ABSTRACT
Tripartite motif‐containing 59 (TRIM59) is an E3 ubiquitin ligase implicated in multiple malignancies, but its role in bladder cancer (BLCA) remains incompletely understood. In this study, we identified TRIM59 as a clinically relevant oncogenic driver in BLCA through integrated transcriptomic, clinical, and functional analyses. TRIM59 was significantly upregulated in BLCA tissues and cell lines, and high TRIM59 expression was associated with advanced stage, higher grade, recurrence, and poor prognosis. Functionally, TRIM59 promoted BLCA proliferation, cell‐cycle progression, migration, invasion, and metastatic colonization in vitro and in vivo. Mechanistically, TRIM59 directly interacted with PTRF/Cavin‐1 and induced its RING domain‐dependent K48‐linked polyubiquitination and proteasomal degradation. Additional mutagenesis analyses identified K98, K122, K152, and K317 as major ubiquitination sites on PTRF. In contrast to the oncogenic role of TRIM59, PTRF was downregulated in BLCA and exhibited tumor‐suppressive properties. PTRF restoration attenuated TRIM59‐driven proliferation, invasion, and epithelial‐mesenchymal transition, whereas PTRF depletion partially rescued the inhibitory effects of TRIM59 silencing. Further analyses showed that PTRF restrains AKT phosphorylation and suppresses MYC transcriptional activity, thereby limiting c‐Myc‐driven proliferative signaling. Collectively, these findings define a previously unrecognized TRIM59–PTRF–AKT/c‐Myc axis that drives BLCA progression and highlight TRIM59 as a potential prognostic biomarker and therapeutic target.
Keywords: bladder cancer, proliferation, PTRF, TRIM59, ubiquitination
Schematic model of TRIM59‐driven BLCA progression through K48‐linked ubiquitination and proteasomal degradation of PTRF, leading to AKT activation and c‐Myc upregulation.

Abbreviations
- BLCA
bladder cancer
- CCK‐8
cell counting kit‐8
- CHX
cCycloheximide
- co‐IP
co‐immunoprecipitation
- DAB
33′’‐diaminobenzidine
- GEO
Gene Expression Omnibus
- IF
immunofluorescence
- IHC
immunohistochemistry
- MS
mass spectrometry
- NAT
normal adjacent tissue
- PLA
proximity ligation assay
- PTRF/Cavin‐1
caveolae associated protein 1
- qRT‐PCR
quantitative reverse transcriptase polymerase chain reaction
- TCGA
The Cancer Genome Atlas
- TRIM59
tripartite motif containing 59
- Ub
ubiquitination
1. Introduction
Bladder cancer (BLCA) remains a major global health challenge. In 2022, it was the ninth most commonly diagnosed malignancy worldwide, with an estimated 614,000 new cases and 220,000 deaths annually [1]. BLCA is a heterogeneous epithelial tumor that most often presents as non‐muscle‐invasive disease (NMIBC); however, roughly one quarter of patients are diagnosed with muscle‐invasive (MIBC) or metastatic disease at first presentation, which is associated with poor outcomes [2]. Although cancer therapeutics have advanced considerably, progress in translating emerging molecular targets into effective diagnostic and treatment strategies for BLCA has been limited, highlighting the need to better define the mechanisms that drive tumor progression and metastasis.
The tripartite motif (TRIM) family comprises more than 80 proteins involved in a wide range of cellular processes, including morphogenesis, cell‐cycle regulation, signal transduction, transcription, DNA repair, and protein homeostasis [3, 4, 5]. TRIM proteins share a characteristic domain organization with an N‐terminal RING finger, B‐box, and coiled‐coil domains, and the RING domain generally confers E3 ubiquitin ligase activity [6]. TRIM59 is a representative TRIM protein with E3 ligase activity and is frequently overexpressed in several malignancies, including renal, pancreatic, prostate, ovarian, and hepatocellular cancers, where elevated expression is linked to advanced disease and worse survival [7, 8, 9, 10, 11]. Mechanistically, TRIM59 has been reported to promote hepatocellular carcinoma growth by driving degradation of protein phosphatase 1B [11] and to facilitate tumorigenesis in clear cell renal cell carcinoma through ubiquitination‐dependent degradation of ACAT1 at K174, disrupting mitochondrial lipid metabolism and cardiolipin homeostasis [7]. In BLCA, TRIM59 has been implicated in regulating tumor cell behaviors through ferroptosis [12], but its precise oncogenic mechanism remains unclear.
In the present study, we found that TRIM59 is markedly upregulated in BLCA tissues and that higher TRIM59 expression is associated with poorer patient survival. Gain‐ and loss‐of‐function analyses showed that TRIM59 promotes tumor growth, facilitates cell‐cycle progression, and enhances cell motility and metastatic potential in vitro and in vivo. Mechanistically, TRIM59 directly binds to Caveolae Associated Protein 1 (PTRF) and reduces its stability by accelerating ubiquitination‐dependent degradation, thereby impairing the tumor‐suppressive function of PTRF. Together, these data identify the TRIM59/PTRF axis as an important regulator of BLCA progression and suggest that targeting this pathway may offer therapeutic benefit.
2. Material and Methods
2.1. Cell Culture and Reagents
Human BLCA cell lines J82, SW780, T24, UMUC‐3, and 5637, along with the benign ureteral epithelial cell line SV‐HUC‐1, were obtained from the American Type Culture Collection (ATCC, USA). T24 and 5637 cells were maintained in RPMI‐1640 medium (Corning, USA) supplemented with 10% fetal bovine serum (FBS; Pricella, China) and 1% penicillin–streptomycin (Beyotime, China). J82, UMUC‐3, and SW780 cells were cultured in DMEM (Corning, USA) containing 10% FBS and 1% penicillin–streptomycin. All cells were incubated at 37°C in a humidified atmosphere with 5% CO2.
Cycloheximide (CHX; S7418) and the proteasome inhibitor MG132 (S2619) were purchased from Selleck (USA).
2.2. Collection of Clinical Specimens
Primary BLCA specimens were collected from the Department of Urology, the First Affiliated Hospital of Chongqing Medical University, between May 2024 and September 2025. Written informed consent was obtained from all participants prior to sample collection. The study protocol was reviewed and approved by the hospital's Ethics Committee and was conducted in accordance with the principles of the Declaration of Helsinki.
2.3. Collection and Analysis of Public Datasets
RNA‐seq expression data and corresponding clinical annotations were retrieved from The Cancer Genome Atlas (TCGA) via the Genomic Data Commons (GDC) portal (https://portal.gdc.cancer.gov/). Nineteen BLCA cases with matched adjacent normal tissues were included in the subsequent analyses. All analyses were performed in accordance with TCGA data access policies and publication guidelines.
For external validation, the mRNA expression matrices and follow‐up information for the GSE13507 and GSE154261 cohorts were downloaded from the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/) for analyze survival.
2.4. RNA Isolation and Quantitative Reverse Transcriptase Polymerase Chain Reaction (qRT‐PCR)
Total RNA was isolated from cultured BLCA cells using TRIzol reagent (Invitrogen, Thermo Fisher) following the manufacturer's protocol. First‐strand cDNA was generated from 1 μg of RNA using the PrimeScript RT reagent kit (Takara, Japan). Quantitative PCR was carried out with SYBR Green chemistry (Takara, Japan) on an ABI 7500 Real‐Time PCR platform (Applied Biosystems). Relative transcript abundance was determined using the 2−ΔΔCq approach, with GAPDH serving as the internal reference. Primer sequences (Invitrogen, Thermo Fisher) are provided in Table S1.
2.5. Western Blot
Western blot assays were performed according to the standard protocol [13]. Proteins from clinical tissues and cultured cells were lysed in RIPA buffer containing 1% PMSF (Beyotime) and quantified by BCA assay (Beyotime). Equal amounts were separated by 10% SDS‐PAGE, transferred to PVDF membranes, and blocked with 5% milk for 2 h at room temperature. Membranes were incubated overnight at 4°C with primary antibodies (listed in Table S2), followed by an HRP‐conjugated secondary antibody (1:1000; ab6721, Abcam) for 2 h. Bands were developed with ECL (Thermo Scientific) and imaged on a Bio‐Rad chemiluminescence system.
2.6. Immunohistochemistry (IHC) Assay
Paraffin‐embedded specimens were cut into 4 μm sections for IHC staining. Sections were deparaffinized and rehydrated, followed by heat‐induced antigen retrieval in sodium citrate buffer. Endogenous peroxidase activity was quenched with 3% hydrogen peroxide, and nonspecific binding was blocked with 10% goat serum. The slides were then incubated with primary antibodies at 4°C overnight. After three washes with phosphate‐buffered saline (PBS), sections were incubated with the appropriate secondary antibody at room temperature. Immunoreactivity was visualized using a 3,3′‐diaminobenzidine (DAB) kit (ZSGB‐BIO), and nuclei were counterstained with hematoxylin. IHC scoring was performed based on staining intensity and the proportion of positive cells, as previously described [14]. Antibodies used are listed in Table S2.
