitial cells (hAVICs) and performed gain‐ and loss‐of‐function experiments to investigate the role of miR‐138‐5p in VIC calcification to determine whether a miR‐138‐5p/SLC39A14/Nrf2 regulatory axis contributes to the control of osteogenic differentiation in CAVD.

2. Materials and Methods

2.1. Tissue Collection

Human aortic valve tissues (n = 10) were obtained from adult patients undergoing aortic valve replacement at our institution. The specimens comprised calcified aortic valves from patients with confirmed calcific aortic valve disease and non‐calcified aortic valves from patients with aortic regurgitation due to aortic annulus dilation. The diagnosis of CAVD was confirmed by intraoperative examination and histopathological analysis. Patients with a history of liver or kidney disease, osteoarthritis, inflammatory or systemic inflammatory disorders, malignancies, chronic corticosteroid use, or other severe conditions within the preceding 5 years were excluded. Following surgical excision, all tissues intended for primary cell isolation were immediately processed for hAVIC culture. Separate tissue samples for RNA and protein analysis were snap‐frozen in liquid nitrogen and stored at −80°C for subsequent molecular analyses.

This study was approved by the Ethics Committee of First Affiliated Hospital of Hainan Medical University (Approval No. 2025‐KYL‐016) and conducted following the Declaration of Helsinki. Informed consent was obtained from all participants before tissue collection.

2.2. Isolation and Culture of hAVICs

Primary hAVICs were isolated from fresh aortic valve tissues according to established protocols with specific modifications. Briefly, fresh valve leaflets were transported to the laboratory in cold, sterile PBS supplemented with 100 U/mL penicillin and 100 μg/mL streptomycin. Valve leaflets were initially washed with ice‐cold phosphate‐buffered saline (PBS) and subjected to enzymatic digestion with 2.5 mg/mL collagenase type II (Sigma‐Aldrich, #1148090) at 37°C for 30 min to remove valve endothelial cells. The residual valve tissues were mechanically dissected into smaller fragments and further digested with 0.8 mg/mL collagenase for 4–6 h at 37°C. The resulting interstitial cells were collected by centrifugation (300 g, 5 min) and resuspended in M199 medium (Sigma‐Aldrich, #M4530) supplemented with 100 U/mL penicillin, 100 μg/mL streptomycin, and 10% fetal bovine serum (FBS, Gibco) at 37°C with 5% CO2. Cells between passages 4 and 6 were used for experiments to ensure consistency. For osteogenic differentiation, hAVICs at 80% confluence were cultured in osteogenic medium (OM, Sigma‐Aldrich, #417D‐250) containing 10 mmol/L β‐glycerophosphate (Sigma‐Aldrich, #G9422), 100 nmol/L dexamethasone (Sigma‐Aldrich, #D4902), and 50 μg/mL ascorbic acid (Sigma‐Aldrich, #AX1775), with medium changes every 2 days [19].

3. Experimental Grouping and Cell Transfection

Cells were allocated to the following experimental groups: miR‐138‐5p mimic group (miR‐mimic), negative control mimic group (NC‐mimic), miR‐138‐5p inhibitor group (miR‐inhibitor), and negative control inhibitor group (NC‐inhibitor). To investigate the functional role of SLC39A14, additional groups were established: SLC39A14 empty vector control (OE‐NC) and overexpression (OE‐SLC39A14) groups; miR‐138‐5p mimic + empty vector (miR‐mimic+OE‐NC) group; miR‐138‐5p mimic + SLC39A14 overexpression (miR‐mimic+OE‐SLC39A14) group; negative control mimic + empty vector group (NC‐mimic+OE‐NC); and negative control mimic + SLC39A14 overexpression group (NC‐mimic+OE‐SLC39A14). To elucidate the interaction between miR‐138‐5p and the Nrf2 pathway, an additional experimental group was included: miR‐138‐5p mimic + ML385 (miR‐mimic+ML385) group, wherein cells were treated with 1 μM ML385 (Nrf2 inhibitor, Sigma‐Aldrich, #SML1833).

The cells were transfected using Lipofectamine 3000 (Thermo Fisher Scientific, #L3000150) following the manufacturer's protocol and the experimental groupings. For gain‐of‐function experiments, miR‐138‐5p mimics were transfected at concentrations commonly used in miRNA functional studies (50 nM), which produces an increase in intracellular miRNA levels. This approach is widely applied to investigate downstream regulatory mechanisms and represents functional overexpression rather than precise restoration of endogenous physiological levels. After transfection, the cells were maintained in low‐serum medium (containing 1% FBS), refreshed every 3 days, and cultured for 21 days prior to analysis. For osteogenic differentiation, hAVICs were seeded in 24‐well plates at a density of 4 × 104 cells/well, cultured to 60–70% confluence, and induced with osteogenic medium supplemented with 50 μg/mL ascorbate‐2‐phosphate and 10 mM β‐glycerophosphate for 21 days. ALP staining was performed on day 7 and alizarin red staining on day 21 to evaluate osteoblastic differentiation.

3.1. qRT‐PCR

Total RNA was extracted from tissues or cells using TRIzol reagent (Invitrogen, #15596018CN) following standard protocols. For miR‐138‐5p detection, reverse transcription was performed using a miRNA‐specific reverse transcription (RT) primer, followed by qPCR with the TaqMan miRNA assay system (Applied Biosystems, USA). For mRNA detection, complementary DNA (cDNA) was synthesized using PrimeScripTM RT Master Mix (Takara, #RR036A), and qPCR was performed using SYBR Green Master Mix (Takara, #RR820A). The relative expression levels of miR‐138‐5p and SLC39A14 were normalized to U6 and GAPDH, respectively, employing the 2−ΔΔCt method for relative quantification. The primer sequences used were as follows: miR‐138‐5p, Forward: GCGAGCTGGTGTTGTGAATC, Reverse: AGTGCAGGGTCCGAGGTATT; SLC39A14, Forward: TCCGAGCGCCAGGTTTATTC, Reverse: GGGGTGGTTCTCCATAAGCC. All experiments were performed in three independent experiments, and each sample was analyzed in technical triplicate.

