Abstract
Background
Cardiac hypertrophy is an adaptive or maladaptive response to physiological or pathological stimuli, with distinct functional outcomes. Metabolic reprogramming plays a key role in this process; however, the metabolism-associated genes underlying different remodeling patterns remain unclear.
Methods
Transcriptomic microarray data related to cardiac hypertrophy (GSE776) were obtained from the Gene Expression Omnibus database. Differentially expressed genes (DEGs) were identified by comparing physiological (exercise-induced) and pathological (high-salt diet-induced) hypertrophy models with controls. Metabolism-associated genes were retrieved from the Molecular Signatures Database (MSigDB) and intersected with physiological hypertrophy-specific DEGs to identify candidate metabolic genes. Protein-protein interaction (PPI) analysis was performed to identify hub genes. Experimental validation was performed using mouse models of pregnancy-induced physiological hypertrophy and isoproterenol-induced pathological hypertrophy, isoproterenol-treated neonatal rat cardiomyocytes, and human myocardial tissue samples.
Results
Transcriptomic analysis identified 48 genes specifically associated with physiological cardiac hypertrophy, which were predominantly enriched in metabolic pathways. Intersection of these genes with metabolism-related gene sets revealed 22 physiological hypertrophy-related metabolic genes. PPI analysis identified HADHA, ACOX1 and GOT2 as key hub genes. In vivo and in vitro experiments demonstrated that these genes were significantly upregulated in physiological cardiac hypertrophy but markedly downregulated in pathological hypertrophy. Immunohistochemical analysis of human myocardial tissues confirmed reduced expression of HADHA, ACOX1 and GOT2 in pathological hypertrophic myocardium compared with non-hypertrophic controls.
Conclusion
Differential expression of HADHA, ACOX1, and GOT2 highlights altered fatty acid oxidation and mitochondrial energy metabolism as key features distinguishing physiological and pathological cardiac hypertrophy.
Supplementary Information
The online version contains supplementary material available at 10.1186/s12872-026-06129-5.
Keywords: Cardiac hypertrophy, Metabolic reprogramming, HADHA, ACOX1, GOT2
Introduction
Cardiac hypertrophy, an increase in cardiomyocyte size, can be classified into adaptive physiological and maladaptive pathological forms, driven by distinct molecular mechanisms [1]. Pathological cardiac hypertrophy is a major contributor to heart failure and remains a significant global health burden. Current treatments mainly alleviate symptoms but do not effectively target the underlying mechanisms, resulting in poor clinical outcomes [2]. Furthermore, the key genes and molecular mechanisms that distinguish adaptive from maladaptive remodeling remain incompletely understood, limiting the development of targeted therapeutic strategies.
Physiological cardiac hypertrophy is an adaptive and reversible form of myocardial growth, typically lacking fibrosis and functional impairment. In contrast, pathological hypertrophy is associated with adverse remodeling and cardiac dysfunction [3]. Beyond these phenotypic differences, the underlying molecular basis, particularly metabolic mechanisms, remains incompletely understood. Identifying the gene signatures that define physiological hypertrophy may help elucidate mechanisms of functional cardiac growth and provide potential targets for therapeutic intervention.
Metabolic reprogramming plays a central role in cardiac hypertrophy. The heart adapts to increased energy demand through metabolic flexibility, enabling shifts in substrate utilization under different stimuli. Physiological hypertrophy is characterized by enhanced mitochondrial oxidative metabolism and efficient fatty acid utilization, whereas pathological hypertrophy is associated with a shift toward glycolysis and impaired fatty acid oxidation [4]. These distinct metabolic patterns suggest that metabolic remodeling is closely linked to functional outcomes. However, the key metabolic genes driving these differences remain poorly defined.
In this study, we identified and validated key metabolic genes differentially expressed between physiological and pathological cardiac hypertrophy by integrating bioinformatic analysis with experimental validation. These findings provide insight into the metabolic basis of cardiac remodeling and may help identify targets for distinguishing hypertrophy subtypes and develop metabolism-related therapeutic strategies.
Materials and methods
Data source and preprocessing
The gene expression microarray dataset GSE776 was obtained from the Gene Expression Omnibus (GEO) database. The dataset included myocardial tissues from Dahl salt-sensitive rats classified into control, physiological hypertrophy, and pathological hypertrophy groups. Physiological hypertrophy was induced by exercise training, whereas pathological hypertrophy was induced by a high-salt diet. This dataset was selected because it includes both physiological and pathological hypertrophy models under identical experimental and microarray conditions, minimizing batch effects and improving comparability.
Differentially expressed genes (DEGs) were identified using the “limma” R package with thresholds of |log2FC| > 1 and adjusted p-value < 0.05 [5]. Physiological hypertrophy-specific DEGs were identified by Venn analysis. Functional enrichment analysis, including Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG), was performed using the “clusterProfiler” R package with an adjusted p-value < 0.05 [6]. All bioinformatic analyses and data visualization were performed using R software (version 4.2.1).
Metabolism-related genes were retrieved from the Molecular Signatures Database (MSigDB) using the keyword “METABOLIC PROCESS” and intersected with physiological hypertrophy-specific DEGs to identify candidate metabolic genes. Protein-protein interaction (PPI) networks were constructed using STRING and visualized in Cytoscape (version 3.10.1), and hub genes were identified using the cytoHubba plugin based on node degree [7, 8].
