A Korean native halophyte extract attenuates the virulence of methicillin-resistant Staphylococcus aureus by inhibiting biofilm formation

Abstract

Since the COVID-19 outbreak, global attention toward infectious diseases has intensified, and many experts anticipate that the next pandemic may stem from multidrug-resistant (MDR) bacteria, often termed “Superbugs”. Among them, methicillin-resistant Staphylococcus aureus (MRSA) represents one of the most widespread MDR bacterium responsible for severe nosocomial infections. As the emergence of new resistant strains accelerates due to overuse and misuse of antibiotics, development of anti-pathogenic therapeutics has gained significant interest. In this study, we explored the anti-biofilm activity of Artemisia fukudo (Af), a halophyte abundant in bioactive metabolites. The n-butanol (n-BuOH) fraction of Af markedly inhibited MRSA biofilm formation, independent of bacterial growth inhibition or biofilm degradation. Transcriptional profiling by qRT-PCR revealed that expression of adhesion-related genes was notably downregulated. In A549 cell line infection assay, Af n-BuOH fraction treatment significantly reduced MRSA attachment and internalization. Furthermore, in a Caenorhabditis elegans infection model, Af n-BuOH fraction exposure extended host life-span, suggesting attenuation of bacterial virulence. Taken together, our findings demonstrate that Af-derived compounds interfere with initial adhesion process crucial for MRSA biofilm development and host colonization. This study highlights the therapeutic potential of halophyte-derived natural products as promising anti-virulence alternatives to conventional antibiotics for controlling infections caused by multidrug-resistant pathogens.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-026-53460-0.

Introduction

Between 2000 and 2010, global antibiotic consumption increased by more than 50%, and during the coronavirus disease 2019 (COVID-19) pandemic the usage of antibiotics increased dramatically^1,2. Antibiotics have made mankind safer from bacterial infections, and played a pivotal role in major advances in medicine and surgery³. However, the problem of antibiotic resistance due to misusage and over-usage of antibiotics is an emerging problem. Multidrug resistance (MDR) pathogens, also known as antimicrobial resistance (AMR) pathogens, are a global problem in which bacteria become resistant to multiple types of antibiotics. Such bacteria have developed resistance strategies, including mutations altering target proteins, enzymatic drug inactivation, bypassing target pathways, and expelling the drug via efflux pumps⁴. If current trends continue and antimicrobial resistance is not effectively tackled, it is predicted that by 2050, there will be 10 million deaths per year and a cumulative loss of 100 trillion USD in global gross domestic product (GDP) caused by this problem^5,6. Therefore, the World Health Organization (WHO) has compiled a list of priority bacterial pathogens ranked according to the urgency of developing new antibiotics, driven by the need to control and monitor these MDR strains. This list includes several pathogens responsible for nosocomial infections, such as those in the ESKAPE (Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species) pathogen group^7–9. Therefore, the development of new antibiotics or new alternatives to replace antibiotics in the treatment of MDRs is essential.

Methicillin-resistant Staphylococcus aureus (MRSA) is a gram-positive, facultative anaerobic bacteria that mainly causes nosocomial infections. MRSA is listed at WHO priority level 2 (High) and can be resistant to the β-lactam antibiotics group as well as the aminoglycosides, fluoroquinolones, macrolides, tetracycline, and chloramphenicol groups¹⁰. It mainly causes wound infection, pneumonia, blood stream infection, and sepsis, resulting in more than 100,000 deaths worldwide in 2019 ¹¹. MRSA has long been treated with vancomycin, but with the emergence of vancomycin-resistant Staphylococcus aureus (VRSA) strains, new treatments are needed^12,13.

Many studies have been conducted to discover new antibiotics or modify conventional antibiotics to control MDR strains. However, traditional antibiotics act as selective pressure on bacteria, leading to the development of resistance as bacteria adapt¹⁴. Therefore, one of the emerging therapeutic strategies, anti-virulence therapy, aims to control bacterial virulence factors rather than directly killing the bacteria. This approach is expected to result in lower resistance development^15,16.

Biofilms consist of a community of microorganisms that irreversibly attach to a surface, a process mainly driven by exopolysaccharides. Biofilm formation helps the colonization of bacteria to novel sites, increases their pathogenicity, and resistance to environmental stress^17,18. Additionally, biofilm formation is one of the antibiotic resistance mechanisms of MDR strains. Biofilms play a key role in antibiotic resistance by physically delaying the diffusion of antibiotics, and thereby reducing direct contact with the bacterial cells^19,20. Additionally, quorum sensing within the biofilm enhances the expression of antibiotic resistance genes, and increased cell-to-cell contact within the biofilm, promoting horizontal gene transfer of resistance genes²¹.

