Gadd45α silencing alleviates cerebral ischemia–reperfusion injury by suppressing FOXO1 signaling

Abstract

Cerebral ischemia–reperfusion (I/R) injury remains a major therapeutic challenge, primarily due to complex mechanisms involving oxidative stress and apoptosis. Growth arrest and DNA damage-inducible protein α (Gadd45α), a stress sensor linked to cellular stress responses, has been implicated in I/R injury, yet its precise role in ischemic stroke is incompletely understood. This study aimed to elucidate the function and underlying mechanisms of Gadd45α in cerebral I/R injury using both in vivo and in vitro models. In rats subjected to middle cerebral artery occlusion (MCAO) and in neurons exposed to oxygen–glucose deprivation/reperfusion (OGD/R), Gadd45α expression was significantly upregulated. Lentivirus-mediated knockdown of Gadd45α (sh-Gadd45α) reduced infarct volumes, improved neurological function and increased miniature excitatory postsynaptic current (mEPSC) amplitude. In primary cortical neurons exposed to OGD/R, Gadd45α knockdown decreased reactive oxygen species (ROS) production, DNA damage, and apoptosis, while Gadd45α overexpression exacerbated these effects. Mechanistically, Gadd45α directly interacts with forkhead box O1 (FOXO1) and positively regulates its transcriptional activity. Gadd45α knockdown attenuated the ischemia-induced upregulation of both total FOXO1 and its phosphorylated form (p-FOXO1), thereby suppressing FOXO1 signaling and mitigating cerebral I/R injury. Furthermore, FOXO1 overexpression reversed the neuroprotective effects of Gadd45α silencing, confirming that FOXO1 acts as a critical downstream mediator. These findings demonstrate that Gadd45α silencing alleviates cerebral I/R injury by suppressing FOXO1 signaling, suggesting the Gadd45α/FOXO1 axis as a promising therapeutic target for ischemic stroke.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-026-55411-1.

Introduction

Ischemic stroke, resulting from blockage of cerebral blood flow, represents a leading cause of death and enduring disability worldwide^1,2. Its underlying pathophysiology involves excitotoxicity, oxidative stress, and apoptotic pathways, which ultimately lead to neuronal death and functional impairment^3,4. Despite advances in revascularization strategies, reperfusion may paradoxically exacerbate injury. This occurs by inducing reactive oxygen species (ROS) generation and inducing inflammatory responses, a phenomenon known as cerebral ischemia–reperfusion (I/R) injury⁵. Current therapeutic options remain limited, underscoring an urgent need to elucidate the molecular mechanisms of I/R injury and identify novel neuroprotective targets.

Emerging evidence indicates that the growth arrest and DNA damage-inducible protein 45 (Gadd45) family plays important roles in neurodevelopment, neurodegenerative diseases, and neuropsychiatric disorders^6,7. Among its members, Gadd45α serves as a critical stress sensor involved in DNA repair, cell cycle control, and the regulation of apoptosis. Notably, Gadd45α has been implicated in neuronal apoptosis and oxidative stress under ischemic conditions and is considered a potential biomarker for ischemic stroke^8–10. However, the precise role and molecular mechanisms of Gadd45α in cerebral I/R injury are not fully understood. In particular, its interactions with key survival and stress-signaling pathways.

The forkhead box O1 (FOXO1) transcription factor is a key regulator of cellular stress responses. It plays a central role in maintaining oxidative balance and determining cell fate, primarily through the modulation of apoptosis and autophagy^11–13. FOXO1 activity is tightly regulated by post-translational modifications, especially phosphorylation, which influences its subcellular localization and transcriptional activity^14,15. Under physiological conditions, phosphorylation-mediated inactivation of FOXO1 promotes cell survival by suppressing pro-apoptotic signals^16,17. However, under sustained or severe oxidative stress, such as during cerebral I/R, reduced FOXO1 phosphorylation and subsequent activation can lead to dysregulated apoptosis and increased oxidative damage¹⁸. Interestingly, Gadd45α has been reported to interact with several kinase pathways that may converge on FOXO1 activation⁸. Nevertheless, whether and how Gadd45α modulates FOXO1 activity under ischemic conditions remains largely unknown. Elucidating this regulatory relationship could provide deeper insight into ischemic brain injury and identify potential therapeutic targets for mitigating reperfusion-related damage.