2.7. Cellular Transfections
Lentiviral vectors LV6 (EF‐1a/Puro) and LV‐12 (pGLVH6/luci05/Puro) (GenePharma, Shanghai, China) were used to generate TRIM59‐overexpressing and TRIM59‐silenced BLCA cells, respectively. Lentiviral infection was performed in the presence of polybrene, and stable clones were selected with puromycin beginning 48 h after transduction. Stable pcDNA3.1‐PTRF cell lines were established by G418 selection. The efficiency of stable cell line construction was confirmed by qRT‐PCR and immunoblotting.
Small interfering RNA (siRNA) was obtained from GenePharma and introduced using Lipofectamine 2000 (Invitrogen, Thermo Fisher) according to the manufacturer's instructions. Cells were harvested 36–48 h post‐transfection for RNA and protein extraction. The RNAi sequences are listed below: shTRIM59‐1: TTTCAACCAACACATCATAAC; shTRIM59‐2: CTGAAGCCTCTCTATCTGTTT; shTRIM59‐3: AGTGATAAGGCATGGCTTAAA.
siPTRF: GAGCATCAGCAAATCGCTGAA.
siMYC: CCTGAGACAGATCAGCAACAA.
siNC: GUCAUCGACUGAUCGUCAUUC.
2.8. Immunofluorescence (IF)
Cells cultured on coverslips were fixed with 4% paraformaldehyde, permeabilized with 0.1% Triton X‐100, and blocked in 5% BSA. The samples were incubated overnight at 4°C with primary antibodies (provided in Table S2), followed by CoraLite Plus 594‐conjugated goat anti‐rabbit IgG (RGAR004, Proteintech) at room temperature. Nuclei were stained with DAPI. Fluorescence images were acquired using a Leica confocal microscope (Leica Microsystems, Germany).
2.9. Co‐Immunoprecipitation and Mass Spectrometry
Cells were lysed in Western blot/IP lysis buffer (Beyotime, China) supplemented with 1% PMSF and a protease inhibitor cocktail. After clarification, the supernatants were incubated overnight with the indicated primary antibody or species‐matched IgG control. Protein A/G magnetic beads (Bimake, China) were then added and rotated gently to capture immune complexes. Bead‐bound proteins were washed with IP lysis buffer, eluted in 2 × SDS loading buffer (Beyotime, China), and heat‐denatured. The eluates were resolved by SDS‐PAGE. Gels were silver‐stained using the Fast Silver Stain Kit (Beyotime, China) following the manufacturer's instructions to compare bands between the IgG control and immunoprecipitation lanes. Bands of interest were excised and submitted to PTM BIO (Hangzhou, China) for LC‐MS/MS analysis.
2.10. GST Pull‐Down
The GST‐TRIM59 fusion protein was produced in BL21 (DE3) Escherichia coli . Bacterial lysates were incubated with glutathione‐Sepharose beads (Beyotime) at 4°C for 2 h to immobilize GST‐tagged proteins. The GST‐bound beads were then incubated with cell lysates at 4°C overnight, followed by four washes with lysis buffer. Bound proteins were eluted by boiling in SDS sample buffer and analyzed by Western blot.
2.11. Animal Models
Male BALB/c nude mice (6 weeks old) were obtained from Tengxin Biotechnology (Chongqing, China). All animal experiments were conducted in compliance with the ARRIVE guidelines and institutional animal care requirements.
For the subcutaneous xenograft model, J82 cells (5 × 106) were injected into the right axillary region of each mouse (n = 5 per group). Tumor growth was monitored every 7 days using caliper measurements after tumors became palpable. Mice were sacrificed 4 weeks after inoculation, and excised tumors were fixed in paraformaldehyde and paraffin‐embedded for immunohistochemical analysis. For in vivo PTRF knockdown, T24 cells (5 × 106) were implanted subcutaneously in the right axillary region. One week later, mice were randomized into two groups (n = 5 per group) and received intratumoral injections of control or PTRF siRNA (GenePharma) at 5 nM per mouse in 20 μL PBS, administered twice weekly for 3 consecutive weeks.
To establish the lung metastasis model, UMUC‐3 cells (2 × 106) were injected via the tail vein (n = 5 per group). Mice were euthanized 6 weeks after injection, and lung tissues were harvested for H&E staining to quantify the number and burden of pulmonary metastatic lesions.
Other materials and methods used in this study are listed in the “Supporting Information and Methods Data S1” file.
2.12. Statistical Analysis
Data are shown as the mean ± standard deviation (SD). Differences between two groups were assessed using an unpaired two‐tailed Student's t‐test, whereas comparisons among three or more groups were evaluated by one‐way ANOVA followed by Tukey's multiple‐comparison test. The chi‐square test was employed to examine the relationship between TRIM59 expression and clinical parameters. Spearman's rank correlation analysis was used to examine associations between variables. Survival was analyzed using the Kaplan–Meier method, with significance determined by the log‐rank test. A two‐sided p value < 0.05 was considered statistically significant. All statistical analyses were performed using GraphPad Prism (version 8.0).
3. Results
3.1. TRIM59 Is Upregulated in BLCA and Predicts Poor Clinical Outcomes
To identify key oncogenic drivers within the tripartite motif (TRIM) protein family that contribute to BLCA progression, we performed differential expression analysis using RNA sequencing data from 19 BLCA tissue samples and their matched normal counterparts obtained from the TCGA‐BLCA cohort, which identified 15 candidates exhibiting aberrant expression patterns (Figure 1A). Feature‐selection algorithms, including Boruta, XGBoost, and Lasso, consistently ranked TRIM59 as one of the top discriminative features distinguishing tumor from normal tissues (Figure 1B). TRIM59 has been characterized as an oncogenic member of the TRIM family in diverse malignancies; however, its specific role in the progression of bladder urothelial carcinoma (BLCA) remains to be elucidated. Receiver operating characteristic (ROC) analysis demonstrated strong diagnostic performance of TRIM59 in TCGA‐BLCA (Figure 1C). Further analysis of paired tumor‐normal samples across the TCGA pan‐cancer cohorts revealed that TRIM59 expression was notably upregulated in tumor tissues compared to their matched adjacent normal counterparts in the majority of solid tumors (Figure 1D). Clinicopathological analysis revealed that TRIM59 expression differed significantly among clinical stage groups in the IMvigor210 cohort (Figure 1E). Similarly, TRIM59 expression was higher in patients with high pathological grade than in those with low grade in the GSE13507 and GSE19423 datasets (Figure 1F). Survival analyses across multiple independent cohorts (GSE13507, GSE154261, and TCGA) revealed that high TRIM59 expression was significantly associated with reduced overall survival (OS, p = 0.007), progression‐free survival (PFS, p = 0.036), and disease‐free survival (DFS, p = 0.048) (Figure 1G). Moreover, pan‐cancer Kaplan–Meier analyses showed that patients with TRIM59‐high tumors had significantly poorer disease‐specific survival than those in the TRIM59‐low group (Figure S1). This association was observed across multiple tumor types, including esophageal carcinoma (ESCA), kidney renal clear cell carcinoma (KIRC), kidney renal papillary cell carcinoma (KIRP), lower‐grade glioma (LGG), liver hepatocellular carcinoma (LIHC), lung adenocarcinoma (LUAD), pancreatic adenocarcinoma (PAAD), prostate adenocarcinoma (PRAD), rectal adenocarcinoma (READ), and uterine corpus endometrial carcinoma (UCEC).
FIGURE 1.

TRIM59 is upregulated in bladder cancer and correlates with adverse prognosis. (A) Heatmap of differentially expressed TRIM family members in 19 paired bladder cancer (BLCA) and adjacent normal tissues from the TCGA‐BLCA cohort. (B) Feature‐selection analyses using Boruta (top left), XGBoost (top right), and LASSO (bottom) identify TRIM59 as a key gene discriminating tumor from normal samples. (C) Receiver operating characteristic (ROC) curve assessing the diagnostic performance of TRIM59 in the TCGA‐BLCA dataset. (D) Differential expression of TRIM59 between normal and tumor tissues across multiple cancer types, including BLCA. Statistical analysis was performed using a paired t‐test. (E) TRIM59 expression across clinical stages in the TCGA‐BLCA cohort. Statistical analysis was performed using a Kruskal–Wallis rank sum test. (F) TRIM59 expression in high‐ versus low‐grade BLCA in the GSE13507 and GSE19423 cohorts. (G) Kaplan–Meier analyses showing that elevated TRIM59 expression is associated with worse overall survival, progression‐free survival, and disease‐free survival in three independent BLCA cohorts (GSE13507, GSE154261, and TCGA). (H) Representative IHC staining of TRIM59 in normal adjacent tissue (NAT), non‐muscle‐invasive BLCA (NMIBC), and muscle‐invasive BLCA (MIBC), with quantification shown on the right (n = 30 per group). Data are presented as mean ± SD, and one‐way ANOVA was used for statistical analysis. (I) qRT‐PCR measurement of TRIM59 mRNA in normal urothelial SV‐HUC‐1 cells and BLCA cell lines (J82, SW780, T24, and UMUC‐3). Data are presented as mean ± SD. (J) Western blot analysis of TRIM59 protein levels in SV‐HUC‐1 cells and BLCA cells. *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001. One‐way ANOVA was used for statistical analysis.