Biofilm formation is generally proceeds through three major stages; attachment, maturation, and dispersion. Each of these stages is regulated by the expression of multiple genes involved in surface adhesion, extracellular matrix production, and cell detachment. In case of S. aureus, including MRSA, biofilm formation is mainly divided into ica-dependent and ica-independent pathways²². The ica-dependent pathway involves the ica operon (icaADBC), which directs the synthesis of polysaccharide intercellular adhesin (PIA) required for biofilm accumulation and maturation. In contrast, the ica-independent pathway relies primarily on surface adhesins such as fibronectin-binding protein A (fnbA) and fibrinogen-binding protein (fib), which facilitate the initial attachment of bacterial cells to biotic and abiotic surfaces.

Resistance to environmental stress and antibiotic resistance caused by biofilms make treatment difficult and cause chronic infections. Due to this problem, many studies are being conducted to discover new substances to solve the problem of biofilm formation^23–26. Halophytes, which grow near the coast, have been described to contain many antioxidants to resist oxidative stress caused by the seawater. Previous studies have demonstrated that halophyte-derived compounds, including phenolic compound, flavonoids, terpenoids, and sulfated polysaccharides, exhibit strong antioxidant and anticancer activities^27–30. Although these properties are predicted to be highly likely to contain novel substances, research on controlling MDR bacteria using halophytes is lacking. This study demonstrates the potential of extracts obtained from native halophytes as novel therapeutic agents for controlling MDR bacteria by reducing pathogenicity through the inhibition of biofilm formation by MRSA.

Materials and methods

Collection, and distribution information of halophyte

Artemisia fukudo Makino (Af) used in this study was collected from Boseong-gun, Jeollanam-do, Republic of Korea (34° 49′ 57.60′′ N, 127° 21′ 48.50′′ E). This species is a non-protected plant that is not designated as an endangered or nationally protected species (https://www.nie.re.kr/nie/pgm/edSpecies/list.do? menuNo=200121). According to the Ministry of Agriculture, Food and Rural Affairs Ordinance No. 714, Enforcement Rule of the Act on the Creation and Management of Forest Resources, the collection of non-protected plant species for research purposes does not require special permits. Based on this regulation, plant materials were collected without additional permissions. Distribution of this plant material is available through the Natural Product Central Bank of Korea (deposit numbers NCB027-096 to NCB027-098; https://www.bioone.re.kr/npcb/uss/search.do? searchWrd=Artemisia%20fukudo).

Extraction and fractionation of halophyte

The whole plant material was air-dried at room temperature in a shaded area until completely dried and then finely powdered. Dried Af was extracted twice with dichloromethane (CH₂Cl) and methanol (MeOH) for 24 h, respectively. Each extract was desalted, and two extracts were mixed to make a crude extract (CE). CE was fractionated with CH₂Cl₂ and water, and the aqueous layers were further fractionated into n-butanol (n-BuOH) and water, and the organic layers were also fractionated into n-hexane (n-Hex) and 85% aqueous MeOH (85% aq. MeOH)³¹. All CEs and fractions were completely dried by rotary evaporator, then dissolved in absolute dimethyl sulfoxide (DMSO) at 100 mg/ml concentration with through mixing and sonication and stock solutions were storage at 4 °C.

Bacterial strain and culture conditions

For this study mainly clinical blood isolated methicillin-resistant Staphylococcus aureus (MRSA) S1 was used, and S. aureus ATCC25923 was used as a standard strain. Staphylococcus epidermidis BF14 was used for the Congo-red agar plate assay, and Escherichia coli OP50 was used as food source in the Caenorhabditis elegans model. MRSA and S. epidermidis BF14 were cultured on Tryptic Soy Broth (TSB) or supplemented with 1.5% agar. E. coli OP50 was cultured on Luria-Bertani (LB) broth or supplemented with 1.5% agar. All strains were cultured at 37 °C for 18 h.

Caenorhabditis elegans strain and culture condition

The C. elegans N2 strain (wild-type) and the AU37 strain (glp-4(bn2) I; sek-1(km4) X) were obtained from the Caenorhabditis Genetics Center (CGC) and used in this experiment. All strains were routinely maintained according to previously described method using nematode growth medium (NGM) plates, supplemented with streptomycin (100 µg/ml) and nystatin (50 units/ml), and seeded with E. coli OP50 as a food source³². Before each experiment, synchronization of worms was conducted using standard protocol³³. Briefly, gravid adult worms, which obtain embryos, were harvested, and the embryos were isolated via bleach-NaOH lysis buffer treatment. Embryos were rinsed 5 to 6 times to remove bleach-NaOH lysis buffer and incubated in 5 ml of M9 buffer using Roto-Mini Plus (Gilson, USA). After overnight incubation, L1 stage worms were harvested and fed E. coli OP50 or inactivated E. coli OP50 until they reached the L4 stage and were used in the experiments.