In this study, we aimed to investigate whether Gadd45α influences cerebral I/R injury by regulating FOXO1 signaling. Using both in vivo (middle cerebral artery occlusion, MCAO) and in vitro (oxygen–glucose deprivation/reperfusion, OGD/R) models, we evaluated the effects of Gadd45α on cerebral I/R injury. Our results demonstrate that Gadd45α promotes ROS production, DNA damage and neuronal apoptosis, whereas its knockdown confers neuroprotection. Mechanistically, Gadd45α directly interacts with FOXO1 and promotes its transcriptional activity. FOXO1 is required for Gadd45α-mediated neurotoxicity. These findings identify the Gadd45α/FOXO1 axis as a potential therapeutic target for ischemic stroke.

Materials and methods

MCAO rat model construction

The animal experimental protocol was approved by the Institutional Animal Care and Use Committee of Nanjing Medical University (Approval number: IACUC-2510049). All experiments were conducted in accordance with the guidelines of the Institutional Animal Care and Use Committee and animal suffering was minimized to the greatest extent possible. Adult male Sprague–Dawley rats (180–200 g) from Qing Longshan Animal Breeding Center (Nanjing, China) and underwent either MCAO or sham surgery. The MCAO model was established using a modified suture-occlusion method based on Longa’s. Briefly, rats were anesthetized with 5% isoflurane (Sigma, 792,632) in 1.5 L/min O₂ and maintained under 1.5–2% isoflurane anesthesia during surgery. With a heating pad operating at a constant temperature, rectal temperature was maintained between 36.5 °C and 37.5 °C. MCAO was induced by inserting a 3–0 monofilament suture (Doccol, 702312PK5Re) into the internal carotid artery until mild resistance indicated MCA origin occlusion. The suture remained in place for 90 min before its removal to initiate reperfusion. Sham-operated animals underwent the same surgical procedure, including exposure of the carotid arteries, but without filament insertion. At the end of the experimental procedures, all animals were euthanized by an intraperitoneal injection of sodium pentobarbital (150 mg/kg), followed by cervical dislocation to ensure death.

Measurement of neurological deficit

Neurological deficits in animals with successful MCAO occlusion, characterized by signs such as persistent circling, were evaluated by blinded investigators using the Zea-Longa scoring system^19,20. The scoring criteria were as follows: 0, no deficit; 1, contralateral forelimb flexion; 2, severe forelimb flexion + reduced lateral push resistance (no circling); 3, unidirectional circling; 4, no spontaneous movement. Higher scores indicate more severe neurological injury. Only rats with a neurological score ≥ 1 at 2 h post-reperfusion were considered successfully occluded and included in subsequent experiments.

Primary culture of cortical neurons

Sprague–Dawley rat embryos (embryonic day 16–18) were used to isolate primary cortical neurons^21,22. Cells were plated at 7 × 10⁵ cells/well. Cells were initially cultured for 4 h in DMEM/F12 (Hyclone, SH30023) with 10% FBS (SH30070) and 1% penicillin/streptomycin (SV30010), then switched to Neurobasal medium containing 2% B27 (Gibco, 17,504,044), 0.25% glutamine (Sigma, P1399), and 1% penicillin/streptomycin. Half-medium was replaced every 3 days with fresh Neurobasal-based medium (Gibco, 21,103,049). After 7 days in a humidified 5% CO₂ environment at 37 °C, neurons were used for OGD/R experiments.

Lentivirus-mediated gene manipulation

For in vitro transduction, primary neurons were transduced on day 5 in vitro with lentiviral vectors carrying Gadd45α-specific short hairpin RNA (LV-sh-Gadd45α) or overexpressing Gadd45α (LV-Gadd45α) at a multiplicity of infection of 100. After 12–16 h, virus-containing medium was replaced with fresh Neurobasal/B27 medium, followed by a 48 h culture for transgene expression prior to OGD/R experiments.

For in vivo intracerebral injection, rats subjected to MCAO were randomly assigned to receive an intracerebroventricular injection immediately at the onset of reperfusion. Using a Hamilton syringe and stereotaxic apparatus, 10 μL of lentiviral suspension (LV-sh-Gadd45α or LV-Gadd45α, titer: 5 × 10⁶ TU) was injected into the left lateral ventricle at a rate of 0.5 μL/min. The coordinates (AP, ML, DV) relative to bregma were −0.8 mm, −1.5 mm, and −4.0 mm, respectively. The needle was left in place for 5 min after injection before withdrawal to ensure complete diffusion. Neurological function was assessed 24 h, and brain tissues were then collected.

Oxygen–glucose deprivation/reoxygenation (OGD/R) model

An in vitro model of cerebral ischemia was established using the OGD/R protocol as previously described²³. Briefly, cells were washed with glucose-free Opti-MEM medium (Gibco, 31,985,070), then incubated in the same medium for 1 h in a tri-gas incubator (1% O₂, 5% CO₂, 94% N₂). After the deprivation period, fresh Neurobasal medium with 2% B27 was used to replace the existing medium, terminating OGD. Simulating reperfusion, cells were subsequently incubated under normoxic conditions (95% air, 5% CO₂) at 37 °C for 4 h. Control cells underwent the same medium changes and incubation times but were maintained under normoxic conditions.