We then checked the protein expression of TRIM59 in BLCA samples. Immunohistochemical staining confirmed high expression of TRIM59 in MIBC tissues (n = 30) relative to adjacent normal tissues (n = 30) and NMIBC samples (n = 30) (Figure 1H). We then analyzed the relationship between TRIM59 expression and clinicopathological features in our internal dataset, and found that high TRIM59 expression was significantly associated with advanced T stage (p = 0.010), higher pathological grade (p = 0.023), and disease recurrence (p = 0.034), but not with age, gender, lesion number, or tumor size (Table 1). In addition, we detected TRIM59 expression in various BLCA cells at the transcriptional and protein levels. Consistently, TRIM59 expression was elevated in BLCA cell lines compared with normal urothelial cells at both mRNA and protein levels (Figure 1I,J). These results indicate that TRIM59 is overexpressed in BLCA and associated with advanced clinical features and poor prognosis.
TABLE 1.
Clinicopathological characteristics of TRIM59 expression.
| Parameter number | TRIM59 expression | p | ||
|---|---|---|---|---|
| Low high | ||||
| Gender | 0.733 | |||
| Female | 22 | 12 | 10 | |
| Male | 38 | 17 | 21 | |
| Age (year) | 0.301 | |||
| ≤ 65 y | 30 | 14 | 16 | |
| 65 y | 30 | 18 | 12 | |
| Tumor size | 0.114 | |||
| ≤ 3 cm | 36 | 21 | 15 | |
| 3 cm | 24 | 9 | 15 | |
| Tumor number | 0.409 | |||
| Unifocal | 41 | 26 | 15 | |
| Multifocal | 19 | 11 | 8 | |
| Grade | 0.023 | |||
| Low | 28 | 16 | 12 | |
| High | 32 | 9 | 23 | |
| T stage | 0.010 | |||
| Ta‐T1 | 30 | 19 | 11 | |
| T2‐T4 | 30 | 9 | 21 | |
| Recurrence | 0.034 | |||
| No | 41 | 29 | 12 | |
| Yes | 19 | 8 | 11 | |
Note: p values were calculated from χ2 test.
4. TRIM59 Expression Is Associated With Cell Cycle and Proliferative Signaling
To further delineate the biological programs linked to TRIM59, gene set variation analysis (GSVA) was performed using multiple publicly accessible GEO datasets. We observed that TRIM59 expression showed a consistent positive association with cell‐cycle and proliferation scores in six independent GEO datasets (Figure 2A). These relationships were further supported by pan‐cancer analyses, suggesting that the connection between TRIM59 and cell‐cycle/proliferative programs is broadly conserved (Figure 2B). Consistently, gene set enrichment analysis (GSEA) demonstrated significant enrichment of a cell‐cycle pathway (KEGG_CELL_CYCLE) and an invasion‐related signature (RIZKI_TUMOR_INVASIVENESS) in tumors with high TRIM59 expression (Figure 2C). Hallmark gene set analyses further indicated that TRIM59‐high tumors preferentially activated canonical oncogenic pathways, including MYC targets, mitotic spindle, G2/M checkpoint, E2F targets, and PI3K/AKT signaling, across multiple cohorts (Figure 2D). In addition, hormone‐ and PI3K‐associated signaling activities were elevated in the TRIM59‐high group (Figure 2E), supporting a role for TRIM59 in coordinating proliferative signaling and tumor growth.
FIGURE 2.

TRIM59 expression is associated with cell‐cycle progression and proliferation. (A) Correlation analyses between TRIM59 expression and cell‐cycle or proliferation scores across six independent BLCA cohorts (GSE13507, GSE19423, GSE37815, GSE48075, GSE48276, and GSE154261). R, spearman's correlation coefficient. (B) Pan‐cancer correlation analysis showing positive associations between TRIM59 expression (z‐score) and cell‐cycle/proliferation signatures (combined z‐score). (C) GSEA demonstrating significant enrichment of KEGG cell cycle and an invasion‐related gene set in TRIM59‐high BLCA tumors. NES, normalized enrichment score. (D) Bubble plot summarizing hallmark pathway enrichment associated with TRIM59 across multiple BLCA datasets. The pathways include Myc targets, mTORC1 signaling, G2/M checkpoint, mitotic spindle, and E2F targets. (E) Estrogen signaling and PI3K activity scores in TRIM59‐low versus TRIM59‐high tumors, compared using the Wilcoxon rank‐sum test.
5. TRIM59 Drives BLCA Cell Proliferation and Cell‐Cycle Progression in Vitro and in Vivo
To define the role of TRIM59 in bladder cancer, we performed complementary loss‐ and gain‐of‐function assays in BLCA cell lines. TRIM59 was silenced in T24 and UMUC‐3 cells using lentiviral shRNAs, whereas TRIM59 was ectopically expressed in J82 cells via a lentiviral overexpression vector. RT‐qPCR and Western blot confirmed efficient TRIM59 knockdown and overexpression, respectively (Figure 3A,B). CCK‐8 assays showed that TRIM59 depletion markedly reduced the proliferation of T24 and UMUC‐3 cells, while TRIM59 overexpression significantly enhanced J82 cell growth (Figure 3C). Consistently, colony formation assays demonstrated impaired clonogenicity upon TRIM59 knockdown and increased colony‐forming ability following TRIM59 overexpression (Figure 3D). Cell‐cycle analysis by flow cytometry revealed that TRIM59 silencing led to G1‐phase accumulation with a concomitant decrease in the S‐phase fraction, whereas TRIM59 overexpression promoted G1/S progression (Figure 3E). In xenograft models, enforced TRIM59 expression accelerated tumor growth and resulted in larger tumor volumes compared with controls (Figure 3F,G). Immunohistochemical staining further showed higher Ki‐67 positivity in TRIM59‐overexpressing tumors, supporting increased proliferative activity in vivo (Figure 3H). Together, these results indicate that TRIM59 promotes BLCA cell proliferation.
FIGURE 3.

TRIM59 promotes BLCA cell proliferation and tumor growth. (A) qRT‐PCR confirming TRIM59 knockdown in T24 and UMUC‐3 cells and TRIM59 overexpression in J82 cells. (B) Immunoblot validation of TRIM59 depletion or overexpression in the indicated BLCA cell lines. (C) CCK‐8 assays showing proliferation of TRIM59‐silenced T24 and UMUC‐3 cells and TRIM59‐overexpressing J82 cells. (D) Representative colony formation images and quantification following TRIM59 knockdown in T24 and UMUC‐3 cells or TRIM59 overexpression in J82 cells. (E) Flow cytometric cell‐cycle profiling of BLCA cells with altered TRIM59 expression, with quantification shown on the right. Statistical analysis was performed using one‐way ANOVA. The experiment was repeated three times. (F) Representative images of xenograft tumors generated from J82 cells with or without TRIM59 overexpression (n = 5 per group). (G) Tumor growth curves of xenografts over time. (H) Representative Ki‐67 IHC staining of xenograft tumors with quantification (scale bar: 100 μm). Data are presented as mean ± SD; *p < 0.05, **p < 0.01 and ***p < 0.001. Mean ± SD values were statistically analyzed using a t‐test.
6. TRIM59 Enhances Invasion, Migration, and Metastatic Potential of BLCA Cells
We next evaluated whether TRIM59 influences the invasive and migratory behavior of BLCA cells. In Matrigel‐coated Transwell assays, TRIM59 silencing markedly reduced invasion in T24 and UMUC‐3 cells, whereas enforced TRIM59 expression significantly increased the invasive capacity of J82 cells (Figure 4A,B). Consistent with these findings, TRIM59 silencing attenuated EMT, as indicated by increased E‐cadherin expression and reduced levels of N‐cadherin and vimentin in T24 and UMUC‐3 cells (Figure 4C). EMT induction by TRIM59 was further supported in xenograft tissues, where tumors with TRIM59 overexpression displayed stronger vimentin staining (Figure 4D). In wound‐healing assays, TRIM59 knockdown impaired cell motility, whereas TRIM59 overexpression accelerated wound closure (Figure 4E,F). Moreover, in vivo metastasis models showed that loss of TRIM59 substantially diminished metastatic burden, as assessed by bioluminescence imaging and histopathological examination of metastatic lesions (Figure 4G,H). Collectively, these data indicate that TRIM59 promotes BLCA cell migration and invasion by facilitating EMT in vitro and enhances distant metastatic dissemination in vivo.