Animal models and treatments
Female C57BL/6 mice (8 weeks old) were obtained from the Experimental Animal Center of Fujian Medical University. Physiological cardiac hypertrophy was modeled using day 18 pregnant mice (Preg), while pathological hypertrophy was induced by subcutaneous injection of isoproterenol (ISO, 150 mg/kg/day) for 7 days [9]. Age-matched wild-type (WT) female mice served as controls. Distinct physiological and pathological hypertrophy models, different from those used in the discovery dataset, were deliberately employed to assess the generalizability of hypertrophy-associated molecular changes across biological contexts. All animal procedures were approved by the Animal Ethics Committee of Huaqiao University.
Echocardiography
Using the Vevo 2100 imaging system, cardiac function was assessed via echocardiography, with left ventricular (LV) M-mode recordings used to quantify: LV internal diameter at the end of diastole and systole (LVIDd and LVIDs), ejection fraction (EF) and fractional shortening (FS). After echocardiography, hearts were harvested and weighed, and cardiac hypertrophy was assessed by the heart weight-to-tibia length (HW/TL) ratio.
Histological analyses
Hematoxylin and eosin (HE), wheat germ agglutinin (WGA), and Masson’s trichrome staining were performed on paraformaldehyde-fixed, paraffin-embedded mouse heart sections to assess myocardial morphology and fibrosis. Cardiomyocyte surface area in WGA-stained sections was quantified using ImageJ software. At least three randomly selected microscopic fields from each sample were analyzed, and the average cardiomyocyte surface area was calculated.
Human myocardial tissues were obtained with informed consent and ethics approval. For immunohistochemistry, paraffin sections were deparaffinized, rehydrated, and subjected to citrate buffer-mediated antigen retrieval (pH 6.0), followed by BSA blocking and overnight incubation at 4℃ with primary antibodies against HADHA (1:50, Cat# R24526, Zenbio), GOT2 (1:50, Cat# R389321, Zenbio), and ACOX1 (1:100, Cat# K111757P, Solarbio). Sections were then incubated with HRP-conjugated secondary antibodies, followed by DAB visualization and hematoxylin counterstaining. Immunohistochemical staining intensity was quantitatively analyzed using ImageJ software by calculating the average optical density (AOD) from at least three randomly selected fields per section.
Isolation and ISO treatment of neonatal rat cardiomyocytes
Neonatal rat hearts (1–3 days old) were minced in ice-cold Hanks’ balanced salt solution and digested with collagenase type II at 37℃. The cell suspension was centrifuged at 800 rpm for 5 min, and non-cardiomyocytes were removed by differential adhesion for 2 h. Neonatal rat cardiomyocytes (NRCMs) were cultured in DMEM/F12 supplemented with 10% fetal bovine serum. After 24 h, NRCMs were treated with PBS or isoproterenol (ISO, 10 µmol/L) for 24 h to induce hypertrophy [10]. Cardiomyocyte identity was confirmed by immunofluorescence staining for cardiac troponin T (cTnT) [11].
RNA isolation and quantitative real-time PCR (qRT-PCR)
Total RNA was extracted from NRCMs and mouse myocardial tissues using the RNAeasyTM kit (Cat# R0026; Beyotime Biotechnology). RNA concentration and purity were measured by spectrophotometry, followed by cDNA synthesis using a reverse transcription kit (Cat# RK20433, ABclonal Technology). qRT-PCR was performed using the Genious 2×SYBR Green Fast qPCR mix (Cat# RK21205, ABclonal Technology) and gene-specific primers.
Primer sequences were commercially synthesized (Tsingke Biotechnology) and listed in Table 1. PCR was performed for 40 cycles at 95℃ for 5 s and 60℃ for 30 s, followed by melt curve analysis to confirm specificity. Gene expression was quantified using the 2^−∆∆Ct method with GAPDH as the reference gene.
Table 1.