3.2. Assessment of ALP

Alkaline phosphatase activity was assessed using a BCIP/NBT Alkaline Phosphatase Colour Development Kit (Beyotime, #C3206) according to the manufacturer's specifications. Briefly, cultured cells were gently rinsed with PBS and fixed with 10% neutral buffered formalin for 15 min at room temperature. Following fixation, cells were thoroughly rinsed with PBS three times and BCIP/NBT liquid substrate solution until the characteristic blue/purple color developed. The reaction was terminated by washing with deionized water (ddH2O). Stained cell monolayers or glass coverslips were imaged using a high‐resolution scanner (Canon, Japan) for qualitative analysis [20].

3.3. Alizarin Red Staining

Calcium deposition within the extracellular matrix was evaluated using an alizarin red staining kit (Beyotime, #C0148S) following 21 days of osteogenic differentiation, according to the manufacturer's instructions. Briefly, differentiated VICs were fixed with pre‐chilled 95% ethanol for 15 min, followed by incubation with alizarin red solution for 5 min at room temperature. Excess dye was removed by rinsing with distilled water, and the stained cells were allowed to air‐dry before mounting. Calcified nodules in the VIC cultures were visualized and documented using an advanced microscope system (Carl Zeiss AG, Germany). For quantitative analysis, the alizarin red S dye was solubilized from the cell matrix by incubation in cetyl pyridinium chloride for 15 min. The concentration of released dye was determined by spectrophotometric measurement at 540 nm. The quantitative results were normalized to total cellular protein content to account for variations in cell number [21].

3.4. Western Blot

Cells were seeded in 6‐well plates and subjected to the indicated experimental treatments. After treatment, cells were harvested for protein extraction. Total cellular protein was extracted using RIPA lysis buffer (Solarbio) supplemented with phenylmethylsulfonyl fluoride (PMSF) and phosphatase inhibitors. For analysis of Nrf2 subcellular localization, nuclear and cytoplasmic protein fractions were prepared using a nuclear and cytoplasmic protein extraction kit (Beyotime, China) according to the manufacturer's instructions. Protein concentrations were determined using a BCA protein assay kit (Beyotime, #P0012). Equal amounts of protein were separated by SDS‐PAGE and subsequently transferred onto PVDF membranes. Membranes were blocked with 5% non‐fat milk for 2 h at room temperature and then incubated overnight at 4°C with the following primary antibodies (all from Abcam, used at 1:1000 dilution and were validated before use): SLC39A14 (ab106568), RUNX2 (ab7695), ALP (ab305305), osteopontin (OPN, ab214050), BMP‐2 (ab14933), heme oxygenase‐1 (HO‐1, ab189491), NAD(P)H quinone dehydrogenase −1 (NQO1, ab80588), nuclear factor erythroid 2‐related factor 2 (Nrf2, ab62352), Histone H3 (nuclear marker, ab1791), and β‐actin (loading control, ab8226). After washing, membranes were incubated with horseradish peroxidase (HRP)‐conjugated secondary antibodies—goat anti‐mouse IgG (1:5000, ab205719, Abcam) or goat anti‐rabbit IgG (1:5000, ab205718, Abcam)—for 1 h at room temperature. Protein bands were detected using a BeyoECL Star chemiluminescence kit (Beyotime, #P0018AS) and visualized with a chemiluminescence imaging system. Band intensities were quantified using ImageJ software.

3.5. Dual‐Luciferase Reporter Assay

To validate the direct interaction between miR‐138‐5p and SLC39A14, the 3’ untranslated region (3'UTR) of SLC39A14 containing the predicted miR‐138‐5p binding site was amplified and cloned into a pmirGLO dual‐luciferase vector to generate the wild‐type (SLC39A14‐WT) reporter construct. A corresponding mutant (SLC39A14‐MUT) reporter construct was engineered by site‐directed mutagenesis of the putative miR‐138‐5p binding site within the SLC39A14 3'UTR. hAVICs were co‐transfected with either miR‐138‐5p mimic or NC‐mimic along with either SLC39A14‐WT or SLC39A14‐MUT reporter plasmids using Lipofectamine 3000. Luciferase activity was measured 48 h post‐transfection using a dual‐luciferase reporter assay system according to the manufacturer's protocol. Firefly luciferase activity was normalized to Renilla luciferase activity to control for transfection efficiency.

3.6. Statistical Analysis

Data are presented as mean ± standard deviation (SD) from at least three independent experiments. Statistical analyses were conducted using SPSS version 20.0. Data normality was assessed using the Shapiro–Wilk test. Comparisons between two groups were performed using an unpaired two‐tailed Student's t‐test, while comparisons among multiple groups were analyzed using one‐way or two‐way analysis of variance (ANOVA) followed by Tukey's post hoc test, as appropriate. A p value < 0.05 was considered statistically significant.

4. Results

4.1. miR‐138‐5p Attenuates OM‐Induced Calcification in hAVICs

Baseline clinical characteristics of the study population are summarized in Supplementary Table 1. To elucidate the role of miR‐138‐5p in CAVD, we first examined its expression profile in human valve tissues and cultured hAVICs. qRT‐PCR analysis revealed a significant downregulation of miR‐138‐5p in CAVD specimens compared to normal controls (p < 0.01, Figure 1A). Similarly, hAVICs cultured in OM exhibited markedly reduced miR‐138‐5p expression relative to untreated controls (p < 0.01, Figure 1B).

Figure 1.