FIGURE 4.

TRIM59 enhances BLCA cell invasion, migration, and metastatic dissemination. (A) Representative images and quantification of Matrigel‐coated Transwell invasion assays in T24 and UMUC‐3 cells after TRIM59 knockdown. (B) Transwell invasion assays showing enhanced invasiveness of J82 cells upon TRIM59 overexpression. (C) Immunoblot analysis of EMT markers in T24 and UMUC‐3 cells following TRIM59 knockdown. (D) Representative IHC staining of TRIM59 and vimentin in xenograft tumors (scale bar: 50 μm). (E) Wound‐healing assays showing reduced migratory capacity of T24 cells upon TRIM59 silencing. (F) Wound‐healing assays showing accelerated wound closure in J82 cells with TRIM59 overexpression; quantification of wound closure is shown on the right. Scale bar: 200 μm. (G) Representative bioluminescence images of metastatic burden in mice injected with shNC‐ or shTRIM59‐expressing T24 cells. (H) Representative H&E staining of metastatic lesions with quantification of metastasis foci in the shNC and shTRIM59 groups (n = 5 per group). Data are presented as mean ± SD; **p < 0.01, and ***p < 0.001. Statistical significance was determined using Student's t‐test for (B, F) and one‐way ANOVA for (A, D and H).
7. PTRF Is Identified as a Novel TRIM59 Interactor and Putative Substrate
To elucidate the molecular basis of TRIM59 function, we used immunoprecipitation followed by mass spectrometry to screen for TRIM59‐associated proteins. Whole‐cell lysates from J82 cells expressing Flag‐tagged TRIM59 were immunoprecipitated with an anti‐Flag antibody, with species‐matched IgG serving as a control. Silver staining revealed distinct bands in the Flag‐TRIM59 precipitates compared with the IgG group (Figure 5A). Mass spectrometry identified 11 proteins specifically enriched in the Flag‐TRIM59 complex, including PTRF, HSPA9, GAPDH, TNX, ANP32B, XPNPEP3, ERGIC1, DCD, ZYX, ATP5F1A, and PSME1 (Figure 5B; Table 2). Among these, PTRF emerged as a previously unreported TRIM59‐binding partner. Given the context‐dependent roles of PTRF in cancer progression [15, 16] and the limited understanding of its function in BLCA, we prioritized PTRF for further investigation. The PTRF peptide coverage identified by mass spectrometry is shown in Figure 5C. Molecular docking suggested a direct interaction interface between TRIM59 and PTRF, with TRIM59 residue F326 and PTRF residue K240 predicted to contribute to binding (Figure 5D). Endogenous co‐immunoprecipitation confirmed the association of TRIM59 with PTRF in T24 and UMUC‐3 cells (Figure 5E,F), and confocal microscopy demonstrated prominent cytoplasmic colocalization of the two proteins (Figure 5G). The interaction was also validated under ectopic expression conditions in J82 cells co‐transfected with Flag‐TRIM59 and HA‐PTRF (Figure 5H). To test the docking prediction, we generated a PTRF K240A mutant and found that this substitution markedly weakened PTRF binding to TRIM59 (Figure 5I), indicating that K240 is important for the interaction. Proximity ligation assays (PLA) further supported a direct endogenous interaction in the cytoplasm of T24 and UMUC‐3 cells (Figure 5J). Consistently, GST pull‐down assays confirmed a physical association between TRIM59 and PTRF (Figure 5K). Taken together, these data identify PTRF as a previously unrecognized TRIM59‐interacting protein and support PTRF as a candidate TRIM59 substrate.
FIGURE 5.

TRIM59 physically interacts with PTRF in BLCA cells. (A) Silver staining of proteins immunoprecipitated from Flag‐TRIM59‐expressing J82 cells. (B) Venn diagram summarizing proteins identified by mass spectrometry in TRIM59 immunoprecipitates and controls. (C) Mass spectrometry identifying PTRF as a TRIM59‐interacting protein. (D) Protein–protein docking model depicting the predicted TRIM59‐PTRF binding interface. (E, F) Endogenous co‐IP assays confirming the interaction between TRIM59 and PTRF in T24 and UMUC‐3 cells. (G) Confocal immunofluorescence images showing cytoplasmic colocalization of TRIM59 (red) and PTRF (green) in BLCA cells. (H) Co‐IP and immunoblotting validating the exogenous binding between Flag‐TRIM59 and HA‐PTRF in J82 cells. (I) Co‐IP followed by Western blot utilized to determine the effect of PTRF K240A mutation on its binding to TRIM59 in J82 cells. K, lysine; A, alanine. (J) Proximity ligation assay (PLA) demonstrating an in situ interaction between endogenous TRIM59 and PTRF in T24 and UMUC‐3 cells. (K) GST pull‐down assay indicating a direct TRIM59‐PTRF interaction in vitro.
TABLE 2.
Candidate proteins screened by protein profiling.
| Accession | Protein names | Gene names | MW [kDa] |
|---|---|---|---|
| Q6NZI2 | Caveolae‐associated protein 1 | PTRF | 43.5 |
| P38646 | Stress‐70 protein, mitochondrial | HSPA9 | 73.6 |
| P04406 | Glyceraldehyde‐3‐phosphate dehydrogenase | GAPDH | 36 |
| P10599 | Thioredoxin | TXN | 11.7 |
| Q92688 | Acidic leucine‐rich nuclear phosphoprotein 32 family member B | ANP32B | 28.8 |
| Q9NQH7 | Xaa‐Pro aminopeptidase 3 | XPNPEP3 | 57 |
| Q969X5 | Endoplasmic reticulum‐Golgi intermediate compartment protein 1 | ERGIC1 | 32.6 |
| P81605 | Dermcidin | DCD | 11.3 |
| Q15942 | Zyxin | ZYX | 61.2 |
| P25705 | ATP synthase subunit alpha, mitochondrial | ATP5F1A | 59.7 |
| Q06323 | Proteasome activator complex subunit 1 | PSME1 | 28.7 |
8. TRIM59 Drives Proteasome‐Dependent PTRF Turnover via K48‐Linked Polyubiquitination
Given that TRIM59 is an E3 ubiquitin ligase, we next asked whether it regulates PTRF protein stability in BLCA cells. Altering TRIM59 expression had no appreciable effect on PTRF mRNA levels, as assessed by RT‐qPCR in knockdown and overexpression settings (Figure 6A,B). In contrast, immunoblotting showed that TRIM59 overexpression reduced PTRF protein abundance in J82 cells, whereas TRIM59 depletion increased PTRF levels in T24 and UMUC‐3 cells (Figure 6C,D). A similar post‐transcriptional effect was observed in HEK‐293 T cells, where ectopic Flag‐TRIM59 decreased HA‐PTRF protein levels (Figure 6E). To determine whether PTRF is degraded through the ubiquitin‐proteasome system, we treated TRIM59‐overexpressing J82 cells with the proteasome inhibitor MG132. MG132 largely restored PTRF protein levels, supporting proteasome‐dependent turnover (Figure 6F). Consistently, a cycloheximide (CHX) assay was performed to analyze the effect of alterations in TRIM59 expression on the turnover rate of PTRF protein, and the results showed that TRIM59 markedly shortened the half‐life of PTRF (Figure 6G). Ubiquitination assays further demonstrated that TRIM59 increased the ubiquitination of PTRF (Figure 6H,I), whereas the RING domain‐deleted TRIM59 mutant partially reversed this effect (Figure S2A). Furthermore, we performed an in vitro ubiquitination assay with purified components, and found that wild‐type TRIM59 induced ubiquitination of PTRF, whereas the RING‐domain mutant exhibited markedly weaker activity than the wild‐type protein (Figure S2B), indicating that TRIM59 directly ubiquitinates PTRF in a manner dependent on its RING domain E3 ligase activity.
FIGURE 6.

