Mixed-Lineage Leukemia 1 (MLL1) Regulates T Cell Phenotype via Notch Signaling During Abdominal Aortic Aneurysm Development

Abstract

Background:

Abdominal aortic aneurysms (AAA) are characterized by progressive pathological vascular remodeling and a dysregulated immune microenvironment marked by an imbalance between anti-inflammatory regulatory T cells (T_Regs) and pro-inflammatory Th17 cells within the aortic wall. The molecular mechanisms governing CD4⁺ T-cell differentiation during AAA development remain incompletely defined. Mixed lineage leukemia 1 (MLL1), a histone methyltransferase, has recently been shown to modulate T-cell lineage commitment through epigenetic regulation of transcriptional programs in multiple inflammatory diseases. We therefore sought to determine whether MLL1 promotes Th17 polarization during AAA development and to identify signaling pathways through which MLL1 regulates CD4⁺ T-cell infiltration and phenotype.

Methods:

Single-cell RNA sequencing was performed on human AAA and non-aneurysmal aortic tissues. Two murine AAA models were utilized: angiotensin II (AngII) infusion with adeno-associated virus–mediated PCSK9 gain-of-function expression and topical porcine pancreatic elastase application in C57BL/6J mice. Mice with CD4⁺ T cell–specific deletion of Notch signaling (DNMAML^fl/flCD4^cre+), Notch1 (Notch1^fl/flCD4^cre+), or MLL1 (Mll1^fl/flCD4^cre+) were subjected to AngII infusion, and aneurysm diameter was quantified. CD4⁺ T cells were isolated by MACs for gene expression analysis and flow cytometric phenotyping. Chromatin immunoprecipitation assessed H3K4me3 enrichment at target gene promoters.

Results:

Single-cell sequencing of human AAA tissue demonstrated marked upregulation of MLL1 and Notch1 signaling in CD4⁺ T cells compared with controls. Both human AAA and murine AngII-induced AAA CD4⁺ T cells exhibited a predominant Th17 phenotype with increased MLL1 expression. ChIP analysis revealed enhanced MLL1-mediated H3K4me3 enrichment at the Notch1 promoter. Mice deficient in CD4⁺ Th cell Notch signaling (DNMAML^fl/flCD4^cre+ or Notch1^fl/flCD4^cre+) or MLL1 (Mll1 ^fl/flCD4^cre+) displayed significant reduction in aneurysm formation, decreased Th17 activity, and increased T_Reg expression.

Conclusions:

MLL1 epigenetically regulates Notch1 signaling to drive pathogenic Th17 polarization during AAA development. Targeting the MLL1 axis may represent a novel therapeutic strategy to limit aneurysmal progression.

INTRODUCTION

Abdominal aortic aneurysms (AAA) are a common vascular disease that can progress to the potentially fatal consequence of aortic rupture which has a mortality of over 80%.¹ Recent studies suggest there may be greater than 1 million people in the United States living with an AAA.² Despite advances in the surgical and endovascular management of AAAs, to date there are no proven pharmacological interventions that slow AAA growth or prevent rupture.³ Cumulative efforts to understand mechanisms that contribute to AAA dilation have consistently highlighted inflammation as a key feature of AAA onset as demonstrated by extensive medial and adventitial inflammatory cell infiltration into the vessel wall.⁴ Within patient clinical samples and animal aneurysm models T cells, including various subclasses of CD4⁺ cells, have been shown to represent 50% of the invading immunocytes within the aortic wall and play a critical and distinct role in AAA development and progression to rupture.^5,6 Identifying the mechanisms that drive CD4⁺ T cell inflammation within AAA disease is a crucial step towards developing effective therapeutics.