Biofilm assay

Biofilm formation was quantitatively detected via crystal violet (CV) staining³⁴. Pre-cultured MRSA and S. aureus ATCC25923 were inoculated into TSB supplemented with 1% glucose, and 500 µl of inoculated broth was aliquoted into 5 ml round bottom polystyrene tubes (Corning, USA). Halophyte CEs and fractions were inoculated at 1 mg/ml concentration and cultured for 24 h under aerobic conditions (37 °C, 200 rpm). The minimal biofilm inhibition concentration was evaluated via a 2-fold serial dilution method. After incubation, 200 µl of each cultured media were transferred into 96-well cell culture plate (SPL, Korea), and the growth of bacteria was measured at an optical density (OD) of 600 nm wavelength. Additionally, the polystyrene tubes were washed three times, and biofilm was stained with 600 µl of 0.1% crystal violet (Sigma, USA) for 20 min, and washed with distilled water. The CV staining the biofilm was dissolved in a 30% acetic acid solution, 200 µl of each solution were transferred to a 96-well cell culture plate and measured at an OD of 550 nm wavelength. OD values were measured using Epoch2 Microplate Spectrophotometer (BioTek, USA). DMSO and LB broth were used as negative and positive control, respectively.

Viable count and biofilm degradation assay

Cultivation of MRSA, and evaluation of biofilm formation were conducted as described in the Biofilm assay section³⁴. The experiment was conducted at two time points (24, 48 h), three polystyrene tubes were washed with phosphate-buffered saline (PBS) and 500 ml of PBS supplemented with 250 µg/ml Af n-BuOH was aliquoted into each tube after 24 h incubation. The Viable count was detected by colony forming units (CFUs) counting. At each time point, cultured media were diluted 10-fold and spotting on TSA. Spotted TSAs were incubated at 37 °C until colony forming.

Transmission electron microscopy (TEM)

This experiment was conducted based on a previous study³⁵. To prepare samples, precultured MRSA was inoculated at a 1% concentration into 2 ml of TSB supplemented with 1% glucose and cultured at 37 °C for 24 h without shaking. After incubation, supernatant was removed, and the remaining bacteria pellet was resuspended until the OD value reached 0.5 at a wavelength of 600 nm. Then, 1 ml of bacteria cells were harvested by centrifugation at 2,000 rpm for 2 min. The supernatant was discarded, and the pellet was resuspended in 1 ml PBS buffer by tapping. 50 µl of the bacterial suspension were dropped onto parafilm, and a 200 Mesh Formvar/Carbon Copper Grid (Electron Microscopy Sciences, USA) was placed on top for 10 min. Excess bacterial suspension was removed using filter paper, followed by washing with 50 µl of PBS buffer. The grid was stained with 50 µl of 2% phosphotungstic acid (PTA) for 2 s, and excess liquid was absorbed with filter paper directly. The grid was placed into a microtube, dried at room temperature, and observed using HT7800 Transmission Electron Microscope (Hitachi, Japan) operated at 120 kV. 500 µg/ml Af n-BuOH was used, and a non-treated group was used as negative control.

Extraction of mRNA & quantitative reverse transcription polymerase chain reaction

Af n-BuOH was added to TSB supplemented with 1% glucose at a concentration of 500 µg/ml, and groups treated with the same volume of DMSO and a non-treated group were used as negative controls. MRSA was growth for 24 h under aerobic condition (37 °C, 200 rpm). mRNA extraction was performed using the AccuPrep^® Bacterial RNA Extraction Kit (Bioneer, Korea) by following the manufactures protocol, and DNA was eliminated using the TURBO DNA-free™ Kit (Invitrogen, USA). Concentration and purity of mRNA samples were measured using a Epoch2 Microplate Spectrophotometer and a Take3 Micro-Volume Plate (BioTek, Korea). Primers used in this study are listed on Table 1, and qRT-PCR was performed using the 2X OneStep qRT-PCR Master Mix (BioFACT, Korea). The expression level of target genes (icaA, icaC, icaD, fnbA, and fib) was analyzed using the QuantStudio 1 Real-Time PCR system (Applied Biosystems, USA), and normalized to the endogenous gene encoding 16 S rRNA. Primer specificity was evaluated through melting curves, and the relative expression of target genes was calculated using the 2^−ΔΔCT method³⁵.