Figure 1

Open in a new tab

miR‐138‐5p Attenuates OM‐Induced calcification in hAVICs In Vitro. (A) qRT‐PCR analysis of miR‐138‐5p expression in calcified aortic valve (CAVD) tissues and normal aortic valve tissues, n = 10. (B) qRT‐PCR analysis of miR‐138‐5p expression in control and osteogenic medium (OM)‐treated hAVICs. (C) Validation of miR‐138‐5p overexpression and knockdown following transfection with miR‐138‐5p mimic or inhibitor. (D) ALP staining showing alkaline phosphatase activity in hAVICs following miR‐138‐5p mimic or inhibitor transfection. Representative images are shown (left), and quantitative analysis of ALP activity was performed by measuring integrated optical density (IOD) (right). (E) Alizarin Red staining demonstrating calcium deposition in hAVICs after miR‐138‐5p modulation. Representative images are shown (left), and quantitative analysis of mineralization was performed by measuring the absorbance of solubilized Alizarin Red dye (right). (F) Western blot analysis of osteogenic markers (RUNX2, ALP, OPN, BMP‐2) following miR‐138‐5p overexpression or inhibition. Data are presented as mean ± SD (n = 3 technical replicates). A–B: unpaired two‐tailed Student's t‐test; (C–F): one‐way or two‐way ANOVA with Tukey's post hoc test, as appropriate. **p < 0.01 versus NC‐mimic group; ## p < 0.01 versus NC‐inhibitor group. Scale bar: 100 μm.

To further investigate the functional impact of miR‐138‐5p, we performed gain‐ and loss‐of‐function experiments in hAVICs. Transfection with miR‐138‐5p mimic substantially increased miR‐138‐5p expression compared to the NC‐mimic group, while miR‐138‐5p inhibitor significantly reduced its expression compared to the NC‐inhibitor (p < 0.01, Figure 1C), confirming the successful overexpression and knockdown of miR‐138‐5p.

Next, we assessed the impact of miR‐138‐5p modulation on osteogenic differentiation and calcification. ALP staining revealed that miR‐138‐5p mimic significantly suppressed ALP activity (p < 0.01), whereas miR‐138‐5p inhibitor markedly enhanced it (p < 0.01) compared to their respective controls (Figure 1D). Similarly, Alizarin Red staining demonstrated that miR‐138‐5p mimic significantly reduced calcified nodule formation, while miR‐138‐5p inhibitor significantly increased calcium deposition (p < 0.01, Figure 1E).

Furthermore, Western blot analysis (Figure 1 F) indicated that miR‐138‐5p mimic significantly decreased the expression of osteogenic markers, including RUNX2, ALP, OPN, and BMP‐2, compared to NC‐mimic (p < 0.01). Conversely, miR‐138‐5p inhibitor significantly upregulated these proteins compared to NC‐inhibitor (p < 0.01).

Collectively, these results suggested that miR‐138‐5p exerted potent inhibitory effects on OM‐induced osteogenic differentiation and calcification in hAVICs, supporting its potential as a therapeutic target for CAVD.

4.2. miR‐138‐5p Activates the Nrf2 Pathway in OM‐Induced hAVICs

Given the inhibitory effect of miR‐138‐5p on osteogenic differentiation, we next explored whether this protective effect is mediated through the Nrf2 signaling, a key regulator of cellular antioxidant defense. Western blot analysis revealed that miR‐138‐5p mimic significantly enhanced the expression of Nrf2 downstream targets HO‐1 and NQO1 compared to NC‐mimic (p < 0.01, Figure 2A). In contrast, the miR‐138‐5p inhibitor markedly downregulated these proteins relative to the NC‐inhibitor (p < 0.01), indicating that miR‐138‐5p positively regulates antioxidant defense mechanisms.

Figure 2.

Figure 2

Open in a new tab

Activation of the Nrf2 Pathway by miR‐138‐5p in OM‐Induced Calcification of hAVICs. (A) Western blot analysis of HO‐1 and NQO1 protein levels in NC‐mimic, miR‐mimic, NC‐inhibitor, and miR‐inhibitor groups. (B) Western blot analysis of Nrf2 expression in the cytoplasm and nucleus across different groups. Data are presented as mean ± SD (n = 3 technical replicates). Statistical analysis was performed using two‐way ANOVA with Tukey's post hoc test. **p < 0.01 versus NC‐mimic group; ## p < 0.01 versus NC‐inhibitor group.

Additionally, we examined the subcellular distribution of Nrf2 to determine its activation status (Figure 2B). Compared with NC‐mimic, miR‐138‐5p mimic significantly reduced cytoplasmic Nrf2 levels while markedly increasing nuclear Nrf2 accumulation (p < 0.01), indicating enhanced nuclear translocation of Nrf2. In contrast, miR‐138‐5p inhibitor significantly increased cytoplasmic Nrf2 while reducing its nuclear content relative to NC‐inhibitor (p < 0.01), indicating impaired Nrf2 activation.

These results indicated that miR‐138‐5p activated Nrf2 signaling in OM‐induced hAVICs, supporting its regulatory role of miR‐138‐5p in modulating redox homeostasis and oxidative stress responses during osteogenic differentiation.

4.3. SLC39A14 Is a Direct Target of miR‐138‐5p

To identify potential molecular mechanisms underlying miR‐138‐5p‐mediated Nrf2 activation, we investigated SLC39A14, a known regulator of the Nrf2 pathway. qRT‐PCR and Western blot analyses demonstrated that SLC39A14 expression was significantly upregulated in CAVD patient valve tissues compared to normal controls (p < 0.01, Figure 3A, B), and a similar increase was observed in OM‐treated hAVICs relative to untreated controls (p < 0.01, Figure 3D,E).

Figure 3.

Figure 3

Open in a new tab

Identification of SLC39A14 as a Direct Target of miR‐138‐5p in the Regulation of Osteogenic Differentiation. (A) qRT‐PCR analysis of SLC39A14 expression in CAV and normal aortic valve tissues (n = 10 patients per group; **p < 0.01 vs. Normal group). (B) Western blot analysis of SLC39A14 protein expression in CAV and normal aortic valve tissues, n = 10. (C) Negative correlation between miR‐138‐5p and SLC39A14 expression. (D) qRT‐PCR analysis of SLC39A14 expression in control and OM‐treated cells. (E) Western blot analysis of SLC39A14 protein levels in normal and CAV valve tissues, n = 10. (F) Western blot analysis of SLC39A14 protein levels in control and OM‐treated hAVICs. (G) Western blot analysis of SLC39A14 protein expression in NC‐mimic, miR‐mimic, NC‐inhibitor, and miR‐inhibitor groups. (H) Bioinformatics prediction of the miR‐138‐5p binding site in the 3’ UTR of SLC39A14. (I) Dual‐luciferase reporter assay validating miR‐138‐5p targeting of SLC39A14. Data are presented as mean ± SD. (A, C, E, F, I): unpaired two‐tailed Student's t‐test. D and G: one‐way ANOVA followed by Tukey's post hoc test. (B) Pearson correlation analysis. **p < 0.01 versus NC‐mimic group; ## p < 0.01 versus NC‐inhibitor group.