One distinct CD4⁺ T cell subclass is CD4⁺CD25⁺FOXP3⁺ regulatory T (T_Reg) cells which are critical for the induction and maintenance of immune homeostasis and tolerance.⁷ These anti-inflammatory T cells prominently regulate autoimmunity, allergic reaction, inflammation, and response to infections.⁸ T_Reg cells are often insufficient or functionally defective in patients with autoimmune diseases,⁹ as well as metabolic and cardiovascular diseases.¹⁰ Patients with acute coronary syndrome (ACS) exhibit reduced numbers and compromised functional properties of T_Reg cells.¹¹ Within AAA disease, prior investigations have demonstrated that depletion of T_Reg cells with an anti-CD25 monoclonal antibody in mice increased the incidence and severity of AAA.¹² Furthermore, T_Reg cell-deficient CD80^−/−/CD86^−/− or CD28^−/− mice showed enhanced susceptibility to angiotensin II-induced AAA, whereas adoptive transfer of T_Reg cells into CD28^−/− mice reduced aneurysm formation and rupture.¹³

A separate T cell subclass are Th17 cells, that have been shown to be involved in immune regulation autoimmune and inflammatory diseases.⁵ Th17 cells are regulated by the transcription factor RORγt, and characterized by the production of cytokines IL-17A, IL-17F, and IL-22¹⁴, which have an immune-stimulating and pro-inflammatory role resulting in the accelerated development of several inflammatory illnesses, including atherosclerosis.^15,16 For AAA disease, genetic and pharmacological inhibition of Th17 cellular function has been shown to decrease IL17 production and limit aortic dilation in murine models.¹⁷ The importance of both T_Reg and Th17 subtypes to aneurysm progression have been confirmed in human AAA tissue whereby an imbalance of the pro- and anti-inflammatory T_Reg/Th17 ratio occurs in the aneurysmal wall.^18,19 Indeed, the balance of these two particular CD4⁺ Th phenotypes, the anti-inflammatory T_Reg and proinflammatory IL-17A–producing CD4⁺ Th17 cells, can independently dictate inflammation in aortic tissues.^19,20 Despite the critical importance of T_Reg and Th17 in AAA development and expansion, the molecular mechanisms that program and sustain the T_Reg /Th17 phenotypic balance in AAA disease have not been identified.

The fate of CD4⁺ Th cell differentiation in tissue is determined via its T cell receptor and cytokine signals²¹; however, cell-to-cell Notch signaling is also known to play a critical role.^22,23 In humans and mice, there are 4 Notch receptors (Notch 1–4) and 5 ligands (Delta-like 1, 3, 4, and Jagged 1 and 2). Once bound by its ligand, Notch receptors undergo proteolytic cleavage events that result in the release of Notch intracellular domain (NICD), which translocates to the nucleus and functions as a transcription factor to complex with the DNA binding protein CSL, Mastermind-like protein 1 (MAML), and histone acetyltransferases. This, in turn, promotes transcription of downstream Notch target genes (i.e., Hes, Hey). Depending on the context and location, loss of Notch signaling has been shown to both inhibit Th17 differentiation^24–26 and drive T_Reg differentiation.^27,28 In other instances, Notch signaling protects T_Reg cells from apoptosis and enhances T_Reg functionality.^29–31 These studies, which were primarily done in vitro, do not provide a succinct likely mechanism of how Notch receptor–mediated signaling influences CD4⁺ Th cell phenotypes in aortic aneurysmal disease.

Additionally, CD4⁺ Th cell phenotypic state is tightly regulated by transcriptional reprogramming, which is achieved by modifications of chromatin accessibility and the epigenetic landscape. Accumulating evidence suggests that epigenetic regulation of gene expression, via mechanisms such as histone modification, is a major influence on innate immune cell phenotypes in both normal and pathologic conditions.^32–34 Histone methylation is important as it maintains active or suppressed gene expression, depending on the methylation site, and thereby controls downstream protein expression patterns. For example, methylation of lysine 4 (K4) of histone 3 (H3) maintains the chromatin in a confirmation such that the promoters for specific genes are available for transcription and thus genes are epigenetically active. In contrast, methylation of lysine 27 on H3 condenses the chromatin and inactivates gene expression.³⁵ Prior work by our lab and others has identified that epigenetic modifications regulate immune-mediator expression in macrophages both in vitro and in vivo.^34,36 Specifically, mixed-lineage-leukemia-1 (MLL1) is a chromatin-modifying enzyme (CME) that upregulates gene transcription via H3K4me3 at promoter sites³⁷ and has been shown to regulate Notch signaling pathways in oncogenesis research.³⁸ Furthermore, alterations to histone methylation by other CMEs have been shown to influence Th cell phenotype in vitro.^39,40 Currently, the role of MLL1 in Th cells in cardiovascular disease is unknown.