2,3,5-triphenyltetrazolium chloride staining (TTC)

Rat brains were collected 24 h post-reperfusion and frozen at −20 °C for 30 min. Subsequently, brain tissues were sectioned into 2 mm slices and immersed in a 2% TTC solution (Sigma, T8877) at 37 °C for 30 min in the dark, rinsed with PBS (Solarbio, P1020). Subsequently, sections were fixed with 4% paraformaldehyde for 2 h and then photographed.

Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining

Apoptosis was assessed with a kit (Nanjing keygen, KGA7073) per manufacturer’s protocol. Briefly, brain sections were permeabilized and incubated with the TUNEL reaction mixture. After counterstaining with DAPI (Beyotime, C1006), sections were visualized under a fluorescence microscopy (NIKON ECLIPSE TS2R, Japan).

Immunofluorescence staining

Rat brain tissues were embedded in OCT compound and cut into 6 μm cryosections and fixed in 4% formaldehyde. Permeabilization was performed with 0.2% Triton X-100 (Solarbio, T8200). Sections were blocked (10% normal goat serum/PBS, 30 min), then incubated overnight at 4 °C with primary antibodies against Gadd45α (Affinity, DF6622), NeuN (Abcam, ab1104224), GFAP (Abcam, ab302644), and IBA1 (Abcam, ab289874). After washing, sections were incubated for 1 h with secondary antibodies: Alexa Fluor 594 goat anti-rabbit for Gadd45α, and Alexa Fluor 488 donkey anti-mouse (for NeuN) or anti-goat (for GFAP/IBA1). DAPI was applied for 10 min for nuclear staining.

For cell immunofluorescence, cultured cells were fixed with 4% paraformaldehyde. Cells were permeabilized in 0.5% Triton X-100/PBS for 10 min, blocked with 3% BSA (Sigma, V900933) for 30 min, and then incubated overnight at 4 °C with primary antibodies: rabbit anti-Gadd45α (Affinity, DF6622) and rabbit anti-FOXO1 (Abcam, ab219734). The next day, cells were exposed to Alexa Fluor 488-conjugated donkey anti-rabbit IgG (Abcam, ab150061) for 1 h. Nuclei were stained with DAPI, mounted with Fluoromount-G mounting medium (EMS, 17,984–25). Imaging was performed using a confocal microscope (Leica TCS SP8 STED, Germany).

Western blot

Cells and tissues were lysed using RIPA Buffer (Sigma, R0278). Total proteins were separated by 10% SDS-PAGE (Solarbio, S8010S; Solarbio, A1010), transferred to nitrocellulose membranes, and probed overnight with primary antibodies against Gadd45α (Affinity, DF6622), p-FOXO1 (Abcam, ab259337), FOXO1 (Abcam, ab179450), PCNA (Abcam, ab92552), RAD51 (Abcam, ab133534), γH2AX (Abcam, ab81299) diluted in 5% non-fat milk (BD, 232,100) in TBS-Tween (Solarbio, T8220). After washing, incubation with HRP-conjugated secondary antibodies, membranes were visualized via ECL reagent. Band intensities were quantified using AlphaEase software (Innotech Corporation, San Leandro, CA), reported as arbitrary units, and based on a minimum of three independent experiments.

Reverse transcription quantitative polymerase chain reaction (RT-qPCR)

Total mRNA was extracted from the cultured cells using Trizol reagent (Invitrogen, 15,596,026). Then, 1 μg of mRNA was reverse-transcribed into first-strand cDNA in 20 μl with a cDNA synthesis kit (Takara, RR047A). Gadd45α and FOXO1 mRNA expression levels were measured with specific primers (Table 1). Relative expression was calculated by the 2^-ΔΔCT method with GAPDH as an internal control.

Table 1.

Primers sequences used for quantitative real-time PCR.

Gene name	Primer sequences (5′−3′)
Gadd45α forward	GTGTGCTGGTGACGAACCCACAT
Gadd45α reverse	CCGTTCGGGGAATCACCGTCCG
FOXO1 forward	ACGAGTGGATGGTGAAGAGTG
FOXO1 reverse	CCTCCCTCTGGATTGAGCATC
GAPDH forward	GACATCAAGAAGGTGGTGAAGC
GAPDH reverse	TCCAGGGTTTCTTACTCCTTGG

Flow cytometry

Apoptosis was assessed using a fluorescein isothiocyanate Annexin V Apoptosis Detection kit (eBioscience, BMS500FI) following the supplier’s instructions. Briefly, rat primary cortical neurons were collected by brief trypsinization and labeled for 15 min with Alexa 488-conjugated Annexin V and propidium iodide (PI). Labeled cells were analyzed using a FACScan flow cytometer and CellQuest software.