Correlation analysis showed a significant negative relationship between miR‐138‐5p and SLC39A14 expression (p < 0.01, Figure 3C), suggesting that miR‐138‐5p negatively regulates SLC39A14. To validate this relationship, we conducted gain‐ and loss‐of‐function experiments. Transfection with miR‐138‐5p mimic significantly reduced SLC39A14 expression compared to NC‐mimic (p < 0.01), whereas miR‐138‐5p inhibitor significantly upregulated SLC39A14 expression compared to NC‐inhibitor (p < 0.01), indicating that miR‐138‐5p negatively regulated SLC39A14 expression (Figure 3F,G).

Bioinformatic analysis predicted a potential binding site for miR‐138‐5p within the 3’ UTR of SLC39A14 (Figure 3H). This interaction was experimentally validated by a dual‐luciferase reporter assay, which demonstrated that co‐transfection with miR‐138‐5p mimic significantly suppressed luciferase activity of the wild‐type SLC39A14 3’ UTR construct (p < 0.01) while having no significant effect on the mutant vector (Figure 3I).

Collectively, these findings support the involvement of SLC39A14 as an important downstream target of miR‐138‐5p in regulating hAVIC calcification.

4.4. miR‐138‐5p Reverses SLC39A14 Overexpression‐Induced Calcification and Inhibition of the Nrf2 Pathway in hAVICs

After identifying SLC39A14 as a target of miR‐138‐5p, we next examined whether miR‐138‐5p overexpression could counteract the pro‐calcific effects induced by SLC39A14 overexpression and modulate Nrf2 pathway activity. Western blot analysis confirmed successful overexpression of SLC39A14 in the OE‐SLC39A14 group compared to the empty vector control (p < 0.01, Figure 4A).

Figure 4.

Figure 4

Open in a new tab

miR‐138‐5p rescues SLC39A14 overexpression‐induced calcification and Nrf2 pathway inhibition in hAVICs. (A) Western blot analysis confirming SLC39A14 overexpression in OE‐NC and OE‐SLC39A14 groups. (B) ALP staining assessing ALP activity in NC‐mimic + OE‐NC, miR‐mimic + OE‐NC, NC‐mimic + OE‐SLC39A14, and miR‐mimic + OE‐SLC39A14 groups. Representative staining images are shown (left), and quantitative analysis of ALP activity was performed using integrated optical density (IOD) measurements (right). (C) Alizarin Red staining showing calcium nodule formation in different groups. Representative images are shown (left), and quantitative analysis of mineralization was performed by measuring absorbance after solubilization of Alizarin Red dye (right). (D) Western blot analysis of osteogenic markers (RUNX2, ALP, OPN, BMP‐2). (E) Western blot analysis of HO‐1 and NQO1 protein expression. (F) Western blot analysis of cytoplasmic and nuclear Nrf2 levels. Data are presented as mean ± SD (n = 3 technical replicates). A: unpaired two‐tailed Student's t‐test; (B–F): one‐way ANOVA with Tukey's post hoc test. p < 0.01 versus NC‐mimic + OE‐NC group; ## p < 0.01 versus miR‐mimic + OE‐NC group; & & p < 0.01 versus NC‐mimic + OE‐SLC39A14 group. Scale bar: 50 μm.

ALP staining demonstrated that miR‐138‐5p mimic significantly reduced ALP activity compared to NC‐mimic, whereas SLC39A14 overexpression significantly enhanced it (p < 0.01). Notably, miR‐138‐5p mimic significantly attenuated the increased ALP activity induced by SLC39A14 overexpression (p < 0.05), indicating its protective effect against osteogenic differentiation (Figure 4B). Similarly, Alizarin Red staining revealed that SLC39A14 overexpression significantly promoted calcified nodule formation (p < 0.01), while miR‐138‐5p mimic markedly suppressed mineralization (p < 0.01). Importantly, miR‐138‐5p mimic significantly mitigated the SLC39A14‐induced increase in calcification, indicating that miR‐138‐5p can antagonize SLC39A14‐driven calcific changes (Figure 4C).

Further evaluation of osteogenic markers by Western blot analysis demonstrated that miR‐138‐5p mimic significantly reduced RUNX2, ALP, OPN, and BMP‐2 levels (p < 0.01), while SLC39A14 overexpression significantly upregulated these proteins (p < 0.01). Notably, miR‐138‐5p mimic effectively reversed the upregulation of these osteogenic markers induced by SLC39A14 overexpression (p < 0.01) (Figure 4D).

Next, we investigated the influence of miR‐138‐5p on the Nrf2 pathway. Western blot analysis revealed that miR‐138‐5p mimic significantly increased HO‐1 and NQO1 protein levels while promoting nuclear translocation of Nrf2 (p < 0.01). In contrast, SLC39A14 overexpression significantly decreased HO‐1 and NQO1 expression while inhibiting Nrf2 nuclear translocation (p < 0.01). Notably, miR‐138‐5p mimic significantly attenuated the suppressive effects of SLC39A14 overexpression on Nrf2 pathway components, accompanied by increased HO‐1 and NQO1 expression and enhanced nuclear Nrf2 translocation (p < 0.01) (Figure 4E,F).

To further investigate the mechanism linking SLC39A14 to Nrf2 signaling, we performed additional analyses. SLC39A14 overexpression suppressed Nrf2 downstream targets (HO‐1 and NQO1), reduced Nrf2 nuclear translocation, and enhanced Keap1–Nrf2 interaction, whereas zinc chelation by TPEN partially reversed these changes (Fig. S1).