Herein, we provide experimental evidence that the epigenetic enzyme MLL1 drives aberrant Notch1 signaling in CD4⁺ Th cells resulting in an imbalance of T_Reg and Th17 cellular inflammation within the aorta producing pathological inflammation and AAA development. Specifically, using two well-established murine AAA models (elastase-induced AAAs and angiotensin (Ang) II-induced AAAs) and human aortic tissue samples we demonstrate that Notch 1 signaling was upregulated in AAA CD4⁺ Th cells. Mechanistically we demonstrate that Th-cell specific MLL1 induces Notch signaling by increasing the activating histone methylation mark H3K4me on the Notch 1 promoter. The increased Notch1 signaling preferentially skews Th cell phenotype toward a proinflammatory Th17 state with increased IL17 secretion within the aortic wall. Targeted inhibition in a CD4⁺ Tcell-specific Notch1 signaling or MLL1 activity prevented AAA expansion and was associated with a reduction in proinflammatory Th17 state and reciprocal increase in anti-inflammatory T_Reg state. Overall, these findings identify MLL1 as a critical regulator of Notch 1 signaling and Th17/T_Reg inflammation during aneurysmal progression and demonstrate translational implications as cell-targeted manipulation of this pathway is feasible to reduce AAA development.

MATERIALS AND METHODS

The data that support the findings of this study are available from the corresponding author upon reasonable request.

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Mice were maintained in the University of Michigan pathogen-free animal facility, and all protocols were approved by and in accordance with the guidelines established by the Institutional Animal Care and Use Committee (UCUCA). Male mice were used for AAA experiments as detailed in the American Heart Association Council statement.⁴¹ Only male mice were used for these studies as female mice do not adequately develop AAAs.⁴¹ Mouse strains include: C57BL/6J mice maintained on a normal diet (ND) (13.5% kcal fat; LabDiet 5001) were purchased at 8–10 weeks from The Jackson Laboratory (Bar Harbor, ME). Mice with the Dnmaml, Notch1, or Mll1 gene deleted in Th cells (Dnmaml^fl/fl CD4^Cre+, Notch1^fl/fl CD4^Cre+, Mll1^fl/fl CD4^Cre+) were generated by mating floxed mice with CD4^Cre mice (The Jackson Laboratory).⁴² Mll1 deletion efficacy in the Mll1^fl/fl CD4^Cre+ was 87% (data not shown). Animals were housed in a barrier facility on a light:dark cycle of 14 : 10 hours (ambient temperature of 22°C) with free access to water, food (Lab diet 5001), and bedding (Andersons Lab Bedding Bed o’Cobs combo). Animals underwent all procedures at 8–10 weeks of age. The number of animals per group in all the experiments was determined on the basis of prior literature and experience from our previous studies to ensure sufficient sample sizes to allow the detection of statistically significant differences. No animals were excluded from analysis. The number of replicates for each experiment is labeled in all figures or legends. Animal studies were approved by the ethics committees of the University of Michigan IACUC.