The sequences of qRT-PCR primers
| Items | Primer (5’−3’) |
|---|---|
| Mouse-BNP (forward) | GGATCGGATCCGTCAGTCGTT |
| Mouse-BNP (reverse) | AGACCCAGGCAGAGTCAGAAA |
| Mouse-Collagen type I (forward) | AGGCTTCAGTGGTTTGGATG |
| Mouse-Collagen type I (reverse) | CACCAACAGCACCATCGTTA |
| Mouse-Collagen type III (forward) | CCCAACCCAGAGATCCCATT |
| Mouse-Collagen type III (reverse) | GAAGCACAGGAGCAGGTGTAGA |
| Mouse-TGF-β (forward) | CTCCCGTGGCTTCTAGTGC |
| Mouse-TGF-β (reverse) | GCCTTAGTTTGGACAGGATCTG |
| Mouse-IGF−1R (forward) | GTGGGGGCTCGTGTTTCTC |
| Mouse-IGF−1R (reverse) | GATCACCGTGCAGTTTTCCA |
| Mouse-GATA4 (forward) | CCCTACCCAGCCTACATGG |
| Mouse-GATA4 (reverse) | ACATATCGAGATTGGGGTGTCT |
| Mouse-AKT1 (forward) | ATGAACGACGTAGCCATTGTG |
| Mouse-AKT1 (reverse) | TTGTAGCCAATAAAGGTGCCAT |
| Mouse-HADHA (forward) | TGCATTTGCCGCAGCTTTAC |
| Mouse-HADHA (reverse) | GTTGGCCCAGATTTCGTTCA |
| Mouse-ACOX1 (forward) | TAACTTCCTCACTCGAAGCCA |
| Mouse-ACOX1 (reverse) | AGTTCCATGACCCATCTCTGTC |
| Mouse-GOT2 (forward) | GGACCTCCAGATCCCATCCT |
| Mouse-GOT2 (reverse) | GGTTTTCCGTTATCATCCCGGTA |
| Mouse-GAPDH (forward) | TGTGTCCGTCGTGGATCTGA |
| Mouse-GAPDH (reverse) | TTGCTGTTGAAGTCGCAGGAG |
| Rat-ANP (forward) | CGTATACAGTGCGGTGTCCA |
| Rat-ANP (reverse) | ATCTATCGGAGGGGTCCCAG |
| Rat-BNP (forward) | GACGGGCTGAGGTTGTTTTA |
| Rat-BNP (reverse) | ACTGTGGCAAGTTTGTGCTG |
| Rat-Collagen type I (forward) | GTGCGATGGCGTGCTATG |
| Rat-Collagen type I (reverse) | ACTTCTGCGTCTGGTGATACA |
| Rat-Collagen type III (forward) | AGATGCTGGTGCTGAGAAGAAAC |
| Rat-Collagen type III (reverse) | GCTGGAAAGAAGTCTGAGGAAGG |
| Rat-TGF-β (forward) | ATTCCTGGCGTTACCTTGG |
| Rat-TGF-β (reverse) | TGTATTCCGTCTCCTTGGTTC |
| Rat-HADHA (forward) | CGGCTCCGGAAGTATGAGTC |
| Rat-HADHA (reverse) | GGAGGAGCAAATCCAAGGCT |
| Rat-ACOX1 (forward) | GTTGATCACGCACATCTTGGA |
| Rat-ACOX1 (reverse) | TCGTTCAGAATCAAGTTCTCAATTTC |
| Rat-GOT2 (forward) | ACGCGTTCCTCGGAAAAGAG |
| Rat-GOT2 (reverse) | CCTATGCCATGCTGACAGGT |
| Rat-GAPDH (forward) | CAGTGCCAGCCTCGTCTCAT |
| Rat-GAPDH (reverse) | AGGGGCCATCCACAGTCTTC |
Protein extraction and western blotting
Mouse myocardial tissues and NRCMs were lysed in RIPA buffer supplemented with protease inhibitors, and lysates were clarified by centrifugation at 12,000×g for 10 min at 4 °C. Protein concentrations were determined using a BCA assay kit. Equal amounts of protein were separated by SDS-PAGE and transferred onto PVDF membranes. After blocking with 5% non-fat milk, membranes were incubated overnight at 4 °C with primary antibodies against IGF-1R (1:1,000, Cat# P010706, Epizyme), HADHA (1:1,000, Cat# R24526, Zenbio), ACOX1 (1:1,000, Cat# R23371, Zenbio), GOT2 (1:1,000, Cat# R389321, Zenbio), ANP (1:2,000, Cat# 27426-1-AP, Proteintech), and BNP (1:1,000, Cat# BS67729, Bioworld Technology). GAPDH (1:50,000, Cat# 60004-1-Ig, Proteintech) served as the loading control. After incubation with HRP-conjugated secondary antibodies, signals were detected using an ECL chemiluminescence kit (Cat# P0018AM, Beyotime). Protein band intensities were quantified using ImageJ software. Relative protein expression levels were calculated by normalizing the gray value of each target protein band to that of the corresponding GAPDH band.
Statistical analysis
All quantitative data are expressed as mean ± standard deviation (SD) from at least three independent experiments. Comparisons between two groups were analyzed using an unpaired two-tailed Student’s t-test. Multiple group comparisons were performed by one-way analysis of variance (ANOVA) followed by Tukey’s post hoc test. A p-value < 0.05 was considered statistically significant.
Results
Identification of physiological cardiac hypertrophy-related metabolic genes
To explore transcriptomic differences between physiological and pathological cardiac hypertrophy, we analyzed the GSE776 dataset. Differential expression analysis identified 54 DEGs in physiological hypertrophy and 11 in pathological hypertrophy (Fig. 1A, B; Supplementary Tables 1,2). Venn analysis revealed 48 DEGs specific to physiological hypertrophy (Fig. 1C).
Fig. 1.

Identification of metabolism-related hub genes specific to physiological cardiac hypertrophy. A Volcano plot of differentially expressed genes (DEGs) between physiological cardiac hypertrophy and normal myocardial tissue. Red dots represent upregulated genes, and blue dots represent downregulated genes. Threshold values were set as adjusted p < 0.05 and |log2FC| > 1. B Volcano plot of DEGs between pathological cardiac hypertrophy and normal myocardial tissue. Threshold values were set as adjusted p < 0.05 and |log2FC| > 1. C Venn diagram showing the overlap and uniqueness of DEGs in physiological and pathological cardiac hypertrophy. D Plots of significantly enriched GO terms of physiological hypertrophy-specific DEGs for biological processes (BP), cellular components (CC), and molecular functions (MF). E Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis of physiological hypertrophy-specific DEGs, identifying significantly enriched pathways. F Venn diagram showing the overlap between physiological hypertrophy-specific DEGs and metabolism-related genes. G Protein–protein interaction (PPI) network of metabolism-related DEGs in physiological cardiac hypertrophy constructed using the STRING database. H Top 10 hub genes identified from the PPI network based on degree centrality
GO enrichment analysis showed that these genes were mainly involved in metabolic processes, including fatty acid transport and cellular response to alkaloids (Fig. 1D; Supplementary Table 3). KEGG pathway analysis further demonstrated enrichment in metabolic pathways such as carbon metabolism, beta-alanine metabolism, propanoate metabolism, and fatty acid degradation (Fig. 1E; Supplementary Table 4), indicating a key role of metabolic remodeling in physiological hypertrophy.