These findings indicated that miR‐138‐5p can counteract SLC39A14 overexpression‐induced calcification and Nrf2 pathway suppression in hAVICs, supporting the involvement of SLC39A14 in the protective effects of miR‐138‐5p during CAVD‐related osteogenic differentiation.

4.5. Nrf2 Pathway Inhibition Attenuates the Anti‐Calcification Effect of miR‐138‐5p in OM‐Induced hAVICs

To further delineate the role of the Nrf2 pathway in miR‐138‐5p‐mediated inhibition of osteogenic differentiation, we employed ML385, a specific Nrf2 inhibitor.

ALP staining demonstrated that miR‐138‐5p mimic significantly reduced ALP activity compared to NC‐mimic (p < 0.01). However, this effect was significantly diminished in the presence of ML385 (p < 0.01), indicating that Nrf2 pathway inhibition compromised the suppressive effect of miR‐138‐5p on osteogenic differentiation (Figure 5A). Similarly, Alizarin Red staining showed that miR‐138‐5p mimic significantly decreased calcified nodule formation compared with NC‐mimic (p < 0.01), whereas this anti‐calcification effect was significantly attenuated by ML385 treatment (p < 0.01), suggesting that Nrf2 activation contributes importantly to miR‐138‐5p‐mediated inhibition of osteogenesis (Figure 5B).

Figure 5.

Figure 5

Open in a new tab

Nrf2 pathway inhibition attenuates the anti‐calcification effects of miR‐138‐5p in OM‐induced hAVICs. (A) ALP staining evaluating ALP activity in NC‐mimic, miR‐mimic, and miR‐mimic + ML385 groups. Representative images are shown (left), and quantitative analysis of ALP activity was performed using integrated optical density measurements (right). (B) Alizarin Red staining assessing calcium deposition across different groups. Representative images are shown (left), and quantitative analysis of mineralization was performed by measuring absorbance of solubilized Alizarin Red dye (right). (C) Western blot analysis of osteogenic markers (RUNX2, ALP, OPN, BMP‐2). Data are presented as mean ± SD (n = 3 technical replicates). Statistical analysis was performed using one‐way ANOVA with Tukey's post hoc test. p < 0.01 versus NC‐mimic group; ## p < 0.01 versus miR‐mimic group. Scale bar: 50 μm.

Western blot analysis revealed that miR‐138‐5p mimic significantly decreased the expression of osteogenic markers (RUNX2, ALP, OPN, and BMP‐2) compared to NC‐mimic (p < 0.01). However, this inhibitory effect was significantly weakened in the presence of ML385 (p < 0.01), indicating that Nrf2 inhibition reversed the suppressive effects of miR‐138‐5p on osteogenic differentiation (Figure 5C).

Collectively, these results suggested that the Nrf2 pathway is an important mediator of the anti‐calcification effect of miR‐138‐5p in OM‐induced hAVICs.

5. Discussion

The present study suggests a novel regulatory mechanism whereby miR‐138‐5p exerts anti‐calcification effects in hAVICs, at least partly through modulation of the SLC39A14/Nrf2 axis, thereby inhibiting osteogenic differentiation. These findings expand our understanding of miRNA‐mediated regulation in CAVD and support the potential relevance of miR‐138‐5p as a therapeutic candidate for mitigating valvular calcification.

Our results demonstrated that miR‐138‐5p was significantly downregulated in both CAVD tissues and OM‐treated hAVICs, which is consistent with previous reports of miRNA dysregulation in calcified valves, such as miR‐26a, miR‐30b, and miR‐195 [22, 23, 24]. Functional assays confirmed that miR‐138‐5p overexpression inhibited osteogenic differentiation, as evidenced by reduced ALP activity, decreased calcified nodule formation, and downregulation of osteogenic markers (RUNX2, ALP, OPN, and BMP‐2). In contrast, inhibition of miR‐138‐5p significantly promoted osteogenesis. These findings are consistent with studies on other miRNAs, including miR‐204, which suppresses calcification by targeting RUNX2 [22], suggesting that miR‐138‐5p may represent an additional regulator of VIC transdifferentiation. The observed downregulation of miR‐138‐5p in CAVD tissues may be associated with hypoxia‐related regulatory mechanisms, as miR‐138‐5p has been identified as a hypoxia‐responsive miRNA in other pathological contexts [25].

A key finding of this study is the identification of SLC39A14 as a novel direct target of miR‐138‐5p and a functionally relevant molecule in the context of CAVD. SLC39A14, a zinc transporter previously linked to metabolic regulation and oxidative stress responses [26], was found to be upregulated in CAVD tissues and OM‐treated hAVICs and showed an inverse correlation with miR‐138‐5p expression. Dual‐luciferase reporter assays confirmed that miR‐138‐5p binds to the 3′ UTR of SLC39A14 and represses its expression, and functionally, SLC39A14 overexpression promoted calcification, whereas this effect was attenuated by miR‐138‐5p mimic transfection. These findings support SLC39A14 as a downstream target involved in miR‐138‐5p‐mediated regulation of calcification. While the role of SLC39A14 in zinc homeostasis has been well‐documented in hepatic and intestinal systems [27, 28], its contribution to VIC calcification has not been well characterized. SLC39A14 (ZIP14) belongs to the ZIP family of metal transporters that regulate intracellular zinc and manganese uptake, thereby influencing cellular metal homeostasis and redox balance. Zinc plays an important role in antioxidant defense and is known to modulate multiple redox‐sensitive signaling pathways, including the Nrf2 pathway. Alterations in intracellular zinc availability can influence oxidative stress responses by affecting the activity of metal‐dependent enzymes and redox‐sensitive transcription factors. Previous studies have shown that disturbances in metal homeostasis can influence oxidative stress responses, and a growing body of evidence supports bidirectional crosstalk between zinc homeostasis and NRF2 signaling [29, 30, 31, 32, 33, 34]. Recent work in vascular redox biology has further highlighted the close relationship between zinc‐dependent redox regulation and NRF2‐mediated antioxidant responses. In light of these observations, our findings raise the possibility that miR‐138‐5p may influence NRF2 activity in hAVICs, at least in part, through regulation of SLC39A14‐associated metal homeostasis; however, the precise molecular link remains to be established experimentally [35, 36].