TRIM59 promotes K48‐linked polyubiquitination and proteasomal degradation of PTRF. qRT‐PCR analysis of PTRF mRNA levels after TRIM59 knockdown in T24 and UMUC‐3 cells (A) or TRIM59 overexpression in J82 cells (B). A t‐test was used for B and G, and one‐way ANOVA for A. (C, D) Immunoblotting of PTRF protein levels following TRIM59 silencing in T24 and UMUC‐3 cells (C) or TRIM59 overexpression in J82 cells (D). (E) Immunoblot showing the effect of ectopic Flag‐TRIM59 on HA‐PTRF protein abundance in HEK‐293 T cells. (F) MG132 treatment (40 μM, 8 h) rescues PTRF protein levels in TRIM59‐overexpressing J82 cells, as assessed by immunoblotting. (G) Cycloheximide (CHX) chase assays demonstrating reduced PTRF protein half‐life upon TRIM59 expression; the protein degradation curves are shown on the right. (H, I) Ubiquitination assays showing that TRIM59 increases PTRF polyubiquitination in BLCA cells. (J) Co‐IP and immunoblot analysis of TRIM59‐induced PTRF ubiquitination using His‐tagged ubiquitin mutants (K48R or K63R). (K) Ubiquitination assays comparing PTRF wild‐type (PTRFWT) and mutant (PTRFK240A), indicating that K240 is required for TRIM59‐mediated K48‐linked PTRF polyubiquitination. (L) Representative IHC staining of TRIM59 and PTRF in BLCA specimens and correlation analysis of protein expression (n = 28). Case A: TRIM59‐high/PTRF‐low; Case B: TRIM59‐low/PTRF‐high. ns, not significant. **p < 0.01. r, spearman's correlation.
We next performed additional ubiquitination assays using PTRF lysine mutants. Based on predictions from the GPS‐Uber online tool (GPS‐Ubiquitin Protein Ligase‐Substrate Relationship Predictor; http://gpsuber.biocuckoo.cn/) [17], nine lysine residues were predicted as potential ubiquitination sites (Figure S3A). Evolutionary conservation analysis showed that most of these residues, with the exception of K173, were highly conserved across multiple species (Figure S3B). We therefore selected eight candidate lysine residues for site‐directed mutagenesis and subsequent analysis. The results showed that mutation of K98, K122, K152, and K317 significantly reduced TRIM59‐mediated ubiquitination of PTRF and attenuated PTRF degradation, suggesting that these residues represent major ubiquitination sites in PTRF (Figure S3C).
Because distinct ubiquitin chain linkages confer different outcomes, K48‐linked chains typically target substrates for proteasomal degradation, whereas K63‐linked chains are more often associated with nondegradative signaling functions [18], we next examined the linkage type involved. HEK‐293 T cells were cotransfected with Flag‐TRIM59 and HA‐PTRF together with His‐tagged ubiquitin mutants (K48R or K63R). TRIM59‐driven PTRF ubiquitination was markedly reduced in the K48R setting, whereas the K63R mutant had little effect, indicating a predominant requirement for K48‐linked polyubiquitination (Figure 6J). Notably, the PTRF K240A mutant also exhibited reduced K48‐linked ubiquitination compared with wild‐type PTRF, consistent with the importance of this residue for TRIM59‐PTRF interaction and subsequent modification (Figure 6K). Finally, IHC of 28 cases of clinical BLCA specimens revealed an inverse correlation between TRIM59 and PTRF protein expression (Figure 6L). Taken together, these findings indicate that TRIM59 promotes K48‐linked polyubiquitination of PTRF, thereby accelerating its proteasomal degradation.
9. TRIM59‐Driven BLCA Progression Is PTRF‐Dependent
The expression landscape and functional relevance of PTRF across cancers remain incompletely defined. Analysis of paired tumor and adjacent normal tissues from TCGA pan‐cancer cohorts showed that PTRF expression was reduced in tumor samples relative to matched normal counterparts in most solid malignancies (Figure S4A). In line with this observation, IHC of 20 clinical cases demonstrated markedly lower PTRF protein levels in BLCA tissues than in paired normal adjacent tissues (Figure 7A). Across pan‐cancer datasets, PTRF expression was inversely correlated with cell‐cycle programs (Figure S4B). Similarly, PTRF levels were consistently negatively associated with cell‐cycle scores in three independent BLCA GEO cohorts (Figure S4C). Hallmark pathway analyses further indicated that PTRF‐high tumors exhibited reduced activity of canonical oncogenic programs, including MYC targets, the G2/M checkpoint, and E2F targets, across multiple cohorts (Figure S4D), a pattern opposite to that observed for TRIM59. Moreover, enforced PTRF expression reduced MYC mRNA levels and decreased c‐Myc and cyclin D1 protein levels in T24 cells (Figure S4E,F). A MYC promoter luciferase reporter assay showed that PTRF overexpression significantly suppressed, whereas PTRF depletion enhanced, MYC promoter activity in T24 cells. Notably, ectopic expression of constitutively active Akt (myr‐AKT1) largely rescued the reduction in MYC promoter activity induced by PTRF overexpression, while treatment with LY294002 attenuated the increase in promoter activity caused by PTRF silencing (Figure S4G). Consistently, qRT‐PCR analysis revealed that TRIM59 loss reduced MYC mRNA expression, whereas PTRF silencing partially reversed this effect in T24 cells (Figure S4H). Immunoblotting analysis demonstrated that TRIM59 silencing attenuated c‐Myc and cyclin D1 protein levels, while PTRF depletion restored their expression (Figure S4I). In addition, PTRF knockdown increased Akt phosphorylation, accompanied by elevated c‐Myc expression, whereas treatment with LY294002 markedly attenuated the increase in c‐Myc expression in J82 cells (Figure S4J,K). Finally, survival analysis showed that patients with TRIM59‐high/PTRF‐low tumors had the poorest prognosis among the examined subgroups (Figure S4L). These data support a tumor‐suppressive role for PTRF, at least in part through restraining the cell proliferation program via AKT pathway inactivation.
FIGURE 7.

PTRF deficiency mediates the oncogenic effects of TRIM59 in BLCA (A) Representative IHC images and quantitative analysis of PTRF expression in BLCA tissues and matched normal adjacent tissues (NATs) (n = 20 per group). (B, C) CCK‐8 assays evaluating the proliferation of T24 (B) and J82 (C) cells under the indicated treatments. Data represent three independent experiments. (D, E) Colony formation assays assessing the clonogenic capacity of T24 and J82 cells following the indicated manipulations. Data represent four independent experiments. (F) Flow cytometric analysis of cell‐cycle distribution in T24 cells following combined modulation of TRIM59 and PTRF. (G, H) Representative Matrigel‐coated Transwell invasion assays in T24 (G) and J82 (H) cells following combined modulation of TRIM59 and PTRF. Data represent three independent experiments. (I) Representative xenograft images and tumor growth curves derived from T24 cells with the indicated genetic manipulations (n = 5 per group). (J) Tumor weights measured at the experimental endpoint. (K) Representative IHC staining for TRIM59, PTRF, Ki‐67, and c‐Myc in xenograft tumors. Data are presented as mean ± SD. Statistical significance was determined using Student's t‐test for (A) and one‐way ANOVA for (B–J). *p < 0.05, **p < 0.01, and ***p < 0.001.
To determine whether PTRF is required for the tumor‐promoting activity of TRIM59, we performed a series of rescue experiments. In vitro, siRNA‐mediated PTRF depletion increased cell proliferation and partially alleviated the growth suppression caused by TRIM59 knockdown in T24 cells (Figure 7B). In contrast, ectopic PTRF expression restrained proliferation and diminished the growth advantage induced by TRIM59 overexpression in J82 cells (Figure 7C). Colony formation assays yielded similar results, showing that loss of PTRF mitigated the reduction in clonogenicity induced by TRIM59 depletion in T24 cells (Figure 7D), whereas PTRF re‐expression counteracted TRIM59‐driven clonogenic growth in J82 cells (Figure 7E). Flow cytometric analysis further demonstrated that the G1/S arrest induced by TRIM59 silencing was largely reversed upon PTRF depletion (Figure 7F). Interestingly, the RING mutant showed a markedly reduced ability to promote cell proliferation (Figure S5A,B), indicating that the pro‐proliferative effect of TRIM59 is largely dependent on its E3 ligase activity. In addition, the reduced invasive capacity caused by TRIM59 depletion in T24 cells was partially restored by PTRF silencing (Figure 7G), whereas the enhanced invasion induced by TRIM59 overexpression in J82 cells was attenuated by PTRF reintroduction (Figure 7H). Consistently, the changes in mesenchymal marker expression induced by TRIM59 were also partially reversed by modulation of PTRF (Figure S5C), indicating that PTRF is functionally involved in mediating the effects of TRIM59 on BLCA cell invasion and EMT. In vivo, simultaneous PTRF knockdown substantially weakened the tumor‐suppressive effects of TRIM59 silencing, leading to increased tumor volume and tumor weight (Figure 7I,J). IHC staining of xenograft tumors confirmed higher PTRF expression in the absence of TRIM59, accompanied by corresponding changes in Ki‐67 and c‐Myc staining (Figure 7K, S5D).