Intersection with MSigDB metabolic gene sets (Supplementary Table 5) identified 22 physiological cardiac hypertrophy-related metabolic genes (Fig. 1F). PPI network analysis using STRING and Cytoscape identified the top 10 hub genes based on degree centrality (Fig. 1G, H). Among these genes, HADHA, ACOX1 and GOT2 were ranked as the top three and selected for subsequent validation because of their relatively higher connectivity within the network and their close association with fatty acid oxidation and mitochondrial energy metabolism.
Construction of cardiac hypertrophy mouse models and validation of related metabolic gene expression
To validate the expression of identified metabolic genes, we established pregnancy-induced physiological hypertrophy (Preg) and ISO-induced pathological hypertrophy (ISO) mouse models, with age-matched wild-type (WT) mice as controls. Histological analysis confirmed successful hypertrophy induction and distinct remodeling patterns. HE and WGA staining showed increased myocardial wall thickness and cardiomyocyte size in both Preg and ISO groups, while Masson’s staining revealed significant fibrosis only in the ISO group (Fig. 2A). Quantitative analysis of WGA staining further confirmed significantly increased cardiomyocyte surface area in both hypertrophic groups compared with WT controls (Fig. 2B).
Fig. 2.

Histological, echocardiographic, and immunohistochemical analyses of physiological and pathological cardiac hypertrophy mouse models. A Representative images of hematoxylin and eosin (HE), Masson’s trichrome and wheat germ agglutinin (WGA) staining of myocardial tissues from wild-type (WT), day 18 pregnant (Preg; physiological hypertrophy) and isoproterenol-treated (ISO; pathological hypertrophy) mice. B Quantitative analysis of cardiomyocyte surface area based on WGA staining among the three groups. C Quantitative comparison of heart weight to tibia length ratio (HW/TL) among the three groups. D Representative echocardiographic images showing left ventricular morphology and function in each group. E–L Statistical analyses of echocardiographic parameters, including left ventricular ejection fraction (EF, E), fractional shortening (FS, F), interventricular septal thickness at end systole (IVS.s, G) and end diastole (IVS.d, H), left ventricular posterior wall thickness at end systole (LVPW.s, I) and end diastole (LVPW.d, J), left ventricular internal diameter at end systole (LVID.s, K) and end diastole (LVID.d, L). M Representative immunohistochemical staining and corresponding quantitative analyses of HADHA, ACOX1 and GOT2 in myocardial tissues from WT, Preg and ISO mice. Quantitative data are presented as mean ± SD (n = 3 per group). Statistical significance was assessed by one-way ANOVA. ns, not significant; *p < 0.05; **p < 0.01; ***p < 0.001
Consistently, the HW/TL ratio was increased in both hypertrophic groups (Fig. 2C). Echocardiography showed no significant change in EF and a slight increase in FS in the Preg group, whereas both EF and FS were significantly reduced in the ISO group, indicating systolic dysfunction in pathological hypertrophy (Fig. 2D-F). In addition, IVS, LVPW, and LVID parameters were increased in both hypertrophic groups (Figs. 2G-L).
Immunohistochemistry showed that HADHA, ACOX1, and GOT2 were upregulated in the Preg group but downregulated in the ISO group (Fig. 2M), indicating opposite metabolic responses between physiological and pathological hypertrophy.
Expression of physiological cardiac hypertrophy-related metabolic genes in physiological hypertrophy
To validate the expression of physiological cardiac hypertrophy-related metabolic genes, we analyzed myocardial tissues from Preg group and WT group. qRT-PCR analysis confirmed the successful establishment of physiological hypertrophy, as evidenced by significantly elevated mRNA levels of physiological hypertrophy markers (IGF-1R, GATA4 and AKT1) in the Preg group (Fig. 3A-C). Concurrently, the transcript levels of the key metabolic genes HADHA, ACOX1, and GOT2 were also significantly upregulated in the Preg group (Fig. 3D-F). These findings were further confirmed at the protein level by Western blot analysis, which demonstrated increased expression of these metabolic genes and IGF-1R in the Preg group (Fig. 3G).
Fig. 3.