Further mechanistic insight was obtained through investigation of the Nrf2 signaling pathway, a key regulator of cellular antioxidant responses [37, 38]. Our data showed that miR‐138‐5p enhanced Nrf2 nuclear translocation and increased expression of its downstream targets HO‐1 and NQO1 in OM‐induced hAVICs. In contrast, inhibition of miR‐138‐5p or overexpression of SLC39A14 was associated with reduced activation of Nrf2 signaling. Moreover, pharmacological inhibition of Nrf2 using ML385 significantly attenuated the anti‐calcification effects of miR‐138‐5p, supporting the involvement of Nrf2 activation in miR‐138‐5p‐mediated suppression of osteogenic differentiation. These findings are consistent with previous studies demonstrating that activation of the Nrf2 pathway can limit calcification in VICs and other vascular cell types [5, 39].

Taken together, the interplay between miR‐138‐5p, SLC39A14, and Nrf2 suggests a potential regulatory axis involved in CAVD‐related osteogenic differentiation. Reduced miR‐138‐5p expression under pathological conditions may relieve repression of SLC39A14, which in turn may contribute to altered cellular signaling associated with reduced Nrf2 activity. In addition, the restoration of miR‐138‐5p expression in our gain‐of‐function experiments partially counteracted these changes, supporting its regulatory role in this pathway. These findings complement existing knowledge of miRNA‐mediated regulation in CAVD, where miRNAs such as miR‐30b and miR‐204 also influence osteogenic signaling pathways [22]. Comparatively, other CAVD studies have identified additional pathways, such as the Wnt/β‐catenin axis, which drives osteogenesis in VICs and is modulated by miR‐29b [40]. Collectively, these findings highlight the complex and multifactorial nature of miRNA regulation in CAVD and suggest that multiple regulatory networks may converge to control VIC osteogenic differentiation.

This study has several limitations. First, all functional experiments were conducted in an osteogenic medium‐induced hAVIC model, which cannot fully recapitulate the complex cellular and inflammatory microenvironment of CAVD in vivo. Consequently, although our results support a regulatory relationship between miR‐138‐5p, SLC39A14, and Nrf2 signaling, the proposed mechanistic pathway remains to be validated in appropriate in vivo models and human tissue systems. Second, although our overexpression and cotransfection experiments support the functional involvement of SLC39A14 in miR‐138‐5p‐mediated regulation of calcification, direct genetic evidence demonstrating the requirement of SLC39A14 is still needed for validation. Reciprocal rescue experiments using SLC39A14 knockdown in the setting of miR‐138‐5p inhibition would further strengthen the causal interpretation. Third, although the involvement of Nrf2 signaling was supported by ML385 inhibition together with consistent changes in Nrf2 nuclear translocation and downstream target expression, additional validation using independent genetic approaches, such as Nrf2 knockdown, would provide stronger mechanistic specificity and help exclude potential off‐target effects of pharmacological inhibition. Fourth, the distribution and co‐localization of miR‐138‐5p, SLC39A14, and Nrf2 in human valve tissues were not examined in the current study. Lastly, the relatively small number of human valve specimens may limit the generalizability of our findings. Future studies are needed to validate these observations in relevant ex vivo and in vivo models, incorporate complementary genetic strategies to further define the roles of SLC39A14 and Nrf2, and assess the feasibility, stability, and safety of miR‐138‐5p‐based therapeutic approaches.

6. Conclusion

In conclusion, this study suggests that miR‐138‐5p inhibits VIC calcification, at least in part through regulation of SLC39A14 and activation of the Nrf2 pathway. These findings improve our understanding of the molecular mechanisms underlying CAVD and identify the miR‐138‐5p/SLC39A14/Nrf2 axis as a potential regulatory pathway involved in valvular calcification.

Author Contributions

Fei Yan: conceptualization, writing – review and editing, writing – original draft, methodology. Ying Zhao: data curation. Yuanyuan Wu: data curation. Dubiao Xian: data curation. Lei Shi: data curation. Yunheng Liang: formal analysis. Ning Wang: formal analysis. Ruiling He: formal analysis. Hongwang Cui: formal analysis. Zhihao Xie: formal analysis.

Ethics Statement

This study was approved by the Ethics Committee of First Affiliated Hospital of Hainan Medical University (Approval No. 2025‐KYL‐016) and conducted following the Declaration of Helsinki. Informed consent was obtained from all participants prior to tissue collection.

Consent

Informed consent was obtained from all participants before tissue collection.

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Figure S1: SLC39A14 suppresses Nrf2 activation through the Keap1–Nrf2 axis in a zinc‐associated manner. (A) Western blot analysis of the Nrf2 downstream antioxidant proteins HO‐1 and NQO1 in cells with SLC39A14 overexpression in the presence or absence of the zinc chelator TPEN. (B) Nuclear–cytoplasmic fractionation showing the effect of SLC39A14 overexpression on Nrf2 nuclear translocation. (C) Co‐immunoprecipitation (Co‐IP) analysis of the interaction between Keap1 and Nrf2. Data are presented as mean ± SD from three independent experiments. ***P < 0.001 vs. OE‐NC; ### P < 0.001 vs. OE‐SLC39A14.

JBT-40-e71034-s002.jpg (233.2KB, jpg)

Table S1: Baseline clinical characteristics of study participants.

JBT-40-e71034-s001.docx (12.7KB, docx)

Acknowledgments

This work was supported by the National Natural Science Foundation of China (Grant No. 82460074).

Data Availability Statement

The data can be obtained from the corresponding author upon a request.