Production and Injection of Adeno-associated Viral (AAV) Vectors

Adeno-associated virus (AAV) vectors (serotype 8) were produced by the Viral Vector Core at the University of Pennsylvania (https://gtp.med.upenn.edu/core-laboratories-public/vector-core). These AAV vectors contained inserts expressing mouse PCSK9D377Y mutation (equivalent to human PCSK9D374Y gain-of-function mutation). Empty AAV vector (null AAV) was used as control. AAV vectors were diluted in sterile PBS (200 μl per mouse) and injected intraperitoneally as reported previously.⁴³ Mice inclusion and randomization were conducted as previously specified. Further, mice had a predefined exclusion from the data analysis if plasma total cholesterol concentrations were < 250 mg/dl 3 weeks and < 500 mg/dl 6 weeks after PCSK9D377Y.AAV injection.⁴³ Briefly, mice received injections of AAVs containing either a null insert or a mouse PCKS9 insert expressing D377Y mutation intraperitoneally with 2 × 10¹¹ genomic copies of adeno-associated virus carrying a gain-of-function mutation of mouse Pcsk9. Immediately after AAV injections, normolipidemic mice were fed a diet containing saturated fat (Diet #TD.88137, Envigo; 0.2% cholesterol and 21.2% percent fat by weight) for 2 weeks at which time they underwent implantation of mini osmotic pumps as described below. Body weights were determined prior to experimentation.

Osmotic Mini Pump Implantation and AngII Infusion

To induce AAAs, 8–10 week male C57BL/6J mice were injected with AAV and started on a saturated fat diet as detailed above. Following two weeks of saturated fat diet feeding, mice were randomized to receive mini osmotic pumps (Model 2004; Alzet) containing AngII (1,000 ng/min per kilogram, Cat# H-1706; Bachem) or saline were implanted subcutaneously in the neck region of anesthetized mice following a protocol described previously.⁴⁴ Briefly, mice were anesthetized in a closed chamber with isoflurane (3%) in oxygen for 2 to 5 minutes until immobile. Each mouse was then removed and taped on a heated (35 to 37°C) procedure board with isoflurane (1.0% to 1.5%) administered via nosecone during minor surgery. Pumps were implanted subcutaneously on the right flank of each mouse which provided AngII or saline infusion for 28 days. Incisions were closed with surgical staples and post-operative analgesia (buprenophine, 0.05 mg/kg/12 h, intraperitoneal) was administered. The primary outcome for the investigations was change in AAA diameter in the genetic groups. Animal experiments were conducted following the NIH guidelines and were approved by the IACUC of the University of Michigan.

Elastase treatment model of aneurysm formation

A murine elastase treatment model of AAA formation was used as described by Laser et al.⁴⁵ In brief, the infrarenal aorta was treated topically with 30 μl elastase reconstituted with normal saline (5 U/mg protein) or 30 μl heat-inactivated elastase (at 90°C for 30 min) as a control group. The topical application was accomplished by dropping the elastase on the anterior aorta from a 2 cm height for 5 min. Video micrometric measurements of aortic diameters were made in situ before perfusion, after perfusion, and before harvesting the aorta on day 14. Maximum infrarenal aortic diameter was measured ex vivo and ratio of treated vs. untreated section of the aorta was calculated.

Quantification of Aortic Pathologies

For in vivo imaging of the abdominal aorta in mice, 2-dimensional (B-mode) ultrasound images were obtained 27 days after the implantation of osmotic pumps using a VisualSonics Vevo2100 imaging system with a mechanical transducer (MS400) from the University of Michigan Frankel Center for Physiology. Two independent investigators measured aortic diameters at systole with no significant interobserver or intraobserver variability and were blinded to group assignments.

At the completion of each murine aneurysm experiment (day 28), mice were deep anesthetized with ketamine (100 mg/kg) and xylazine (20 mg/kg). At termination after blood collection, right atrium was cut open, and saline was perfused through the left ventricle to remove blood in aortas. Subsequently, aortas were dissected and placed in either RNA later or 10% neutrally buffered formalin overnight at room temperature. After fixation, periaortic fat tissue was removed thoroughly. Maximal outer diameters of suprarenal aortas were measured in vivo ultrasound as a parameter for abdominal aortic aneurysm (AAA) quantification using ImageJ software (National Institutes of Health, Bethesda, MD). AAA was defined as a 50% increase in maximal aortic diameter compared to baseline.