To further determine whether the tumor‐suppressive effect of PTRF is mediated through the AKT‐c‐Myc axis, we performed Akt rescue and MYC silencing experiments in J82 cells. CCK‐8, colony formation, and cell‐cycle analyses showed that myr‐AKT1 partially rescued the inhibitory effects of PTRF overexpression on cell proliferation, whereas siMYC largely abolished this rescue effect (Figure 8A–C). Consistently, immunoblot analysis demonstrated that PTRF overexpression reduced p‐AKT, c‐Myc, and cyclin D1 levels, while myr‐AKT1 restored their expression; this effect was attenuated by MYC silencing (Figure 8D). These findings indicate that PTRF suppresses BLCA cell proliferation, at least in part, through the AKT‐c‐Myc axis.
FIGURE 8.

PTRF suppresses BLCA cell proliferation through the AKT‐c‐Myc axis. (A) CCK‐8 assays evaluating the proliferation of J82 cells under the indicated treatments. (B) Colony formation assays assessing the clonogenic capacity of J82 cells under the indicated treatments, with quantification shown on the right. (C) Flow cytometric analysis of cell‐cycle distribution in J82 cells under the indicated treatments, with quantification of the G1, G2, and S phase fractions shown below. (D) Immunoblot analysis of p‐AKT (S473), total AKT, c‐Myc, and cyclin D1 protein levels in J82 cells under the indicated treatments. Data are presented as mean ± SD from three independent experiments. Statistical significance was determined using one‐way ANOVA. The p values are indicated as follows: **p < 0.01, and ***p < 0.001. (E) Schematic model of TRIM59‐driven BLCA progression through K48‐linked ubiquitination and proteasomal degradation of PTRF, leading to AKT activation and c‐Myc upregulation.
Collectively, these data support a model in which TRIM59 drives BLCA progression by promoting E3 ligase‐dependent K48‐linked polyubiquitination and proteasomal degradation of PTRF, while PTRF loss increases c‐Myc expression by activating AKT signaling and thereby amplifies proliferative phenotypes (Figure 8E).
10. Discussion
In this work, we establish TRIM59 as an oncogenic driver in BLCA and uncover a mechanistic basis for its protumorigenic activity. By combining transcriptomic profiling with functional and mechanistic analyses, we demonstrate that TRIM59 is frequently upregulated in BLCA, is associated with advanced stage and adverse clinical outcomes, and promotes tumor cell proliferation, invasion, and metastatic potential. Mechanistically, TRIM59 directly engages PTRF and induces its K48‐linked polyubiquitination and proteasomal degradation, thereby lifting PTRF‐dependent restraint on c‐Myc and ultimately reinforcing malignant phenotypes in BLCA cells.
TRIM family proteins are increasingly appreciated as pivotal regulators of tumor biology, largely because many function as E3 ubiquitin ligases that reshape protein stability and signaling outputs. Notably, individual TRIM proteins can act as either oncogenes or tumor suppressors in a context‐dependent manner, often dictated by the identity of their interacting substrates. For example, TRIM44 has been reported to bind cytoplasmic vimentin via its B‐box domain and promote K48‐linked polyubiquitination and degradation of vimentin, thereby suppressing renal cell carcinoma growth and invasion [18]. In contrast, TRIM44 can stabilize TLR4 by protecting it from degradation, which promotes melanoma progression in an AKT/mTOR‐dependent manner both in vitro and in vivo [19]. Similarly, TRIM56 has been shown to interact with the SH3 domain of Src through its B‐box1 domain and catalyze Lys63‐linked polyubiquitination of Src at Lys184, enhancing Src clustering and activation to drive hepatocellular carcinoma progression [20]. Yet, in ovarian cancer, TRIM56 has also been described as a tumor suppressor by promoting ubiquitination‐dependent elimination of vimentin [21]. Together, these seemingly divergent findings underscore that the biological effects of TRIM proteins are highly substrate‐specific and shaped by cellular context. In contrast to TRIM44 and TRIM56, TRIM59 is generally regarded as an oncogenic TRIM family member across multiple malignancies, largely attributable to its E3 ubiquitin ligase activity toward tumor‐suppressive substrates. For example, TRIM59 has been reported to enhance proliferation and migration and to dampen ferroptosis by promoting p53 ubiquitination and degradation in digestive cancers [22, 23]. Nuclear TRIM59 facilitates ubiquitination‐dependent turnover of the tumor‐suppressive histone variant macroH2A1, thereby augmenting STAT3 signaling and tumorigenicity [24]. Our work extends this model to BLCA by identifying PTRF as a direct TRIM59‐interacting protein and a functionally relevant downstream effector. PTRF (also known as Cavin‐1) is an essential structural component of caveolae and has been implicated in membrane organization and signal transduction, with context‐dependent roles in tumor suppression and tumor promotion [25, 26]. Here, we found that PTRF is downregulated in BLCA and is associated with reduced cell‐cycle activity, consistent with a tumor‐suppressive function. Mechanistically, PTRF restrains G1/S progression, at least in part, by limiting c‐Myc signaling.
A recent study described EPIC‐0726, a proteolysis‐targeting chimera (PROTAC) that induces dose‐dependent PTRF degradation via the ubiquitin‐proteasome system [27]. However, the endogenous E3 ligases responsible for PTRF ubiquitination have remained unclear. In this study, we uncover a previously unrecognized TRIM59‐PTRF regulatory axis, demonstrating that TRIM59 targets PTRF for K48‐linked polyubiquitination and proteasomal degradation. Specifically, K98, K122, K152, and K317 were identified as major ubiquitination sites on PTRF, as mutation of these residues markedly attenuated PTRF degradation. Importantly, our rescue experiments further established PTRF as a critical functional mediator of TRIM59‐driven malignant phenotypes. Re‐expression of PTRF significantly blunts TRIM59‐induced cell proliferation, invasiveness, and EMT, whereas PTRF depletion partially reversed the suppressive effects of TRIM59 silencing on cell growth and invasion. Together, these findings indicate that PTRF is not merely an interacting partner of TRIM59 but a key downstream substrate that mediates, at least in part, the protumorigenic functions of TRIM59.
Clinically, our findings support TRIM59 as a prognostic biomarker in BLCA and potentially across a broader range of solid tumors. This notion is consistent with prior reports linking elevated TRIM59 to adverse outcomes in neuroblastoma [28, 29], ovarian cancer [30], pancreatic cancer [31], prostate cancer [9], hepatocellular carcinoma [11], and breast cancer [32]. The strong association between TRIM59 expression and patient survival, together with its functional contribution to tumor growth and metastasis, underscores its translational relevance. Notably, patients with TRIM59‐high/PTRF‐low tumors exhibited the poorest overall survival, suggesting that combined assessment of TRIM59 and PTRF may improve prognostic stratification.
Several limitations of this study should be acknowledged. First, the follow‐up period of our internal cohort is relatively short, which currently precludes a robust survival analysis, such as multivariate Cox regression. Second, although our data support an oncogenic role for TRIM59 in BLCA, whether TRIM59 influences therapeutic responsiveness or reveals actionable vulnerabilities remains to be determined. Third, while PTRF was identified as a key downstream target, it is unlikely to be the only substrate of TRIM59 in BLCA. TRIM59 may regulate additional substrates, particularly those involved in cell motility and metabolic regulation, which could also contribute to its protumorigenic effects. Fourth, the in vivo findings of the present study mainly support a role for TRIM59 in metastatic colonization, rather than the full spontaneous metastatic cascade. Last, although the present study establishes TRIM59 as the endogenous E3 ligase responsible for PTRF degradation and identifies major ubiquitination sites on PTRF, future studies employing ubiquitination‐resistant PTRF mutants will be critical to determine whether prevention of PTRF ubiquitination is sufficient to abolish TRIM59‐driven oncogenic signaling in vivo. Such studies may provide the mechanistic foundation for developing therapeutic strategies aimed at selectively disrupting the TRIM59‐PTRF ubiquitination axis rather than broadly inhibiting TRIM59 activity.
In summary, we identify TRIM59 as an oncogenic driver in BLCA and uncover a previously unrecognized TRIM59‐PTRF‐AKT/c‐Myc axis that promotes malignant progression. These findings refine the current understanding of BLCA biology and provide a rationale for exploring ubiquitin‐dependent regulatory pathways as potential therapeutic opportunities.
Author Contributions
Junlin Gan: methodology, formal analysis, validation, visualization. Xuesong Bai: data curation, writing – original draft, validation, methodology. Aijie Zhang: methodology, validation. Fei Lin: software, resources. Hang Tong: resources, funding acquisition. Tinghao Li: resources. Ning Xu: investigation. Xinyuan Li: project administration, funding acquisition, formal analysis. Zhou Yu: writing – review and editing, project administration. Hubin Yin: project administration, writing – review and editing, funding acquisition, conceptualization.
Funding
This work was supported by the National Natural Science Foundation of China (No. 82303655 and 82403698), the Natural Science Foundation of Chongqing (CSTB2024NSCQ‐MSX1163), and the Scientific Research Project of the Suining Municipal Health Commission (24ZDJB06).