Table 1.

Primers used in this study.

Primer	Sequence (5′− 3′)	Accession numbers	Amplicon size (bp)
16 S Forward	GAGTACGACCGCAAGGTTGA	NR_118997.2	170
16 S Reverse	TGCACCACCTGTCACTTTGT
icaA Forward	GAGGTAAAGCCAACGCACTC	AF086783	151
icaA Reverse	CCTGTAACCGCACCAAGTTT
icaD Forward	ACCCAACGCTAAAATCATCG	AF086783	211
icaD Reverse	GCGAAAATGCCCATAGTTTC
icaC Forward	TCCTATTAGGTCAATGGTATGGCT	AF086783	183
icaC Reverse	CGGTATCGTGAAACGCTGTG
fnbA Forward	TTGGGAGCAGCATCAGTATTCTT	X95848.1	155
fnbA Reverse	AGTTGTAGTTGTTTGTGTTTCGCTT
fib Forward	CGTCAACAGCAGATGCGAG	X72014.1	239
fib Reverse	TGCATCAGTTTTCGCTGCTG

MTT (3-[4,5-dimethylthiazol-2-yl]-2,5 diphenyl tetrazolium bromide) assay

This experiment was conducted with slight modifications based on a previous study³¹. A549 (ATCC CCL-185) human lung cancer cells were used in this assay. Cell viability was confirmed using the Cell Proliferation Kit I (Roche, Switzerland), and following the manufactures protocol. Cells were cultured in RPMI 1640 (Gibco, USA) supplemented with 10% fetal bovine serum (Gibco, USA), and 100 units/ml Pen-Strep (Gibco, USA) at 37 °C, 5% CO₂. A549 cells were seeded in a 96-well cell culture plate at a concentration of 1.87 × 10⁴ cells per well. After the cells attached to the surface, the supernatant was removed, and the cells were washed gently three times with PBS. Af n-BuOH was serially diluted 2-fold using cell culture medium, and 100 µl of medium were aliquoted into each well before cultivation for 24 h. Subsequently, 10 µl of MTT labeling reagent at a concentration of 0.5 mg/ml were treated to the wells, followed by incubation for 4 hours in a humidified atmosphere. After this incubation period, 100 µl of solubilization buffer was added into each well and the plate was kept in humidified atmosphere overnight. Purple formazan crystal generated from active metabolism was detected at a wavelength of 550 nm. A group containing only culture medium without cells was used as a negative control.

Invasion & adhesion assay

The A549 cell line was used in these assays. Cells were cultured in RPMI 1640 (Gibco, USA) supplemented with 10% heat-inactivated fetal bovine serum (Gibco, USA), and 100 units/ml Pen-Strep (Gibco, USA) at 37 °C and 5% CO₂. A549 cells were seeded in a 24-well plate with 1.5 × 10⁵ cells per well, and cultured for 24 h. The cultured cells were washed 3 times with PBS, and MRSA was infected at the multiplicity of infection (MOI) 1 and 10 for 2 h. For the adhesion assay, cells were washed three times with PBS, and each well was treated with 1 ml of 1% Triton X-100 for 30 min to lyse the cells. For the invasion assay, cells were washed 3 times with PBS, and vancomycin (100 µg/ml) was treated to eliminate extracellular bacteria. After 30 min, 1 ml of 1% Triton X-100 was added to each well, and incubated for 30 min to lyse the cells. The lysates were 10-fold diluted, and 50 µl of each lysate was spotted onto TSA. Spotted TSAs were incubated at 37 °C until colony forming³⁵.

C. elegans life span assay

The C. elegans N2 strain was used in this experiment. The C. elegans N2 strain was routinely maintained and bleached before the experiment as described in 2.4. NGM plates were supplemented with concentrations of 200, 100, 50, 25, 10 µg/ml, respectively. E. coli OP50 was seeded on NGM plate as a food source. L1 stage worms were resuspended in S-complete medium to a concentration of 80–100 worms/ml. Carbenicillin and Amphotericin B were added to a final concentration of 50 µg/ml and 0.1 µg/ml, respectively. A total of 120 µl S-complete medium containing worms were dispensed into a 96-well cell culture plate and incubated until the worms reached the L4 stage. L4 stage worms were treated with 30 µl of 0.6 mM 5’-fluorodeoxyuridine (FUDR) for sterilization, and 5 µl of 2 × 10¹⁰ CFU/ml E. coli OP50 were added once a week. Observations were conducted daily using the Stemi 305 stereo microscope (ZEISS, German), and living worms were counted based on their movement³⁶.