Necropsy was performed for mice that died during AngII infusion. Aortic rupture was defined as observation of blood clots in either the thoracic cavity (thoracic aortic rupture) or retroperitoneal cavity (abdominal aortic rupture). There was no difference in early rupture between treatment groups and genotypes.

MACS of murine CD4⁺ Th cells

Briefly, following tissue morcellation, aortas were digested in a suspension of Elastase 1mg/ml (LS002292 Worthington, Lakewood, NJ), Collagenase D 0.2 mg/ml (Roche Diagnostics, 11088858001), Dispase I 0.2 U/ml (07923 Stemcell,Cambridge, Mass), and DNase I 60 units/ml (Roche 10104159001). RPMI + FBS were then added to stop the reaction, and the cells were filtered through a 100 μm filter and subsequently run through a CD4+ MACS Selection Kit (Stemcell Technologies, 18952), achieving a 98.4% purity measured by FACS. For splenocytes, no digestion was performed and the morcellated samples were simply filtered through a 40 μm filter before running MACS.

In vitro T cell Stimulation and MM-102 Treatment

Naïve CD4 T cells were isolated from the wild type C57BL6 mouse spleen using EasySep^™ Mouse Naïve CD4+ T Cell Isolation Kit (STEMCELL cat#19765) and plated onto anti-mouse CD3ε antibody (clone 145–2C11, 5ug/ml, Biolegend cat#100339) coated cell culture dishes. Cells were polarized toward Th17 differentiation for 7 days in the presence of the following antibodies and cytokines: anti-mouse CD28(clone 37.51, 5ug/ml, Biolegend cat# 102116), recombinant mouse IL-6 (50ng/mL, Cell Signaling Technology #50977), recombinant human TGF-β1 (1ng/mL, Biolegend Cat# 781802), recombinant mouse IL-23 (5ng/ml, Biolegend Cat# 589002), anti-mouse IL-4 (10μg/mL, Biolegend Cat# 504122) and anti-mouse IFN-γ (10μg/mL, Biolegend Cat# 505834). This was conducted in the presence of absence of MM-102 (2 ug/ml). The cell culture medium was replaced with fresh medium containing the above antibodies and cytokines on day 3.

Flow Cytometry

Aortic flow cytometry was conducted as previously described.⁴⁶ Briefly, following tissue isolation, aortas minced and digested in a suspension of Elastase 1mg/ml (LS002292 Worthington, Lakewood, NJ), Collagenase D 0.2 mg/ml (Roche Diagnostics, 11088858001), Dispase I 0.2 U/ml (07923 Stemcell,Cambridge, Mass), and DNase I 60 units/ml (Roche 10104159001) for 45 minutes at 37°C shaking at 150 rpm. Blood and spleen suspensions were prepared after lysing red blood cells. Single-cell suspensions were meshed on a 70-mm cell strainer. Cells were first stained with a LIVE/DEAD Fixable Yellow Dead Cell Stain Kit (Molecular Probes, Invitrogen, L34959; 1:1,000 dilution) and then washed 2 times with cold PBS. Cells were then resuspended in flow buffer (500 mL PBS, 0.5 g BSA, 5 mL 2% NaN3 in water, and 5 mL of 1M Hepes Buffer), and Fc-receptors were blocked with anti-CD16/32 (BioXCell, CUS-HB-197, 1:200 dilution) prior to surface staining. Following surface staining, cells were washed twice. Next, cells were either washed and acquired for surface-only flow cytometry, or they were fixed with 2% formaldehyde and then washed/permeabilized with BD perm/wash buffer (BD Biosciences, 00-8333-56) for intracellular flow cytometry. Antibodies utilized for flow cytometry are as follows: CD3 APC (Invitrogen, 17-0031-82, 1:400 dilution), CD4 (BioLegend, 100547, 1:400 dilution), CD25 (BioLegend, 102051, 1:400 dilution), FoxP3 (BioLegend, 126404, 1:200 dilution), RORγ (Invitrogen, 2-6988-82, 1:200 dilution), CD19 (Bio- Legend, 115506, 1:400 dilution), Gr1 (BioLegend, 108406, 1:400 dilution), and CD8 (BioLegend, 100705, 1:400 dilution). After washing, samples were then acquired on a 3-Laser Novocyte Flow Cytometer (Acea Biosciences). Data were analyzed using FlowJo software version 10.0 (Tree Star Inc.) and compiled using Prism software 9.2 (GraphPad). To verify gating and purity, all populations were routinely back-gated.