mRNA and protein levels of physiological cardiac hypertrophy-related metabolic genes in physiological hypertrophy and control mice. A–C Quantitative real-time PCR (qRT-PCR) analysis of physiological cardiac hypertrophy marker genes, including IGF-1R, GATA4 and AKT1 in myocardial tissues from wild-type (WT) and day 18 pregnant (Preg; physiological hypertrophy) mice. D–F qRT-PCR analysis of physiological cardiac hypertrophy-related metabolic genes, including HADHA, ACOX1 and GOT2 in myocardial tissues from WT and Preg mice. G Western blot analysis showing protein levels of physiological cardiac hypertrophy-related metabolic genes and physiological hypertrophy marker genes in myocardial tissues from WT and Preg mice. The GAPDH blot shown is presented as a representative loading control for the corresponding protein blots. Protein expression levels were normalized to corresponding GAPDH and quantified by densitometric analysis using ImageJ software. Quantitative analysis data represent mean ± SD (n = 3 per group). Statistical significance was determined using unpaired two-tailed Student’s t-test. *p < 0.05; **p < 0.01; ***p < 0.001
Expression of physiological cardiac hypertrophy-related metabolic genes in pathological hypertrophy
To evaluate the expression of physiological cardiac hypertrophy-related metabolic genes under pathological conditions, we analyzed myocardial tissues from ISO group and WT group mice. qRT-PCR analysis confirmed the successful establishment of pathological hypertrophy, as evidenced by the significant upregulation of classic pathological hypertrophy markers (Collagen-1, Collagen-3, TGF-β and BNP) in the ISO group (Figs. 4A-D). Consistent with the immunohistochemical findings, the mRNA levels of the key metabolic genes HADHA, ACOX1, and GOT2 were significantly downregulated in the ISO group compared to controls (Figs. 4E-G). Western blot analysis further confirmed these results at the protein level, revealing reduced expression of these key metabolic genes alongside elevated expression of the pathological hypertrophy markers ANP and BNP in the ISO group (Fig. 4H).
Fig. 4.

mRNA and protein levels of physiological cardiac hypertrophy-related metabolic genes in pathological cardiac hypertrophy. A–D qRT-PCR analysis of pathological cardiac hypertrophy marker genes, including BNP, Collagen-1, Collagen-3 and TGF-β in myocardial tissues from wild-type (WT) and isoproterenol-treated (ISO; pathological hypertrophy) mice. E–G qRT-PCR analysis of physiological cardiac hypertrophy-related metabolic genes, including HADHA, ACOX1 and GOT2 in myocardial tissues from WT and ISO mice. H Western blot analysis showing protein levels of physiological cardiac hypertrophy-related metabolic genes and pathological hypertrophy marker genes in myocardial tissues from WT and ISO mice. The GAPDH blot shown is presented as a representative loading control for the corresponding protein blots. Protein expression levels were normalized to corresponding GAPDH and quantified by densitometric analysis using ImageJ software. Quantitative analysis data represent mean ± SD (n = 3 per group). Statistical significance was determined using unpaired two-tailed Student’s t-test. *p < 0.05; **p < 0.01; ***p < 0.001
Validation of physiological cardiac hypertrophy-related metabolic genes in ISO-treated NRCMs
To further investigate the role of the key metabolic genes in cardiomyocyte hypertrophy, NRCMs were isolated and identified by immunofluorescence staining for cTnT, which confirmed a high purity of cardiomyocytes (Fig. 5A). Pathological hypertrophy was induced in NRCMs by treatment with ISO for 24 h. Phalloidin staining revealed a significant increase in cell surface area in ISO-treated NRCMs compared to PBS-treated controls, confirming successful hypertrophic remodeling (Fig. 5B). The model was further validated by qRT-PCR which showed significantly elevated mRNA levels of pathological hypertrophy markers (ANP, BNP, Collagen-1, Collagen-3 and TGF-β) in ISO-treated NRCMs (Fig. 5C-G). Simultaneously, ISO stimulation significantly downregulated the mRNA levels of the key metabolic genes HADHA, ACOX1, and GOT2 (Fig. 5H-J). Consistent with the transcriptional changes, Western blot analysis confirmed downregulated protein expression levels of these key metabolic genes, while the protein expression levels of ANP and BNP were significantly upregulated in ISO-treated NRCMs (Fig. 5K).
Fig. 5.

mRNA and protein levels of physiological cardiac hypertrophy-related metabolic genes in neonatal rat cardiomyocytes (NRCMs). A Immunofluorescence staining of cTnT to identify NRCMs. B Representative images showing the increase in cardiomyocyte surface area after 24-hour treatment with isoproterenol (ISO, 10 µmol/L) compared to PBS-treated controls. C–G qRT-PCR analysis of pathological hypertrophy marker genes, including ANP, BNP, Collagen-1, Collagen-3 and TGF-β in PBS and ISO-treated NRCMs. H–J qRT-PCR analysis of cardiac hypertrophy-related metabolic genes, including HADHA, ACOX1 and GOT2 in PBS and ISO-treated NRCMs. K Western blot analysis showing protein levels of physiological cardiac hypertrophy-related metabolic genes and pathological hypertrophy marker genes in NRCMs following PBS or ISO treatment. The GAPDH blot shown is presented as a representative loading control for the corresponding protein blots. Protein expression levels were normalized to corresponding GAPDH and quantified by densitometric analysis using ImageJ software. Quantitative analysis data represent mean ± SD (n = 3 per group). Statistical significance was determined using unpaired two-tailed Student’s t-test. *p < 0.05; **p < 0.01; ***p < 0.001
Expression of physiological cardiac hypertrophy-related metabolic genes in human myocardial tissues
To further validate the downregulation of physiological cardiac hypertrophy-related metabolic genes in pathological cardiac hypertrophy, immunohistochemical analysis was performed on human myocardial tissue samples obtained from patients with (hypertrophic group) and without (non-hypertrophic group) myocardial hypertrophy. The expression of HADHA, ACOX1, and GOT2 were significantly decreased in myocardial tissues from the hypertrophic group compared to the non-hypertrophic group (Fig. 6). These findings are consistent with the transcriptomic analyses and molecular biology experimental results.