For ROS detection, the ROS Detection Kit (Beyotime, S0033) was used according to the supplier’s instructions. In Brief, cells subjected to OGD/R were harvested. Cells were then washed, trypsinized, and then loaded with 1 μmol/l H₂DCFDA (Molecular Probes) for 30 min at 37 °C. After two washes with PBS, total ROS levels were detected by measuring H₂DCFDA fluorescence using a FACSCanto flow cytometer (Becton Dickinson) and analyzed with FlowJo 7.1 software (Treestar, Inc.)

Electrophysiological recording and long-term potentiation induction

Hippocampal slices (350 μm) were prepared from anesthetized rats and maintained in oxygenated artificial cerebrospinal fluid. Whole-cell patch-clamp recordings of CA1 pyramidal neurons were made with borosilicate glass electrodes (4–8 MΩ) containing a Cs⁺-based internal solution. Voltage-clamp recordings were then performed to measure miniature excitatory postsynaptic currents (mEPSCs). To induce long-term potentiation (LTP), a concentric stimulating electrode was placed in the Schaffer collateral pathway, and baseline responses were recorded for 10 min before applying high-frequency stimulation (100 Hz, 1 s). Postsynaptic responses were monitored for 40 min post-induction. Signals were amplified (Axon Instruments, USA), digitized at 5 kHz, and analyzed offline using Clampfit 10.2 (Molecular Devices, San Jose, CA, USA). The amplitudes and decay time constants of EPSCs and EPSPs were analyzed by single exponential fitting. Data were plotted using Adobe Illustrator CS software.

Molecular docking

The three-dimensional structures of FOXO1 (PDB ID: 3CO6, determined by X-ray) and Gadd45α (PDB ID: 2KG4, determined by NMR) were retrieved from the UniProt database (IDs Q12778 and P24522, respectively). HDOCKlite v1.1 was used for protein–protein docking, and the MM/GBSA method via the HawkDock server was applied to compute the binding free energy of the predicted complex. Non-covalent interactions at the protein–protein interface were then analyzed, followed by structural visualization analysis.

Co-immunoprecipitation (Co-IP) assay

Cells were harvested and lysed in IP lysis buffer (Shanghai Aladdin Biochemical Technology Co., Ltd, T434386). After centrifugation at 4 °C for 20 min, a small aliquot of each supernatant was retained as input control. The remaining supernatants were sequentially incubated: first with the indicated primary antibodies (overnight, 4 °C), then with protein A/G magnetic beads (4 h, 4 °C). Beads were subsequently washed with 1 mL of lysis buffer, and the captured complexes were eluted in SDS-PAGE loading buffer, denatured at 100 °C for 7 min, and analyzed by western blotting.

Dual luciferase reporter gene

Cells were seeded into 24‑well plates the day before transfection. A FOXO1‑responsive luciferase reporter plasmid (containing FOXO1 binding elements) was co‑transfected with either Gadd45α overexpression plasmid (OE‑Gadd45α) or corresponding control vectors using Lipofectamine 2000 reagent. A Renilla luciferase reporter plasmid was co‑transfected as an internal control. After 48 h of incubation at 37 °C, cells were harvested, and luciferase activities were determined with a dual-luciferase reporter assay, then normalized to Renilla luciferase activity.

Statistical analysis

All statistical analyses were performed using GraphPad Prism 9. Data were presented as the means ± standard error of the mean (SEM). The t-test was used to compare two groups, and the one-way analysis of variance (ANOVA) was employed for comparisons of more than two groups. P < 0.05 was considered statistically significant.

Results

MCAO induces neurological injury and upregulates Gadd45α expression in rat brain

The Longa scoring system was employed to evaluate neurological deficits and validate the successful induction of the MCAO model. Rats with a Longa score ≥ 1 (Fig. 1A) were considered to have successful ischemia and were included in subsequent analyses. These rats were sacrificed at predetermined time points (4, 8, 12, 24, and 72 h post-MCAO). Immunofluorescence analysis was performed on ischemic penumbral tissues to examine the effect of MCAO on Gadd45α expression. As shown in Fig. 1B–D, sham-operated animals exhibited minimal Gadd45α expression. In contrast, MCAO induction significantly upregulated Gadd45α protein. This increase was detectable as early as 4 h after ischemia, peaked at 24 h, and was characterized by intense nuclear staining within NeuN-positive neurons. Thus, Gadd45α is significantly upregulated in the ischemic penumbra following MCAO, suggesting that Gadd45α plays a role in this pathological process.