C. elegans colonization assay

The colonization assay was conducted according to a previously described method³⁷. The C. elegans AU37 strain was cultured as described above. NGM plates were seeded with 200 µl of MRSA and incubated at 37 °C for 24 h without or under supplementation of 200 µg/ml Af n-BuOH. Groups non-treated or supplemented with same volume of DMSO were used as control. A total of 50 L4 stage worms were transferred to each plate, and 10 worms were collected after 72 h. The collected worms were transferred to Brain-heart infusion (BHI) agar supplemented with streptomycin (100 µg/ml), and kanamycin (100 µg/ml), and exposed to 10 µl of gentamycin (25 µg/ml) for 5 min to eliminate external bacteria. The worms were then picked into M9 buffer using a platinum wire and washed three times with M9 buffer at 1000 rpm for 1 min. 1 ml of M9 buffer containing 1% Triton X-100 was added, and the worms were homogenized using the Power Masher II (Nippi, Japan). The homogenized solution was serially diluted 10-fold and spotted on TSA to quantify the viable bacterial count.

C. elegans infection assay

C. elegans AU37 was used in this experiment and cultured as described above. L4 stage worms were transferred to NGM plates seeded with MRSA or E. coli OP50. Af n-BuOH was added to the NGM plates at a concentration of 200 µg/ml, and groups non-treated or supplemented with the same volume of DMSO were used as control. A E. coli OP50 group was used as a non-infected control. Approximately 120 C. elegans worms were transferred to four plates (30 ± 5 worms per plate), and observed every 24 h. The Stemi 305 stereo microscope (ZEISS, German) was used to observe the worms, and dead worms were counted. Worms that exhibited no movement were gently touched with a platinum wire to induce a response. If no response was observed from the worm, it was considered dead and subsequently removed.

Statistical analysis

All statistical analyses were performed using GraphPad Prism 9.0 (GraphPad, USA). All in vitro assays were conducted at least in triplicates and analyzed using one-way ANOVA, two-way ANOVA, or Welch’s t-test. The life span of C. elegans and the infection assay were compared using a log-rank (Mantel-Cox) test, with individual comparisons made between respective groups. Statistical significance was indicated by asterisks. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

Results

Anti-biofilm activity of Artemisia fukudo Makino (Af) extract against MRSA

A total of 21 crude extract (CE) of different halophytes were tested, and Artemisia fukudo Makino (Af) CE reduced biofilm formation of MRSA by approximately 39%, without inhibiting bacterial growth (Fig. 1A, B). Additionally, none of the Af fractions showed an effect on growth of MRSA, and the n-BuOH fraction possessed a biofilm inhibition activity of approximately 67% compared to the DMSO control (Fig. 1C, D, G).

Fig. 1.

Anti-biofilm activity of halophyte extract and fraction against MRSA. (A,B) Growth and crystal violet (CV) staining results by 1 mg/ml concentration Af crude extract (CE) treatment. (C,D) Growth and CV stain results after treatment with 1 mg/ml concentration of each fraction. (E,F) Identification of minimum-biofilm inhibitory concentration. (G,H) Representative image of CV staining results. All experiments were biological triplicated and analyzed by one-way ANOVA. Error bars represent the standard deviation. Significance levels are denoted as follows: **p < 0.01.

To evaluate the anti-biofilm activity of the Af n-BuOH fraction, the minimal biofilm inhibition concentration was detected. As shown in Fig. 1E, Af n-BuOH did not inhibit the growth of MRSA, but significantly reduced the biofilm formation until a concentration of 125 µg/ml (Fig. 1F, H). The Biofilm formation ability of MRSA was restored at a Af n-BuOH concentration of 62.5 µg/ml, which indicates that the Af n-BuOH fraction has an anti-biofilm activity for concentrations above 125 µg/ml.

Consistent with these findings, we further investigated the effect of Af n-BuOH on biofilm formation in a standard strain. Af n-BuOH treatment significantly reduced biofilm without significant inhibition the growth of S. aureus ATCC25923 (Supplementary Fig. S2).

Evaluation of bactericidal and biofilm degradation activity of Af n-BuOH fraction

To confirm whether the decrease of biofilm formation observed for the Af n-BuOH fraction was achieved by degradation of the biofilm or a decrease in number of viable bacteria, viable count and biofilm degradation assays were conducted. After 24 h of cultivation the number of viable bacteria was not significantly decreased compared to the control group, when treated with Af n-BuOH (Fig. 2A). After 48 h of cultivation the number of viable bacteria treated with Af n-BuOH was not decreased compared to the non-treated group, but slightly decreased compared to the DMSO treated control (Fig. 2B). In the biofilm degradation assay, bacteria were removed from the well and the remaining biofilm was treated with the Af n-BuOH fraction. In the group treated with Af n-BuOH simultaneously during cultivation, biofilm was decreased compared to the control after 24 and 48 h of cultivation, respectively. However, in the post-treated group where the remaining biofilm was treated with the Af n-BuOH fraction, the existing biofilm was not degradated (Fig. 2C). These results indicate that the anti-biofilm activity of the Af n-BuOH fraction is due to inhibition of biofilm formation by MRSA and not due to reduced bacteria numbers or biofilm degradation.