Fig. 6.

Immunohistochemical analysis of physiological cardiac hypertrophy-related metabolic genes in human myocardial tissues. Representative immunohistochemical staining and corresponding quantitative analyses of selected physiological cardiac hypertrophy-related metabolic genes, HADHA (A), ACOX1 (B) and GOT2 (C), in human myocardial tissue samples from patients with myocardial hypertrophy (hypertrophy group) and without myocardial hypertrophy (non-hypertrophy group). Quantitative data are presented as mean ± SD (n = 3 per group). Immunohistochemical staining intensity was quantified by calculating the average optical density (AOD). Statistical significance was determined using unpaired two-tailed Student’s t-test. *p < 0.05; **p < 0.01; ***p < 0.001
Discussion
Cardiac hypertrophy is a response to physiological and pathological stimuli and is accompanied by metabolic reprogramming. Increasing evidence indicates that metabolic remodeling plays a key role in determining the functional outcome of cardiac hypertrophy [4]. Therefore, identifying metabolic regulators that distinguish adaptive physiological hypertrophy from maladaptive pathological hypertrophy is essential for developing metabolism-targeted strategies to preserve cardiac function and prevent progression to heart failure.
In this study, we compared the transcriptomic profiles of physiological and pathological cardiac hypertrophy with controls and identified 48 DEGs specific to physiological hypertrophy. Functional enrichment indicated that these genes were mainly involved in metabolic pathways, including fatty acid metabolism, suggesting that metabolic remodeling is a central feature of physiological cardiac hypertrophy. This finding is consistent with previous reports highlighting the role of metabolic regulation in adaptive cardiac growth [12]. Integration with metabolism-related gene sets further identified 22 associated metabolic genes, among which HADHA, ACOX1, and GOT2 were identified as key hub genes.
HADHA and ACOX1 are key enzymes involved in the fatty acid oxidation (FAO) pathway, which is the primary metabolic process supporting energy homeostasis and contractile function in the adult myocardium [13]. In this study, HADHA and ACOX1 were upregulated in physiological cardiac hypertrophy but markedly downregulated in pathological cardiac hypertrophy, suggesting that FAO pathway may play a critical role in metabolic remodeling and functional outcomes of cardiac hypertrophy. Previous studies have demonstrated that impairment of FAO represents an important metabolic basis for the development and progression of pathological cardiac hypertrophy [14].
HADHA encodes the α subunit of the mitochondrial trifunctional protein complex and serves as a key catalytic enzyme responsible for multiple consecutive steps in long-chain fatty acid β-oxidation. Previous studies have shown that HADHA deficiency impairs mitochondrial fatty acid oxidation, reduces ATP production and ultimately disrupts myocardial energy homeostasis [15]. In addition to its role in fatty acid oxidation, HADHA is also involved in cardiolipin remodeling. Cardiolipin is essential for mitochondrial respiratory chain integrity and efficient oxidative phosphorylation, and its dysregulation has been associated with cardiomyopathy [16, 17].
ACOX1 is the rate-limiting enzyme of the fatty acid β-oxidation pathway and plays a critical role in regulating the initial oxidation steps of fatty acids. In studies of cardiac metabolism, ACOX1 is considered an important regulatory node for maintaining fatty acid metabolic flux and metabolic flexibility [18]. Previous studies have shown that under pathological conditions such as diabetes or myocardial injury, downregulation of ACOX1 is associated with reduced fatty acid oxidation and increased myocardial lipid accumulation [19]. These metabolic alterations have been linked to enhanced oxidative stress and inflammatory responses, thereby contributing to structural and functional cardiac impairment [14, 19]. These findings are consistent with our observations showing significant downregulation of ACOX1 in pathological cardiac hypertrophy models and human hypertrophic myocardial tissues.
GOT2 is a mitochondrial matrix transaminase and a key component of the malate-aspartate shuttle, which transfers cytosolic NADH into mitochondria and maintains redox homeostasis. Previous studies have demonstrated that GOT2 is critical for preserving the mitochondrial NADH/NAD+ balance in cardiomyocytes and stabilizing mitochondrial membrane potential [20]. Liu et al. reported that GOT2 expression and activity increased during development-associated physiological cardiomyocyte hypertrophy but were markedly reduced in hypoxia-induced pathological hypertrophy [21]. These findings are consistent with our observations and suggest that upregulation of GOT2 may support mitochondrial metabolic adaptation to meet the increased energy demand during physiological cardiac hypertrophy. In addition, activation of GOT2-mediated MAS increases mitochondrial NADH availability and improves oxidative phosphorylation efficiency. These effects have been reported to exert cardioprotective effects in multiple models of myocardial injury [20]. In contrast, under pathological cardiac hypertrophy, downregulation of GOT2 may reflect impaired mitochondrial metabolic homeostasis. For example, studies have shown that the SO2/GOT metabolic pathway is suppressed in ISO-induced myocardial injury models [22]. This suppression is accompanied by mitochondrial structural abnormalities, increased oxidative stress and impaired cardiac function. Moreover, reduced GOT2 expression may further impair MAS activity, resulting in insufficient mitochondrial NADH supply and reduced energy production efficiency [23]. This metabolic phenotype is consistent with the mitochondrial dysfunction commonly observed in pathological cardiac hypertrophy.