Fig. 1.

Gadd45α expression is upregulated in the ischemic penumbra after MCAO. (A) Longa scores of rats after MCAO. Rats with scores ≥ 1 were included. (B–D) Immunofluorescence staining showing Gadd45α (red), NeuN (green, neuronal marker), GFAP (green, astrocytic marker), and IBA1 (green, microglial marker) in sham and MCAO groups at different time points. Nuclei are stained with DAPI (blue). Scale bar: 50 μm. Data are presented as mean ± SEM (n = 6 per group). Statistical significance was determined by one-way ANOVA followed by Tukey’s post hoc test. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

Gadd45α knockdown exerts neuroprotection and suppresses FOXO1 signaling in a rat MCAO model

To further explore the role of Gadd45α in ischemic injury, we investigated the effects of Gadd45α knockdown (sh-Gadd45α) in the MCAO model. Rats treated with sh-Gadd45α showed a significant improvement in neurological function at 24 h post-MCAO, as indicated by lower Longa scores compared to the model group (Fig. 2A). The extent of cerebral infarction, assessed by TTC staining, was notably reduced in the sh-Gadd45α group (Fig. 2B). Furthermore, TUNEL staining demonstrated that Gadd45α knockdown markedly attenuated apoptosis in the ischemic brain tissue (Fig. 2C). To elucidate the potential mechanism underlying this anti-apoptotic effect, we analyzed the expression of key apoptotic regulators. Western blot analysis revealed that sh-Gadd45α treatment significantly reduced the protein levels of both total FOXO1 and phosphorylated FOXO1 (p-FOXO1) in the brains of MCAO rats (Fig. 2D). Collectively, these results demonstrate that Gadd45α knockdown alleviates ischemic brain injury, potentially through suppression of the FOXO1 pathway and subsequent reduction of apoptosis.

Fig. 2.

Gadd45α knockdown exerts neuroprotection and suppresses FOXO1 signaling in a rat MCAO model. (A) Longa scores. (B) TTC staining showing infarct volume. (C) TUNEL staining for apoptosis. Scale bar: 50 μm. (D) Western blot analysis and quantification of FOXO1 and p-FOXO1 in brain tissue. The uncropped original blots are shown in Supplementary Figure S1. Data are presented as mean ± SEM (n = 6 per group). Statistical significance was determined by one-way ANOVA followed by Tukey’s post hoc test. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

Gadd45α knockdown enhances synaptic plasticity in the hippocampus of MCAO rats

Given that Gadd45α knockdown reduced apoptosis and cerebral infarction, we hypothesized that it might also influence synaptic function. We therefore assessed whether Gadd45α knockdown affected AMPA receptor-mediated mEPSCs. Our results showed that sh-Gadd45α treatment significantly increased mEPSC amplitude in hippocampal neurons (Fig. 3A,B). This result suggests that Gadd45α knockdown enhances basal synaptic transmission, which may contribute to the improvement of neurological function.

Fig. 3.

Gadd45α knockdown enhances synaptic plasticity in the hippocampus of MCAO rats. (A) Representative traces of mEPSC amplitude in neurons treated with sh-Gadd45α. (B) Quantification of mEPSC amplitude in neurons treated with sh-Gadd45α. Data are presented as mean ± SEM (n = 6 per group). Statistical significance was determined by an unpaired two-tailed Student’s t-test. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

Gadd45α and FOXO1 are both upregulated in primary cortical neurons following OGD/R

To validate our in vivo findings and explore the underlying mechanisms, we established an in vitro model of cerebral ischemia using primary cortical neurons subjected to OGD/R. Consistent with the in vivo results, OGD/R treatment significantly increased Gadd45α protein expression, as evidenced by immunofluorescence staining (Fig. 4A) and western blot analysis (Fig. 4B). In addition, we measured the FOXO1 mRNA expression and found it to be significantly upregulated (Fig. 4C). This upregulation was further confirmed at the protein level by immunofluorescence analysis (Fig. 4D). Notably, we also examined the phosphorylation status of FOXO1. Both total FOXO1 and phosphorylated FOXO1 (p-FOXO1) were significantly higher in the OGD/R group (Fig. 4E). Taken together, these findings point to a concurrent increase in Gadd45α expression and FOXO1 signaling activity under OGD/R conditions, which is consistent with our in vivo observations.

Fig. 4.