Fig. 2.

(A,B) Viable count results after culture for 24 and 48 h. (C) Biofilm degradation assay result. All experiments were performed for biological triplicates and analyzed by one-way ANOVA. Error bars represent the standard deviation. Significance levels are denoted as follows: ns, not significant (p > 0.05); *p < 0.05, **p < 0.01, ****p < 0.0001.

Af n-BuOH reduced biofilm via disruption of MRSA attachment

During the biofilm assay, differences in MRSA morphology were observed when MRSA treated with the Af n-BuOH fraction settled and grew in liquid culture. Even though the culture conditions were aerobic, the number of planktonic bacteria decreased exponentially compared to the non-treated or DMSO treated control group (Fig. 3A). To confirm the difference in biofilm formation, TEM was used to observe the morphology. Observation through TEM revealed different morphologies of the biofilm of MRSA when treated with the Af n-BuOH fraction (Fig. 3B).

Fig. 3.

Observation of morphological differences in MRSA. (A) Morphologically difference of MRSA in planktonic culture condition. (B,C) TEM images of non-treated and Af n-BuOH treated MRSA, respectively. Red arrow indicated different morphologies of MRSA. Scale bar: 50 nm.

To determine whether these morphological differences affect extracellular polymeric substances (EPS) production or cell attachment, quantitative real-time PCR was conducted to detect the effect of the Af n-BuOH fraction on biofilm formation related genes of MRSA at the transcriptional level. The expression levels of icaA, icaD, and icaC genes, which are involved in EPS production of MRSA, did not show any differences after treatment with the Af n-BuOH fraction (Fig. 4). Additionally, there were no differences observed regarding the colony pigment or morphology in the Congo-red agar plate assay (see Supplementary Fig. S1 online). Contrary, fnbA and fib genes, which are associated with bacterial adhesion to surfaces, were downregulated by 11.36-fold and 4.57-fold, respectively.

Fig. 4.

Relative gene expression of biofilm formation-related genes. All experiments were performed for biological triplicates and analyzed by one-way ANOVA. Error bars represent the standard deviation. Significance levels are denoted as follows: ****p < 0.001.

Evaluation of the cytotoxicity of Af n-BuOH fraction

The cytotoxicity of the Af n-BuOH fraction was evaluated both in vitro using the human lung cancer cell line A549 and in vivo using the Caenorhabditis elegans N2 model. In the MTT assay, the Af n-BuOH fraction showed viability rate of more than 80% at all concentration, including the high-dose concentration of 1000 µg/ml (Fig. 5A). Similarly, in the C. elegans model, supplementation of the Af n-BuOH fraction at various concentrations (10–200 µg/ml) did not reduce viability (Fig. 5B). Notably, instead of showing cytotoxicity, treatment with the Af n-BuOH fraction significantly extended the lifespan of the worms compared to the control group. These results indicate that the Af n-BuOH fraction exhibits no cytotoxicity and may even bring beneficial effects to the host.

Fig. 5.

Evaluation of the cytotoxicity of Af n-BuOH fraction. (A) Result of the MTT assay using the A549 cell line. (B) Toxicity assessment results using the C. elegans model. Comparisons made between control group and analyzed by a log-rank (Mantel-Cox) test, and E. coli OP50-fed group was used as a control. For survival assay, n ≥ 120 worms per group were used Error bars represent the standard deviation. Significance levels are denoted as follows: ***p < 0.001. ****p < 0.0001.