References

  • 1. Kraler S., Blaser M. C., Aikawa E., Camici G. G., and Lüscher T. F., “Calcific Aortic Valve Disease: From Molecular and Cellular Mechanisms to Medical Therapy,” European Heart Journal 43, no. 7 (2022): 683–697. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Wang S. and Pu W. T., “Calcific Aortic Valve Disease: Turning Therapeutic Discovery Up a Notch,” Nature Reviews Cardiology 18, no. 5 (2021): 309–310. [DOI] [PubMed] [Google Scholar]
  • 3. Lindman B. R., Clavel M. A., Mathieu P., et al., “Calcific Aortic Stenosis,” Nature Reviews Disease Primers 2 (2016): 16006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Otto C. M., Newby D. E., and Hillis G. S., “Calcific Aortic Stenosis: A Review,” Journal of the American Medical Association 332, no. 23 (2024): 2014–2026. [DOI] [PubMed] [Google Scholar]
  • 5. Hutcheson J. D., Aikawa E., and Merryman W. D., “Potential Drug Targets for Calcific Aortic Valve Disease,” Nature Reviews Cardiology 11, no. 4 (2014): 218–231. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Moncla L. H. M., Briend M., Bossé Y., and Mathieu P., “Calcific Aortic Valve Disease: Mechanisms, Prevention and Treatment,” Nature Reviews Cardiology 20, no. 8 (2023): 546–559. [DOI] [PubMed] [Google Scholar]
  • 7. Osman L., Yacoub M. H., Latif N., Amrani M., and Chester A. H., “Role of Human Valve Interstitial Cells in Valve Calcification and Their Response to Atorvastatin,” supplement, Circulation 114, no. 1 Suppl (2006): 547–552. [DOI] [PubMed] [Google Scholar]
  • 8. Phua K., Chew N. W., Kong W. K., Tan R. S., Ye L., and Poh K. K., “The Mechanistic Pathways of Oxidative Stress in Aortic Stenosis and Clinical Implications,” Theranostics 12, no. 11 (2022): 5189–5203. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Gee T. W., Richards J. M., Mahmut A., and Butcher J. T., “Valve Endothelial‐Interstitial Interactions Drive Emergent Complex Calcific Lesion Formation In Vitro,” Biomaterials 269 (2021): 120669. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Lu T. X. and Rothenberg M. E., “MicroRNA,” Journal of Allergy and Clinical Immunology 141, no. 4 (2018): 1202–1207. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Lee S. C., Fang L., Wang C. H., Kahai S., Deng Z., and Yang B. B., “A Non‐Coding Transcript of Nephronectin Promotes Osteoblast Differentiation by Modulating MicroRNA Functions,” FEBS Letters 585, no. 16 (2011): 2610–2616. [DOI] [PubMed] [Google Scholar]
  • 12. Chen J., Lin Y., and Sun Z., “Inhibition of miR‐101‐3p Prevents Human Aortic Valve Interstitial Cell Calcification Through Regulation of CDH11/SOX9 Expression,” Molecular Medicine 29, no. 1 (2023): 24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Gu Y., Chen R., Song J., et al., “MiR‐21‐5p Promotes Osteogenic Differentiation and Calcification of Valvular Interstitial Cells by Targeting TGFBI in Calcific Aortic Valve Disease,” Iranian Journal of Public Health 53, no. 10 (2024): 2260–2270. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Nigam V., Sievers H. H., Jensen B. C., et al., “Altered MicroRNAs in Bicuspid Aortic Valve: A Comparison Between Stenotic and Insufficient Valves,” Journal of Heart Valve Disease 19, no. 4 (2010): 459–465. [PMC free article] [PubMed] [Google Scholar]
  • 15. Yan F., Huo Q., Zhang W., Wu T., Dilimulati D., and Shi L., “MiR‐138‐5p Targets RUNX2 to Inhibit Osteogenic Differentiation of Aortic Valve Interstitial Cells via Wnt/β‐catenin Signaling Pathway,” BMC Cardiovascular Disorders 22, no. 1 (2022): 24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Chi Q., Luan Y., Zhang Y., Hu X., and Li S., “The Regulatory Effects of miR‐138‐5p on Selenium Deficiency‐Induced Chondrocyte Apoptosis Are Mediated by Targeting SeLM,” Metallomics 11, no. 4 (2019): 845–857. [DOI] [PubMed] [Google Scholar]
  • 17. Ngo V. and Duennwald M. L., “Nrf2 and Oxidative Stress: A General Overview of Mechanisms and Implications in Human Disease,” Antioxidants 11, no. 12 (2022): 2345. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Loboda A., Damulewicz M., Pyza E., Jozkowicz A., and Dulak J., “Role of Nrf2/HO‐1 System in Development, Oxidative Stress Response and Diseases: An Evolutionarily Conserved Mechanism,” Cellular and Molecular Life Sciences 73, no. 17 (2016): 3221–3247. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Xiong J., Lin W., Yuan C., et al., “SIRT6‐mediated Runx2 Downregulation Inhibits Osteogenic Differentiation of Human Aortic Valve Interstitial Cells in Calcific Aortic Valve Disease,” European Journal of Pharmacology 968 (2024): 176423. [DOI] [PubMed] [Google Scholar]
  • 20. Shao X., Hu Z., Su H., Wang Y., and Lin Y., “Effects of Tension on Mitochondrial Autophagy and Osteogenic Differentiation of Periodontal Ligament Stem Cells,” Cell Proliferation 57, no. 3 (2024): e13561. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Chen J. H. and Simmons C. A., “Cell‐Matrix Interactions in the Pathobiology of Calcific Aortic Valve Disease: Critical Roles for Matricellular, Matricrine, and Matrix Mechanics Cues,” Circulation Research 108, no. 12 (2011): 1510–1524. [DOI] [PubMed] [Google Scholar]
  • 22. Wang Y., Chen S., Deng C., et al., “MicroRNA‐204 Targets Runx2 to Attenuate BMP‐2‐induced Osteoblast Differentiation of Human Aortic Valve Interstitial Cells,” Journal of Cardiovascular Pharmacology 66, no. 1 (2015): 63–71. [DOI] [PubMed] [Google Scholar]