From a metabolic perspective, this study reveals distinct metabolic differences between physiological and pathological cardiac hypertrophy in fatty acid oxidation and mitochondrial energy metabolism. However, several limitations should be acknowledged. The present study primarily relied on expression-level analyses, and causal relationships were not directly tested. In addition, metabolic function was inferred from molecular markers rather than direct functional measurements. Direct assessments of metabolic flux, including glucose and fatty acid oxidation rates, were not performed in the present study. These aspects need further investigation in future studies.
Conclusion
In conclusion, this study identifies distinct metabolic features that differentiate physiological from pathological cardiac hypertrophy, particularly in fatty acid oxidation and mitochondrial energy metabolism. HADHA, ACOX1 and GOT2 were consistently upregulated in physiological hypertrophy but downregulated in pathological remodeling, suggesting their potential roles in maintaining mitochondrial metabolic homeostasis and adaptive cardiac growth. These findings enhance our understanding of the metabolic differences underlying functional and maladaptive cardiac hypertrophy and support further investigation of metabolism-related mechanisms in pathological cardiac remodeling.
Supplementary Information
Acknowledgments
Clinical trial number
Not applicable. This study did not involve any clinical trial, and human myocardial tissues were obtained from paraffin-embedded specimens derived from prior cardiac surgeries.
Authors’ contributions
Yong Diao and Liling Zheng designed the study and wrote the manuscript. Xiaojian Cai, Sihuang Lin, Jiangwei Chen, Quanfu Dai performed the experiments. Yong Diao and Liling Zheng supervised the project. All authors contributed to the article and approved the final version of the manuscript.
Funding
This study was supported by the Natural Science Foundation of Fujian Province (grant no. 2023J011797), Natural Science Foundation of Fujian Provincial Health Commission (grant no. 2024CXB014), and the Quanzhou High-Level Talent Innovation and Entrepreneurship Project (grant no. 2024QZC013YR).
Data availability
The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/Supplementary Material.
Declarations
Ethics approval and consent to participate
The study involving human specimens was approved by the Ethics Committee of the First Hospital of Quanzhou (approval number: 2023-K078), and written informed consent was obtained from all participants in accordance with the Declaration of Helsinki. Animal experiments were approved by the Animal Ethics Committee of Huaqiao University (approval number: LHJJ2025043) and conducted in accordance with institutional guidelines for the care and use of laboratory animals.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Contributor Information
Yong Diao, Email: diaoyong@hqu.edu.cn.
Liling Zheng, Email: zhengll20@hotmail.com.
References
- 1.Nakamura M, Sadoshima J. Mechanisms of physiological and pathological cardiac hypertrophy. Nat Rev Cardiol. 2018;15(7):387–407. 10.1038/s41569-018-0007-y. [DOI] [PubMed] [Google Scholar]
- 2.Peikert A, Fontana M, Solomon SD, Thum T. Left ventricular hypertrophy and myocardial fibrosis in heart failure with preserved ejection fraction: mechanisms and treatment. Eur Heart J. 2026;47(1):37–53. 10.1093/eurheartj/ehaf524 . PubMed PMID: 40892534IF: 35.6 Q1 B1; PubMed Central PMCID: PMC12765563IF: 35.6 Q1 B1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Bazgir F, Nau J, Nakhaei-Rad S, Amin E, Wolf MJ, Saucerman JJ, et al. The microenvironment of the pathogenesis of cardiac hypertrophy. Cells. 2023;12(13):1780. 10.3390/cells12131780 . PubMed PMID: 37443814IF: 5.2 Q2 B2; PubMed Central PMCID: PMC10341218IF: 5.2 Q2 B2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Ritterhoff J, Tian R. Metabolic mechanisms in physiological and pathological cardiac hypertrophy: new paradigms and challenges. Nat Rev Cardiol. 2023;20(12):812–29. 10.1038/s41569-023-00887-x. [DOI] [PubMed] [Google Scholar]
- 5.Ritchie ME, Phipson B, Wu D, Hu Y, Law CW, Shi W, et al. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. 2015;43(7):e47–47. 10.1093/nar/gkv007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Yu G, Wang LG, Han Y, He QY. clusterProfiler: an R package for comparing biological themes among gene clusters. OMICS J Integr Biol. 2012;16(5):284–7. 10.1089/omi.2011.0118. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Shannon P, Markiel A, Ozier O, Baliga NS, Wang JT, Ramage D, et al. Cytoscape: a software environment for integrated models of biomolecular interaction networks. Genome Res. 2003;13(11):2498–504. 10.1101/gr.1239303 . PubMed PMID: 14597658IF: 5.5 Q1 B1; PubMed Central PMCID: PMC403769IF: 5.5 Q1 B1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Szklarczyk D, Kirsch R, Koutrouli M, Nastou K, Mehryary F, Hachilif R, et al. The STRING database in 2023: protein-protein association networks and functional enrichment analyses for any sequenced genome of interest. Nucleic Acids Res. 2023;51(D1):D638–46. 10.1093/nar/gkac1000 . PubMed PMID: 36370105IF: 13.1 Q1 B2; PubMed Central PMCID: PMC9825434IF: 13.1 Q1 B2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Li X, Zhang ZL, Wang HF. Fusaric acid (FA) protects heart failure induced by isoproterenol (ISP) in mice through fibrosis prevention via TGF-β1/SMADs and PI3K/AKT signaling pathways. Biomed Pharmacother. 2017;93:130–45. 10.1016/j.biopha.2017.06.002. [DOI] [PubMed] [Google Scholar]