Ethics Statement
The study was approved by the Ethics Committee of Chongqing Medical University for animal research (2024–09062). All experiments were performed in compliance with applicable guidelines and regulations.
Consent
Written informed consent was obtained from all participants prior to enrolment. All procedures were conducted in accordance with the Declaration of Helsinki.
Conflicts of Interest
The authors declare no conflicts of interest.
Supporting information
Figure S1: Pan‐cancer Kaplan–Meier analysis of disease‐specific survival stratified by TRIM59 expression across the indicated tumor types.
Figure S2: The RING domain is required for TRIM59‐mediated ubiquitination of PTRF. (A) Cell‐based ubiquitination assay performed in 293 T cells cotransfected with the indicated plasmids. (B) In vitro ubiquitination assay showing that TRIM59‐mediated ubiquitination of PTRF depends on an intact RING domain.
Figure S3: Identification of candidate ubiquitination sites in PTRF. (A) Prediction of potential ubiquitination sites in PTRF using the GPS‐Uber online tool. (B) Evolutionary conservation analysis of candidate lysine residues in PTRF. Amino acid sequence alignment across multiple species showed that K95, K98, K109, K122, K137, K152, K161, and K317 are highly conserved. (C) Site‐directed mutagenesis followed by immunoblot analysis to assess the degradation of PTRF mutants, in which individual lysine residues were substituted with arginine.
Figure S4: PTRF is inversely associated with cell‐cycle activity and c‐Myc signaling. (A) PTRF expression in tumor versus paired adjacent normal tissues across multiple TCGA cancer types. (B) Pan‐cancer correlation analysis showing a negative association between PTRF expression and cell‐cycle signature. (C) Correlations between PTRF expression and cell‐cycle scores in the GSE48075, GSE48276, and GSE69795 cohorts. (D) Bubble plot summarizing gene sets inversely associated with PTRF across BLCA datasets, including MYC targets, G2/M checkpoint, and E2F targets. (E) qRT‐PCR analysis of MYC mRNA expression in T24 cells following PTRF overexpression. **p < 0.01 by two‐sided Mann–Whitney U test. (F) Immunoblot analysis of c‐Myc and Cyclin D1 protein levels in T24 cells following PTRF overexpression. (G) MYC promoter luciferase reporter assay in T24 cells following PTRF overexpression or depletion, with additional modulation of AKT activity by myr‐AKT1 or LY294002. *p < 0.05, **p < 0.01, and ***p < 0.001 by one‐way ANOVA with Tukey's test. (H) qRT‐PCR analysis of MYC mRNA expression in TRIM59‐silenced T24 cells with or without PTRF depletion. *p < 0.05 and **p < 0.01 by one‐way ANOVA with Tukey's test. (I) Immunoblot analysis of c‐Myc and cyclin D1 protein levels in TRIM59‐silenced T24 cells following PTRF knockdown. (J) Immunoblot analysis of p‐AKT and c‐Myc expression in PTRF‐silenced T24 cells. (K) qRT‐PCR analysis of MYC mRNA expression in T24 cells following PTRF knockdown. *p < 0.05 by one‐way ANOVA with Tukey's test. (L) Stratified Kaplan–Meier analysis showing that patients with TRIM59‐high/PTRF‐low tumors have the poorest overall survival in the TCGA‐BLCA cohort.
Figure S5: The RING domain is required for TRIM59‐induced cell proliferation. (A, B) Effects of the TRIM59 RING mutant on cell growth, as assessed by CCK‐8 assay (A) and colony formation assay in J82 cells (B). (C) Immunoblot analysis of mesenchymal marker expression in T24 and J82 cells following combined modulation of TRIM59 and PTRF. (D) Quantitative analysis of Ki‐67 and c‐Myc staining in xenograft tumors, corresponding to Figure 7K. Data are presented as mean ± SD and were analyzed using Student's t‐test; *p < 0.05, **p < 0.01, and ***p < 0.001. Table S1: The sequences of the qRT‐PCR primers used in this study.
Table S2: Information on primary antibodies. Other materials and methods used in this study are listed in the “ and Methods Doc S1” file. Schematic model of TRIM59‐driven BLCA progression through K48‐linked ubiquitination and proteasomal degradation of PTRF, leading to AKT activation and c‐Myc upregulation.
Data S1: Supporting Information.
Acknowledgments
We thank TCGA and GEO databases for their free use.
Contributor Information
Xinyuan Li, Email: lixinyuan@sibcb.ac.cn.
Zhou Yu, Email: 6988344@qq.com.
Hubin Yin, Email: 204625@hospital.cqmu.edu.cn.
Data Availability Statement
The data that support the findings of this study are available from the corresponding author upon reasonable request.
References
- 1. Bray F., Laversanne M., Sung H., et al., “Global Cancer Statistics 2022: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries,” CA: A Cancer Journal for Clinicians 74, no. 3 (2024): 229–263. [DOI] [PubMed] [Google Scholar]
- 2. Dyrskjøt L., Hansel D. E., Efstathiou J. A., et al., “Bladder Cancer,” Nature Reviews Disease Primers 9, no. 1 (2023): 58. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Venuto S. and Merla G., “E3 Ubiquitin Ligase TRIM Proteins, Cell Cycle and Mitosis,” Cells 8, no. 5 (2019): 510. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Huang N., Sun X., Li P., et al., “TRIM Family Contribute to Tumorigenesis, Cancer Development, and Drug Resistance,” Experimental Hematology & Oncology 11, no. 1 (2022): 75. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Wu W., Yang J., Yu T., Zou Z., and Huang X., “The Role and Mechanism of TRIM Proteins in Gastric Cancer,” Cells 13, no. 24 (2024): 2107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Crawford L. J., Johnston C. K., and Irvine A. E., “TRIM Proteins in Blood Cancers,” Journal of Cell Communication and Signaling 12, no. 1 (2018): 21–29. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Weng H., Zhong J., Yang R., et al., “TRIM59 Suppresses Mitochondrial‐Associated Apoptosis to Facilitate Progression in Papillary Renal Cell Carcinoma via the ACAT1‐Cardiolipin Pathway,” Cell Death & Disease 16, no. 1 (2025): 606. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Chen S., He Z., Cai K., et al., “TRIM59/RBPJ Positive Feedback Circuit Confers Gemcitabine Resistance in Pancreatic Cancer by Activating the Notch Signaling Pathway,” Cell Death & Disease 15, no. 12 (2024): 932. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Fan L., Gong Y., He Y., et al., “TRIM59 Is Suppressed by Androgen Receptor and Acts to Promote Lineage Plasticity and Treatment‐Induced Neuroendocrine Differentiation in Prostate Cancer,” Oncogene 42, no. 8 (2023): 559–571. [DOI] [PubMed] [Google Scholar]
- 10. Wang Y., Zhou Z., Wang X., et al., “TRIM59 Is a Novel Marker of Poor Prognosis and Promotes Malignant Progression of Ovarian Cancer by Inducing Annexin A2 Expression,” International Journal of Biological Sciences 14, no. 14 (2018): 2073–2082. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Ying H., Ji L., Xu Z., et al., “TRIM59 Promotes Tumor Growth in Hepatocellular Carcinoma and Regulates the Cell Cycle by Degradation of Protein Phosphatase 1B,” Cancer Letters 473 (2020): 13–24. [DOI] [PubMed] [Google Scholar]
- 12. Lei J., Wang P., Qu Y., et al., “Identification of TRIM59 as a Key Biomarker for Ferroptosis Resistance and Immunotherapy Response in Bladder Cancer via Multi‐Omics Integration and Machine Learning,” Front Biosci (Landmark Ed) 30, no. 9 (2025): 44395. [DOI] [PubMed] [Google Scholar]
- 13. Li J., Zhao F., Wang Z., et al., “KAT2A Deficiency Suppresses Lung Cancer Progression by Downregulating MYC Through Decreasing MYC Succinylation,” Cancer Science 117, no. 3 (2026): 631–643. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Chen D., Li X., Zhao G., et al., “Transglutaminase 2 Facilitates Metastasis of Basal‐Like Bladder Cancer by Sustaining MVP‐Mediated MAPK/ERK1/2 Signaling Activation,” Cancer Letters 636 (2026): 218146. [DOI] [PubMed] [Google Scholar]
- 15. Huertas‐Mart nez J., Court F., Rello‐Varona S., et al., “DNA Methylation Profiling Identifies PTRF/Cavin‐1 as a Novel Tumor Suppressor in Ewing Sarcoma When Co‐Expressed With Caveolin‐1,” Cancer Letters 386 (2017): 196–207. [DOI] [PubMed] [Google Scholar]