  • 23. Zhou X., Xu S. N., Yuan S. T., et al., “Multiple Functions of Autophagy in Vascular Calcification,” Cell and Bioscience 11, no. 1 (2021): 159. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Zheng R., Zhu P., Gu J., et al., “Transcription Factor Sp2 Promotes TGFB‐Mediated Interstitial Cell Osteogenic Differentiation in Bicuspid Aortic Valves Through a SMAD‐Dependent Pathway,” Experimental Cell Research 411, no. 1 (2022): 112972. [DOI] [PubMed] [Google Scholar]
  • 25. Sawai S., Wong P. F., and Ramasamy T. S., “Hypoxia‐Regulated Micrornas: The Molecular Drivers of Tumor Progression,” Critical Reviews in Biochemistry and Molecular Biology 57, no. 4 (2022): 351–376. [DOI] [PubMed] [Google Scholar]
  • 26. Jenkitkasemwong S., Wang C. Y., Coffey R., et al., “SLC39A14 Is Required for the Development of Hepatocellular Iron Overload in Murine Models of Hereditary Hemochromatosis,” Cell Metabolism 22, no. 1 (2015): 138–150. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Jimenez‐Rondan F. R., Ruggiero C. H., Riva A., et al., “Deletion of Metal Transporter Zip14 Reduces Major Histocompatibility Complex II Expression in Murine Small Intestinal Epithelial Cells,” Proceedings of the National Academy of Sciences 122, no. 1 (2025): e2422321121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Gong Y., You Q., Yuan X., et al., “Mesenchymal Stem Cell‐Derived Extracellular Vesicles Attenuate Ferroptosis in Aged Hepatic Ischemia/Reperfusion Injury by Transferring Mir‐1275,” Redox Biology 81 (2025): 103556. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Xin Y., Gao H., Wang J., et al., “Manganese Transporter Slc39a14 Deficiency Revealed Its Key Role in Maintaining Manganese Homeostasis in Mice,” Cell Discovery 3 (2017): 17025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Deng Z., Zeng W., Gao Y., et al., “Mesenchymal Stem Cells Prevent SLC39A14‐Dependent Hepatocyte Ferroptosis Through Exosomal miR‐16‐5p in Liver Graft,” Advanced Science 12, no. 6 (2025): e2411380. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Yu Y., Jiang L., Wang H., et al., “Hepatic Transferrin Plays a Role in Systemic Iron Homeostasis and Liver Ferroptosis,” Blood 136, no. 6 (2020): 726–739. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Aydemir T. B., Sitren H. S., and Cousins R. J., “The Zinc Transporter Zip14 Influences C‐Met Phosphorylation and Hepatocyte Proliferation During Liver Regeneration in Mice,” Gastroenterology 142, no. 7 (2012): 1536–1546.e5 e1535. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Mitchell S. B., Thorn T. L., Lee M. T., et al., “Metal Transporter SLC39A14/ZIP14 Modulates Regulation Between the Gut Microbiome and Host Metabolism,” American Journal of Physiology‐Gastrointestinal and Liver Physiology 325, no. 6 (2023): G593–G607. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Thorsen K., Mansilla F., Schepeler T., et al., “Alternative Splicing of SLC39A14 in Colorectal Cancer Is Regulated by the Wnt Pathway,” Molecular and Cellular Proteomics 10, no. 1 (2011): M110 002998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Yang F., Smith M. J., Siow R. C. M., Aarsland D., Maret W., and Mann G. E., “Interactions Between Zinc and NRF2 in Vascular Redox Signalling,” Biochemical Society Transactions 52, no. 1 (2024): 269–278. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Smith M. J., Yang F., Griffiths A., et al., “Redox and Metal Profiles in Human Coronary Endothelial and Smooth Muscle Cells under Hyperoxia, Physiological Normoxia and Hypoxia: Effects of NRF2 Signaling on Intracellular Zinc,” Redox Biology 62 (2023): 102712. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Zhao X., Tian Z., Sun M., and Dong D., “Nrf2: a Dark Horse in Doxorubicin‐Induced Cardiotoxicity,” Cell Death Discovery 9, no. 1 (2023): 261. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Kondratenko N. D., Zinovkina L. A., and Zinovkin R. A., “Transcription Factor NRF2 in Endothelial Functions,” Molekuliarnaia Biologiia (Moskva) 57, no. 6 (2023): 1058–1076. [DOI] [PubMed] [Google Scholar]
  • 39. Greenberg H. Z. E., Zhao G., Shah A. M., and Zhang M., “Role of Oxidative Stress in Calcific Aortic Valve Disease and Its Therapeutic Implications,” Cardiovascular Research 118, no. 6 (2022): 1433–1451. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Fang M., Li B., Li X., Wang Y., and Zhuang Y., “MicroRNA‐29b Regulates Pyroptosis Involving Calcific Aortic Valve Disease Through the STAT3/SOCS1 Pathway,” International Journal of Cardiology 371 (2023): 319–328. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1: SLC39A14 suppresses Nrf2 activation through the Keap1–Nrf2 axis in a zinc‐associated manner. (A) Western blot analysis of the Nrf2 downstream antioxidant proteins HO‐1 and NQO1 in cells with SLC39A14 overexpression in the presence or absence of the zinc chelator TPEN. (B) Nuclear–cytoplasmic fractionation showing the effect of SLC39A14 overexpression on Nrf2 nuclear translocation. (C) Co‐immunoprecipitation (Co‐IP) analysis of the interaction between Keap1 and Nrf2. Data are presented as mean ± SD from three independent experiments. ***P < 0.001 vs. OE‐NC; ### P < 0.001 vs. OE‐SLC39A14.

JBT-40-e71034-s002.jpg (233.2KB, jpg)

Table S1: Baseline clinical characteristics of study participants.

JBT-40-e71034-s001.docx (12.7KB, docx)

Data Availability Statement

The data can be obtained from the corresponding author upon a request.

Articles from Journal of Biochemical and Molecular Toxicology are provided here courtesy of Wiley

RESOURCES