- 10.Zhou L, Miao K, Yin B, Li H, Fan J, Zhu Y, et al. Cardioprotective Role of Myeloid-Derived Suppressor Cells in Heart Failure. Circulation. 2018;138(2):181–97. 10.1161/circulationaha.117.030811. [DOI] [PubMed] [Google Scholar]
- 11.Chen R, Zhang S, Liu F, Xia L, Wang C, Sandoghchian Shotorbani S, et al. Renewal of embryonic and neonatal-derived cardiac-resident macrophages in response to environmental cues abrogated their potential to promote cardiomyocyte proliferation via jagged-1–Notch1. Acta Pharm Sin B. 2023;13(1):128–41. 10.1016/j.apsb.2022.08.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Chen G, Sun Q, Xiong S, Cao T, Du B, Wang Q, et al. Spatial Lipid Metabolic Remodeling from Placenta to Multiple Suborgans during the Gestational Micro- or Nanoplastics Exposure. ACS Nano. 2025;19(48):41062–75. 10.1021/acsnano.5c13265 . PubMed PMID: 41263540IF: 16.0 Q1 B1. [DOI] [PubMed] [Google Scholar]
- 13.Li Y, Xiong Z, Yan W, Gao E, Cheng H, Wu G, et al. Branched chain amino acids exacerbate myocardial ischemia/reperfusion vulnerability via enhancing GCN2/ATF6/PPAR-α pathway-dependent fatty acid oxidation. Theranostics. 2020;10(12):5623–40. 10.7150/thno.44836 . PubMed PMID: 32373236IF: 13.3 Q1 B1; PubMed Central PMCID: PMC7196282IF: 13.3 Q1 B1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Ljubkovic M, Gressette M, Bulat C, Cavar M, Bakovic D, Fabijanic D, et al. Disturbed fatty acid oxidation, endoplasmic reticulum stress, and apoptosis in left ventricle of patients with type 2 diabetes. Diabetes. 2019;68(10):1924–33. 10.2337/db19-0423. [DOI] [PubMed] [Google Scholar]
- 15.Miklas JW, Clark E, Levy S, Detraux D, Leonard A, Beussman K, et al. TFPa/HADHA is required for fatty acid beta-oxidation and cardiolipin re-modeling in human cardiomyocytes. Nat Commun. 2019;10(1):4671. 10.1038/s41467-019-12482-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Eke C, Babcock S, Gaston G, Elizondo G, Chung H, Asal A, et al. Cardiomyopathy in a c.1528G > C hadha mouse is associated with cardiac tissue lipotoxicity and altered cardiolipin species. J Lipid Res. 2025;66(5):100792. 10.1016/j.jlr.2025.100792. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Miao H, Li B, Wang Z, Mu J, Tian Y, Jiang B, et al. Lipidome atlas of the developing heart uncovers dynamic membrane lipid attributes underlying cardiac structural and metabolic maturation. Research. 2022;2022:6. 10.34133/research.0006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Su K, Liu J, Chen J, Wu H, Tang W, Sun S, et al. Bisphenol C Induces Cardiac Developmental Defects by Disrupting m6 A Homeostasis. Environ Sci Technol. 2024;58(39):17259–69. 10.1021/acs.est.4c04373. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Gutiérrez-Cuevas J, Sandoval-Rodríguez A, Monroy-Ramírez HC, Vazquez-Del Mercado M, Santos-García A, Armendáriz-Borunda J. Prolonged-release pirfenidone prevents obesity-induced cardiac steatosis and fibrosis in a mouse NASH model. Cardiovasc Drugs Ther. 2021;35(5):927–38. 10.1007/s10557-020-07014-9. [DOI] [PubMed] [Google Scholar]
- 20.Ma Ylei, Huo X, wei, Wong C, Zhou F, jie, Li S, ze, Zhang H, et al. Salvianolic acid A targets glutamic-oxaloacetic transaminase 2 to ameliorate doxorubicin-induced myocardial oxidative injury by activating malate-aspartate NADH shuttle. Phytomedicine. 2025;148:157492. 10.1016/j.phymed.2025.157492. [DOI] [PubMed] [Google Scholar]
- 21.Liu X, Li X, Zhou H. Changes in glutamic oxaloacetic transaminase 2 during rat physiological and pathological cardiomyocyte hypertrophy. BMC Cardiovasc Disord. 2023;23(1):595–603. 10.1186/s12872-023-03648-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Liang Y, Liu D, Ochs T, Tang C, Chen S, Zhang S, et al. Endogenous sulfur dioxide protects against isoproterenol-induced myocardial injury and increases myocardial antioxidant capacity in rats. Lab Invest. 2011;91(1):12–23. 10.1038/labinvest.2010.156. [DOI] [PubMed] [Google Scholar]
- 23.Rocca C, Soda T, De Francesco EM, Fiorillo M, Moccia F, Viglietto G, et al. Mitochondrial dysfunction at the crossroad of cardiovascular diseases and cancer. J Transl Med. 2023;21(1):635. 10.1186/s12967-023-04498-5 . PubMed PMID: 37726810IF: 7.5 Q1 B2; PubMed Central PMCID: PMC10507834IF: 7.5 Q1 B2. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/Supplementary Material.