- 16. Yang E., Wang L., Jin W., et al., “PTRF/Cavin‐1 Enhances Chemo‐Resistance and Promotes Temozolomide Efflux Through Extracellular Vesicles in Glioblastoma,” Theranostics 12, no. 9 (2022): 4330–4347. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Wang C., Tan X., Tang D., et al., “GPS‐Uber: A Hybrid‐Learning Framework for Prediction of General and E3‐Specific Lysine Ubiquitination Sites,” Briefings in Bioinformatics 23, no. 2 (2022): bbab574. [DOI] [PubMed] [Google Scholar]
- 18. Ke S., Baiyun J., Yuanyu L., et al., “Loss of TRIM44 Promotes Renal Cell Carcinoma Progression by Regulating K48‐Linked Ubiquitination of Vimentin,” Journal of Biological Chemistry 301, no. 11 (2025): 110734. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Wei C., Wang L., Zhu M., et al., “TRIM44 Activates the AKT/mTOR Signal Pathway to Induce Melanoma Progression by Stabilizing TLR4,” Journal of Experimental & Clinical Cancer Research 38, no. 1 (2019): 137. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Zhu L., Cui X., Xu H., Yang M., and Han L., “The E3 Ubiquitin Ligase TRIM56 Promotes Aggregation and Activation of Src Protein Through Lys63‐Linked Polyubiquitination in Hepatocellular Carcinoma,” Cell Death & Disease 16, no. 1 (2025): 731. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Zhao L., Zhang P., Su X., and Zhang B., “The Ubiquitin Ligase TRIM56 Inhibits Ovarian Cancer Progression by Targeting Vimentin,” Journal of Cellular Physiology 233, no. 3 (2018): 2420–2425. [DOI] [PubMed] [Google Scholar]
- 22. Ben C., Du Y., Rongfa Y., et al., “SLC35F2‐SYVN1‐TRIM59 Axis Critically Regulates Ferroptosis of Pancreatic Cancer Cells by Inhibiting Endogenous p53,” Oncogene 42, no. 44 (2023): 3260–3273. [DOI] [PubMed] [Google Scholar]
- 23. Zhou Z., Ji Z., Wang Y., et al., “TRIM59 Is Up‐Regulated in Gastric Tumors, Promoting Ubiquitination and Degradation of p53,” Gastroenterology 147, no. 5 (2014): 1043–1054. [DOI] [PubMed] [Google Scholar]
- 24. Sang Y., Li Y., Zhang Y., et al., “CDK5‐Dependent Phosphorylation and Nuclear Translocation of TRIM59 Promotes macroH2A1 Ubiquitination and Tumorigenicity,” Nature Communications 10, no. 1 (2019): 4013. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Nassar Z. D., Hill M. M., Parton R. G., and Parat M., “Caveola‐Forming Proteins Caveolin‐1 and PTRF in Prostate Cancer,” Nature Reviews Urology 10, no. 9 (2013): 529–536. [DOI] [PubMed] [Google Scholar]
- 26. Yi K., Zhan Q., Wang Q., et al., “PTRF/Cavin‐1 Remodels Phospholipid Metabolism to Promote Tumor Proliferation and Suppress Immune Responses in Glioblastoma by Stabilizing cPLA2,” Neuro‐Oncology 23, no. 3 (2021): 387–399. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Hong B., Su D., Cui X., et al., “PEAKS Activation by PROTAC EPIC‐0726 Potentiates Temozolomide in Glioblastoma via K63/K48 Ubiquitination‐Dependent ERK/AKT Suppression and p21 Stabilization,” Neuro‐Oncology 28 (2025): 597–612. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Zhang Y., Yang Y., Chen G., et al., “Targeting TRIM59 Impairs RNA Splicing and Promotes Neuroblastoma Differentiation and Therapeutic Responses,” Journal of Experimental & Clinical Cancer Research 45, no. 1 (2025): 25. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Zeng L., Xu H., Li M., et al., “Degradation of IRF6 by TRIM59 in Tumor Cells Triggers PGM1‐Mediated Glycolysis to Regulate Cell Proliferation in Neuroblastoma,” Cell Death & Disease 16, no. 1 (2025): 613. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Tong X., Mu P., Zhang Y., Zhao J., and Wang X., “TRIM59, Amplified in Ovarian Cancer, Promotes Tumorigenesis Through the MKP3/ERK Pathway,” Journal of Cellular Physiology 235, no. 11 (2020): 8236–8245. [DOI] [PubMed] [Google Scholar]
- 31. Li R., Weng L., Liu B., et al., “TRIM59 Predicts Poor Prognosis and Promotes Pancreatic Cancer Progression via the PI3K/AKT/mTOR‐Glycolysis Signaling Axis,” Journal of Cellular Biochemistry 121, no. 2 (2020): 1986–1997. [DOI] [PubMed] [Google Scholar]
- 32. Tan P., Ye Y., He L., et al., “TRIM59 Promotes Breast Cancer Motility by Suppressing p62‐Selective Autophagic Degradation of PDCD10,” PLoS Biology 16, no. 11 (2018): e3000051. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Figure S1: Pan‐cancer Kaplan–Meier analysis of disease‐specific survival stratified by TRIM59 expression across the indicated tumor types.
Figure S2: The RING domain is required for TRIM59‐mediated ubiquitination of PTRF. (A) Cell‐based ubiquitination assay performed in 293 T cells cotransfected with the indicated plasmids. (B) In vitro ubiquitination assay showing that TRIM59‐mediated ubiquitination of PTRF depends on an intact RING domain.
Figure S3: Identification of candidate ubiquitination sites in PTRF. (A) Prediction of potential ubiquitination sites in PTRF using the GPS‐Uber online tool. (B) Evolutionary conservation analysis of candidate lysine residues in PTRF. Amino acid sequence alignment across multiple species showed that K95, K98, K109, K122, K137, K152, K161, and K317 are highly conserved. (C) Site‐directed mutagenesis followed by immunoblot analysis to assess the degradation of PTRF mutants, in which individual lysine residues were substituted with arginine.
Figure S4: PTRF is inversely associated with cell‐cycle activity and c‐Myc signaling. (A) PTRF expression in tumor versus paired adjacent normal tissues across multiple TCGA cancer types. (B) Pan‐cancer correlation analysis showing a negative association between PTRF expression and cell‐cycle signature. (C) Correlations between PTRF expression and cell‐cycle scores in the GSE48075, GSE48276, and GSE69795 cohorts. (D) Bubble plot summarizing gene sets inversely associated with PTRF across BLCA datasets, including MYC targets, G2/M checkpoint, and E2F targets. (E) qRT‐PCR analysis of MYC mRNA expression in T24 cells following PTRF overexpression. **p < 0.01 by two‐sided Mann–Whitney U test. (F) Immunoblot analysis of c‐Myc and Cyclin D1 protein levels in T24 cells following PTRF overexpression. (G) MYC promoter luciferase reporter assay in T24 cells following PTRF overexpression or depletion, with additional modulation of AKT activity by myr‐AKT1 or LY294002. *p < 0.05, **p < 0.01, and ***p < 0.001 by one‐way ANOVA with Tukey's test. (H) qRT‐PCR analysis of MYC mRNA expression in TRIM59‐silenced T24 cells with or without PTRF depletion. *p < 0.05 and **p < 0.01 by one‐way ANOVA with Tukey's test. (I) Immunoblot analysis of c‐Myc and cyclin D1 protein levels in TRIM59‐silenced T24 cells following PTRF knockdown. (J) Immunoblot analysis of p‐AKT and c‐Myc expression in PTRF‐silenced T24 cells. (K) qRT‐PCR analysis of MYC mRNA expression in T24 cells following PTRF knockdown. *p < 0.05 by one‐way ANOVA with Tukey's test. (L) Stratified Kaplan–Meier analysis showing that patients with TRIM59‐high/PTRF‐low tumors have the poorest overall survival in the TCGA‐BLCA cohort.
Figure S5: The RING domain is required for TRIM59‐induced cell proliferation. (A, B) Effects of the TRIM59 RING mutant on cell growth, as assessed by CCK‐8 assay (A) and colony formation assay in J82 cells (B). (C) Immunoblot analysis of mesenchymal marker expression in T24 and J82 cells following combined modulation of TRIM59 and PTRF. (D) Quantitative analysis of Ki‐67 and c‐Myc staining in xenograft tumors, corresponding to Figure 7K. Data are presented as mean ± SD and were analyzed using Student's t‐test; *p < 0.05, **p < 0.01, and ***p < 0.001. Table S1: The sequences of the qRT‐PCR primers used in this study.
Table S2: Information on primary antibodies. Other materials and methods used in this study are listed in the “ and Methods Doc S1” file. Schematic model of TRIM59‐driven BLCA progression through K48‐linked ubiquitination and proteasomal degradation of PTRF, leading to AKT activation and c‐Myc upregulation.
Data S1: Supporting Information.
Data Availability Statement
The data that support the findings of this study are available from the corresponding author upon reasonable request.