OGD/R induces Gadd45α expression and activates FOXO1 signaling in neurons. (A) Immunofluorescence staining of Gadd45α (green) in primary cortical neurons. Nuclei were counterstained with DAPI (blue). (B) Western blot analysis and quantification of Gadd45α protein expression in primary cortical neurons. (C) RT-qPCR analysis of FOXO1 mRNA expression levels (D) Immunofluorescence of FOXO1 protein (green) in primary cortical neurons. Nuclei were counterstained with DAPI (blue). (E) Western blot analysis and quantification of p-FOXO1, total FOXO1 protein expression. The uncropped original blots are shown in Supplementary Figure S2 and S3. Data are presented as mean ± SEM of three independent biological replicates (n = 3). Statistical significance was determined by an unpaired two-tailed Student’s t-test. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

Gadd45α modulates OGD/R-induced ROS production, DNA damage, and apoptosis in neurons

To further investigate the functional role of Gadd45α in OGD/R-induced injury, we modulated its expression in neuronal cultures using lentiviral vectors. Western blot analyses confirmed successful overexpression and knockdown of Gadd45α (Fig. 5A). We next examined the involvement of FOXO1 in OGD/R-induced cellular stress pathways. We found that Gadd45α upregulation enhanced OGD/R-induced ROS production, while Gadd45α knockdown significantly reduced ROS levels (Fig. 5B). Given that excessive ROS triggers DNA damage, we then assessed DNA damage repair markers. Gadd45α overexpression significantly increased γH2AX (a DNA damage marker) while reducing the expression of repair proteins PCNA and RAD51; in contrast, Gadd45α knockdown decreased γH2AX expression and increased PCNA and RAD51 levels (Fig. 5C). Furthermore, we analyzed the effect of Gadd45α on cell death. Gadd45α overexpression promoted apoptosis, whereas Gadd45α knockdown attenuated it (Fig. 5D). Together, these results demonstrate that Gadd45α knockdown exerts a neuroprotective effect by suppressing ROS overproduction, DNA damage, and apoptosis, whereas Gadd45α overexpression aggravates these pathological processes.

Fig. 5.

Gadd45α promotes ROS production, DNA damage, and apoptosis in OGD/R-treated neurons. (A) Western blot analysis and quantification of Gadd45α after lentiviral overexpression or knockdown. (B) Fluorescence measurement of ROS levels (C) Western blot analysis and quantification of γH2AX, PCNA, and RAD51 protein expression. (D) Flow cytometry analysis of apoptosis using Annexin V/PI staining. Representative plots and quantification are shown. The uncropped original blots are shown in Supplementary Figure S4 and S5. Data are presented as mean ± SEM of three independent biological replicates (n = 3). Statistical significance was determined by one-way ANOVA followed by Tukey’s post hoc test. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

Gadd45α interacts with and transcriptionally activates FOXO1

Our previous results suggested that Gadd45α may exert its neuroprotective or neurotoxic effects via FOXO1. To elucidate the molecular mechanism by which Gadd45α regulates FOXO1, we first performed molecular docking simulations, which predicted a direct physical interaction (Fig. 6A). Co-IP assays in primary cortical neurons subjected to OGD/R confirmed that endogenous Gadd45α interacts with FOXO1 (Fig. 6B). Western blot analysis revealed that Gadd45α overexpression increased total FOXO1 and p-FOXO1 protein levels, whereas Gadd45α knockdown reduced FOXO1 and p-FOXO1 expression (Fig. 6C). To determine whether Gadd45α directly regulates FOXO1 transcriptional activity, we performed dual‑luciferase reporter assays using a FOXO1‑responsive luciferase reporter plasmid. As shown in Fig. 6D, Gadd45α overexpression significantly enhanced FOXO1 transcriptional activity. These results collectively demonstrate that Gadd45α interacts with FOXO1 and positively regulates its expression and transcriptional activity.

Fig. 6.

Gadd45α interacts with and activates FOXO1. (A) Molecular docking analysis of the Gadd45α-FOXO1 interaction. (B) Co‑immunoprecipitation analysis of the interaction between Gadd45α and FOXO1 in primary cortical neurons subjected to OGD/R. (C) Western blot analysis and quantification of p-FOXO1 and total FOXO1 protein expression after Gadd45α overexpression or knockdown in primary cortical neurons. (D) Dual‑luciferase reporter assay of FOXO1 transcriptional activity after Gadd45α overexpression in primary cortical neurons. The uncropped original blots are shown in Supplementary Figure S6 and S7. Data are presented as mean ± SEM of three independent biological replicates (n = 3). Statistical significance was determined by one‑way ANOVA followed by Tukey’s post hoc test. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

FOXO1 overexpression abolishes the protective effects of Gadd45α silencing against OGD/R-induced injury