Verification of reduced adhesion capacity

In the qRT-PCR results, we found that Af n-BuOH treatment reduced the mRNA level of fib and fnbA genes, which are associated with adhesion of MRSA. Therefore, we further examined whether this adhesion inhibitory activity of the Af n-BuOH fraction could also be observed in the A549 cell line and the C. elegans model. In the invasion & adhesion assay, the Af n-BuOH fraction suppressed bacterial adhesion and invasion. At MOI 1, adhesion was significantly reduced by approximately 75%, while invasion was reduced by approximately 98% (Fig. 6A). At MOI 10, invasion was significantly reduced approximately 93% (Fig. 6B). Adhesion was reduced approximately 57%, but did not show a significant difference compared to the control. The in vivo anti-biofilm efficacy of Af n-BuOH was further evaluated using a C. elegans colonization assay. Worms treated with Af n-BuOH exhibited a reduced MRSA intestinal load, with 3.25 × 10⁴ CFU per worm compared to 7.00 × 10⁴ CFU per worm in the control group. This corresponds to an approximately 53% reduction in MRSA colonization, indicating that Af n-BuOH effectively inhibits in vivo adherence of MRSA within the host intestinal environment (Fig. 6B). Therefore, it can be assumed that the number of MRSA colonizing the intestine of C. elegans was reduced due to a reduced adhesion ability of MRSA after treatment with the Af n-BuOH fraction.

Fig. 6.

Verification of reduced adhesive strength due to Af n-BuOH treatment in vitro and in vivo. (A) Invasion and adhesion assays performed at a MOI of 1. (B) Invasion and adhesion assays performed at a MOI of 10. (C) Verification of reduced adhesion capacity of MRSA in the intestine of C. elegans. Error bars represent the standard deviation. Differences between groups were evaluated using Welch’s t-test. Significance levels are denoted as follows: ns, not significant (p > 0.05); **p < 0.01.

Survivability of Caenorhabditis elegans model against MRSA

An infection assay was conducted to evaluate whether the Af n-BuOH treatment, which reduced MRSA adhesion, also diminished MRSA pathogenicity in an in vivo model. Results showed no significant difference within the E. coli OP50 fed group. Compared to the E. coli OP50-fed control groups, all MRSA infected C. elegans groups showed a significantly shorter life-span. However, it was observed that the treatment with Af n-BuOH significantly extended the life-span of MRSA infected C. elegans compared to the non-treated and DMSO treated control group (Fig. 7A).

Fig. 7.

Survivability of C. elegans model against MRSA. (A) Lifespan variation of C. elegans during MRSA infection. (B–G) Representative image of C. elegans infected by prey bacteria MRSA and E. coli OP50. The MRSA infected C. elegans appear ‘ghosts’ in the bacterial lawn, because the internal cellular ultrastructure was lost (red arrow), and also abnormal intestinal morphology was observed (blue arrow). Comparisons made between each non-treated group and analyzed by a log-rank (Mantel-Cox) test. For infection assay, n ≥ 120 worms per group were used. Significance levels are denoted as follows: ns, not significant (p > 0.05); ****p < 0.0001. Scale bar: 300 μm.

Additionally, in the groups fed with MRSA, organ necrosis and prolapse were observed in both DMSO treated and non-treated groups (Fig. 7E, F). However, organ necrosis and prolapse of C. elegans were alleviated in the Af n-BuOH treated group (Fig. 7G). These findings confirm that the Af n-BuOH fraction attenuates the pathogenicity of MRSA.

Discussion

Antibiotic resistance has rapidly emerged as a global problem, and the WHO has categorized antibiotic-resistant bacteria as a priority for which new antibiotic development is urgently needed³⁸. However, antibiotics themselves exert selective pressures that accelerate the development of resistance³⁹. Recently, instead of using antibiotics, phage therapy, anti-virulence strategies, probiotics and others have emerged as novel approaches to control these antibiotic-resistant bacteria^40–42. In this context, this study focused on the anti-virulence effects of halophyte extract, aiming to control the formation of biofilms, a virulence factor of MRSA that contributes not only to pathogenicity but also to antibiotic resistance.

Previous studies have highlighted the potential of plant-derived compounds as anti-biofilm agents against MRSA^43–46. Consistent with these findings, we demonstrated that the n-BuOH fraction of Artemisia fukudo Makino (Af n-BuOH) has an anti-biofilm activity against MRSA (Fig. 2D), and inhibits biofilm formation at a minimal concentration of 125 µg/ml (Fig. 2G). Importantly, this inhibition was not attributable to suppression of bacterial growth or degradation of preformed biofilm, suggesting that Af n-BuOH specifically interferes with the biofilm formation itself. Additionally, the MRSA strain used in this study was a clinical isolated strain, so further tested was performed whether a similar activity against Staphylococcus aureus ATCC25923 could be observed. Consistent with the findings in MRSA, the Af n-BuOH also exhibited an anti-biofilm activity against S. aureus ATCC25923 strain (see Supplementary Fig. S2 online). This suggests that Af n-BuOH can be widely used against S. aureus.