Having established that Gadd45α positively regulates FOXO1, we next performed rescue experiments to determine whether FOXO1 is required for the neuroprotective effects of Gadd45α knockdown. FOXO1 was overexpressed in Gadd45α-silenced primary cortical neurons subjected to OGD/R. Efficient gene manipulation was confirmed by RT-qPCR and Western blot (Fig. 7A-D). We then examined the functional consequences of FOXO1 re‑expression. Gadd45α knockdown significantly reduced the protein levels of both total FOXO1 and p‑FOXO1, whereas FOXO1 overexpression restored their expression (Fig. 7E). The reduced ROS levels (Fig. 7F) and the attenuated DNA damage (Fig. 7G) observed with Gadd45α silencing were largely reversed by FOXO1 overexpression. Flow cytometry analysis further revealed that the anti‑apoptotic effect of Gadd45α knockdown was significantly reversed by FOXO1 overexpression (Fig. 7H). Collectively, these results confirm that FOXO1 acts as a critical downstream mediator of Gadd45α in cerebral ischemic injury.

Fig. 7.

FOXO1 overexpression reverses the protective effects of Gadd45α silencing against OGD/R‑induced ROS production, DNA damage, and apoptosis. (A) RT‑qPCR analysis of Gadd45α mRNA expression. (B) RT‑qPCR analysis of FOXO1 mRNA expression. (C) Western blot analysis and quantification of Gadd45α protein expression. (D) Western blot analysis and quantification of FOXO1 protein expression. (E) Western blot analysis and quantification of p-FOXO1 and total FOXO1 protein expression. (F) Fluorescence measurement of ROS levels. (G) Western blot analysis and quantification of PCNA, RAD51, and γH2AX protein expression. (H) Flow cytometry analysis of apoptosis using Annexin V/PI staining. The uncropped original blots are shown in Supplementary Figure S8-S11. Data are presented as mean ± SEM of three independent biological replicates (n = 3). Statistical significance was determined by one‑way ANOVA followed by Tukey’s post hoc test. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

Discussion

Ischemic stroke remains a significant clinical challenge, with reperfusion injury substantially contributing to secondary brain damage^24,25. Our study identifies Gadd45α as a critical exacerbating factor in cerebral I/R injury. We demonstrate that Gadd45α is markedly upregulated following cerebral I/R and promotes neuronal damage. Mechanistically, the pro-injury effect of Gadd45α is associated with its interaction with FOXO1, which enhances FOXO’s transcriptional activity and activates the FOXO1 signaling pathway. Conversely, silencing Gadd45α inhibits FOXO1 pathway. This inhibition correlated with neuroprotection, including reduced ROS production, DNA damage and apoptosis, as well as improved neurological function. These findings highlight the Gadd45α/FOXO1 axis as a potential therapeutic target.

Our findings align with and extend previous reports on Gadd45 proteins as inducible factors. We observed Gadd45α upregulation peaked in the ischemic penumbra at 24 h post-MCAO and was predominantly localized to neurons. This spatiotemporal profile corroborates its role as an early stress responder with neuron-specific pathogenic functions in I/R injury. In vitro, OGD/R also robustly induced Gadd45α, further validates its responsiveness to ischemic stimuli. These results are consistent with a previous report implicating Gadd45 family members in neuronal stress responses and plasticity²⁶.

Gadd45α silencing promoted functional recovery, as evidenced by improved neurological scores, reduced infarct volumes, and enhanced mEPSC amplitude. Consistent with the inclusion criteria (neurological score ≥ 1 at 2 h post-reperfusion), both MCAO model groups exhibited comparable initial ischemic insult. At 24 h post-reperfusion, the sh-Gadd45α group showed significant neurological improvement, indicating functional recovery. To elucidate the histological basis underlying this functional improvement, we examined tissue damage and neuronal survival in the ischemic penumbra. Gadd45α knockdown reduced infarct volume and decreased neuronal apoptosis in the penumbra, indicating effective tissue preservation. Beyond these protections, Gadd45α silencing also enhanced functional integrity of surviving neural circuits, as evidenced by increased mEPSC amplitude. The augmentation of mEPSC amplitude suggests that Gadd45α influences synaptic transmission, potentially through indirect modulation of AMPA receptor trafficking secondary to improved neuronal health^27–29. Thus, the functional recovery observed upon Gadd45α silencing likely arises from the combination of reduced tissue loss and preserved synaptic function. This underscores its multifaceted neuroprotective potential.

The mechanistic basis for this neuroprotection lies in Gadd45α's ability to orchestrate multiple interconnected stress responses. ROS are critical signaling molecules that, when overproduced during I/R, become pathological and trigger secondary damage cascades^30–35. Our data demonstrate that Gadd45α acts as a critical regulator of ROS homeostasis under ischemic conditions. ROS are well-established triggers of DNA damage, particularly double-strand breaks (DSB)³⁶. The phosphorylated histone H2AX (γH2AX) serves as a classic marker for DSB detection³⁷. Key DNA repair proteins, including PCNA and RAD51, serve as indicators of cellular DNA repair capacity^38,39. Indeed, we found that Gadd45α modulates the DNA damage response by enhancing the accumulation of γH2AX while simultaneously suppressing the expression of key repair proteins PCNA and RAD51. Notably, while Gadd45α can promote DNA repair under certain conditions⁴⁰, our findings under severe I/R reveal an opposite effect, likely driven by excessive ROS production. Consequently, Gadd45α creates a deleterious scenario of accumulated damage and compromised repair, accelerating neuronal apoptosis. By restoring redox balance, Gadd45α silencing alleviates DNA injury and apoptosis, ultimately contributing to functional recovery.

A central question is how Gadd45α exerts such broad effects. Our data identify FOXO1 as the critical downstream mediator. To explore the structural basis, we performed molecular docking, which predicted multiple hydrogen bonds between Gadd45α and FOXO1. Co‑IP assays confirmed that Gadd45α physically interacts with FOXO1 under OGD/R conditions. Moreover, dual‑luciferase reporter assays revealed that Gadd45α positively regulates FOXO1 transcriptional activity. Consistent with these findings, Gadd45α overexpression increased, while its knockdown decreased, the protein levels of both total FOXO1 and p‑FOXO1. The functional necessity of FOXO1 was confirmed by rescue experiments: FOXO1 overexpression in Gadd45α‑silenced neurons reversed the protective phenotype, restoring ROS production, DNA damage, and apoptosis. This reversal effect demonstrates that FOXO1 is functionally required for Gadd45α‑mediated neurotoxicity. Traditionally, FOXO1 activity is tightly regulated by phosphorylation, which often leads to its inactivation and cytoplasmic retention^41,42. However, in our acute severe ischemia models, the co-upregulation of total FOXO1 and p-FOXO1 by Gadd45α was linked to exacerbated cellular injury. This suggests that in this pathological context, the overall increase in the FOXO1 protein pool may be the dominant driver of its detrimental output This could potentially override the conventional regulatory effect of phosphorylation or indicate a context-dependent role of p-FOXO1. The neuroprotection observed upon Gadd45α silencing likely stems primarily from reducing the availability of the FOXO1 protein substrate, thereby dampening the entire pathway’s activity.

In summary, our findings identify Gadd45α as a critical mediator of cerebral I/R injury, which promotes ROS production, DNA damage and apoptosis, at least in part, by upregulating the FOXO1 pathway. Silencing Gadd45α conferred significant neuroprotection and enhanced recovery, largely by reducing the protein levels of FOXO1 and suppressing its pathway activity. These results highlight the promise of Gadd45α/FOXO1 axis as a novel therapeutic target for ischemic stroke. However, several limitations of this study should be acknowledged. First, while our study demonstrates that Gadd45α silencing attenuates oxidative stress, DNA damage, and apoptosis through FOXO1 suppression, the upstream regulators of Gadd45α expression under ischemic conditions require further exploration. Second, the study primarily focused on short-term outcomes. Long-term functional and behavioral assessments following Gadd45α silencing are needed to fully evaluate its therapeutic potential. Third, the translational relevance of these findings may be affected by comorbidities commonly seen in human stroke patients. Future studies should therefore validate these results in higher species and in models incorporating comorbid conditions. Finally, although we demonstrated that Gadd45α directly interacts with FOXO1 and enhances its transcriptional activity, whether other co-factors are involved in this regulation remains to be determined.

Conclusions

In conclusion, this study illustrates that Gadd45α plays a critical role in exacerbating cerebral I/R injury. Mechanistically, Gadd45α promotes neuronal damage by upregulating the FOXO1 pathway via transcriptional activation of FOXO1. Conversely, silencing Gadd45α confers significant neuroprotection, improved functional recovery, and enhanced synaptic plasticity. These beneficial effects are largely mediated through suppression of the FOXO1 pathway, which restored redox balance, enhanced DNA repair capacity, and inhibited apoptosis. Collectively, our findings identify the Gadd45α/FOXO1 axis as a promising therapeutic candidate for ischemic stroke.

Author contributions

Cong Chen and Wen Tao: Conceptualization, Methodology, Software, Data curation, Visualization, Investigation, Formal analysis, Writing—Original draft preparation. Fei Chen and Jie Gong: Conceptualization, Writing—Review & Editing, Supervision, Project administration.

Funding

This work was supported by grants from Elderly Health Research Project of Jiangsu Province (No. LKM2024050).

Data availability

This article can be available from the corresponding author on reasonable request.

Declarations

Competing interests

The authors declare no competing interests.