The altered growth pattern observed following Af n-BuOH treatment, together with morphological differences in the bacterial cell surface, suggested interference with biofilm-associated cellular processes. Biofilm formation of MRSA can be classified into two types: ica-dependent biofilm formation, where biofilms are formed via poly-intercellular adhesion (PIA) molecules encoded by the ica-operon, and ica-independent biofilm formation, where biofilms are formed via cell wall-associated proteins such as SpA, FnBPs, and Bap^47,48. Transcript analysis revealed that Af n-BuOH did not influence ica-operon genes but significantly downregulated fnbA and fib, which are part of the family microbial surface components recognizing adhesive matrix molecules (MSCRAMMs). The fib gene encodes a fibrinogen-binding protein (Fib), and attachment via Fib has been associated with wound infections, colonization of implanted biomaterials, and endocarditis⁴⁹. Likewise, fnbA, encoding a fibronectin-binding protein A (FnbA), facilitates adherence to the extracellular matrix and contributes to invasion, immune evasion, and septic infection, and has been identified as a key determinant of MRSA biofilm formation^50–53. Previous studies have shown that MRSA strains with fnbA deficiency show a significant reduction in invasive capacity, demonstrating that fnbA is essential for bacterial adhesion and biofilm formation^54,55. Similarly, we confirmed that inhibition of adhesion-related genes through Af n-BuOH treatment led to inhibition of MRSA adhesion in the A549 cell lines (Fig. 6A). Consistent with these observations, Af n-BuOH treatment also inhibited MRSA adhesion in the intestine of the Caenorhabditis elegans model (Fig. 6B). Collectively, these findings indicate that Af n-BuOH modulates the expression of adhesion-associated factors in MRSA, and that this effect is consistently reflected in both the in vitro cell adhesion assay and the in vivo C. elegans colonization model.

In previous studies, colonization of MRSA has been shown to correlate with pathogenicity in the C. elegans model^56,57. Consistent with this, our study demonstrated that treatment with the Af n-BuOH fraction significantly attenuated the nematocidal activity of MRSA compared with the DMSO and non-treated group (Fig. 7A). After infection for 9 days, C. elegans fed with MRSA exhibited mortality rates of 94% in the non-treated group and 91% in the DMSO-treated group, whereas Af n-BuOH treatment significantly reduced the mortality to 62%. Wu et al. reported that invasive and noninvasive methicillin-susceptible S. aureus (MSSA) strains isolated from infants displayed different pathogenicity to C. elegans, with 93% and 61% nematocidal activity at day 9, respectively⁵⁸. The reduction of pathogenicity of non-invasive MSSA strains was associated with the absence of several virulence genes, including the exotoxin gene chp, the adhesive molecular gene sdrC, and the exoenzyme genes hysA and sak. Additionally, abnormal intestinal morphology was observed, with loss of internal cellular ultrastructure, resulting in the appearance of “ghosts”⁵⁹. These results suggest that inhibition of MRSA adhesion by Af n-BuOH treatment may play a role in reducing the pathogenicity of MRSA to C. elegans, similar to a deficiency of other virulence factors, and may also alleviate organ necrosis and increase life-span.

Conclusion

In this study, we demonstrated that extracts derived from halophytes, growing in a coastal region, selectively inhibited the biofilm formation of MRSA. This anti-biofilm activity originated from inhibition of adhesion-related genes. Furthermore, suppression of MRSA adhesion was shown to attenuate pathogenicity in C. elegans models. These finding suggest disruption of adhesion can be a novel approach for controlling MRSA biofilm formation and colonization. Additionally, the observed beneficial activities of halophyte extracts suggest that they could be used as antibiotic alternative and adjuvant to reduce antibiotic usage in the future.

Supplementary Information

Below is the link to the electronic supplementary material.

Author contributions

Conceptualization, H.S.K., G.Y.K., S.H., and K.H.M.; Investigation, H.S.K., G.Y.K., J.W.P., J.H.L., and B.H.Y.; Data curation, H.S.K., G.Y.K., J.W.P., J.H.L., A.M.Y., and B.H.Y.; Writing—original draft preparation, H.S.K., G.Y.K., S.H., and K.H.M.; Writing—review and editing, A.M.Y., B.H.Y., S.H., and K.H.M.; Funding acquisition, K.H.M.; Supervision, S.H., and K.H.M. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Research Foundation of Korea (NRF) grants funded by the Republic of Korea government (MSIT) (No. 2021R1C1C1004734, 2022R1F1A1065328, and RS-2026-25470385).

Data availability

The data supporting the findings of this study are available within the article and its supplementary information. Additional data can be obtained from the corresponding author upon reasonable request.

Declarations

Competing interests

The authors declare no competing interests.

Declaration of AI use

No artificial intelligence (AI) tools or AI-assisted technologies were used in the conception, design, data collection, analysis, writing, or revision of this manuscript.