ChIP assay.

ChIP assay was performed as described previously.⁴⁷ Briefly, cells were fixed in 1% paraformaldehyde and lysed and sonicated using a Bioruptor Pico (Diagenode) to generate 300–500 bp fragments. Samples were then incubated overnight in anti-H3K4me3 antibody (ab8850, Abcam) or isotype control (rabbit polyclonal IgG; ab171870, Abcam) in parallel followed by addition of protein A-Sepharose beads (Thermo Fisher Scientific). Beads were washed and bound; DNA was eluted and purified using phenol/chloroform/isoamyl alcohol extraction followed by ethanol precipitation. H3K4me3 deposition was measured by qPCR using 2X SYBR PCR mix (Thermo Fisher Scientific) and primers targeting NF-κB binding sites in the Notch1 and Notch2 promoters. Primers were designed using the Ensembl genome browser to search the Notch1, Notch2, Rorγ, and Foxp3 promoters for NF-κB within the promoter region, and then NCBI Primer-BLAST was used to design primers that flank this site. The following primers were used to amplify DNA in samples: Notch1: 5′ – AATGGAGGGAGGTGCGAAGT– 3′ and 5′ – AAGGCTCCGCTGCAGACA – 3′; and Notch2: 5′ – CCGCTGTCCCCCTCAGT– 3′ and 5′ – AGCGTTGGGCTGCAACA – 3′

RNA Analysis

Total RNA extraction was performed using Trizol (Invitrogen) according to manufacturer’s instructions. RNA was then reversed transcribed to cDNA using iScript (Biorad). PCR was performed with 2X Taqman PCR mix using the 7500 Real-Time PCR System. Primers for Notch1 (Mm00627185_m1), Notch2 (Mm00803077_m1), Notch3 (Mm01345646_m1), Notch4 (Mm00440525_m1), Hey1 (Mm00468865_m1), Hey2 (Mm01180513_m1), Hes1 (Mm01342805_m1), Dll4 (Hs00184092_m1 and Mm00444619_m1), and Mll1 (Mm01179235_m1) were purchased (Applied Biosystems). 18S or GAPDH was used as the internal control. Primers for human tissue included: MLL1 (Hs00610538_m1) were purchased (Applied Biosystems). Data were then analyzed relative to 18s ribosomal RNA or GAPDH (2ΔCt). All samples were assayed in triplicate. The threshold cycle values were used to plot a standard curve. Data are representative of 2–3 independent experiments were compiled in Microsoft Excel and presented using Prism software (GraphPad).

Inflammatory cytokine ELISA

Either whole wound homogenates or ex vivo isolated CD4+ Th cells had IL-17A levels measured by ELISA kits for IL-17A and IL-22 (R&D systems) per the manufacturer’s protocol.

Human Tissue

Full-thickness aortic wall tissue specimens were collected from the infrarenal abdominal aorta from patients undergoing open aortic aneurysm repair or open aorto-bifemoral bypass. The aneurysmal samples were taken from the midportion of the aneurysmal sac. For control samples, aortic tissue was isolated from patients with atherosclerotic occlusive disease but no history of aneurysmal disease at the time of open aorto-bifemoral bypass. For single cell RNA-sequencing (scRNA-seq) a second cohort of samples were retrieved from the infrarenal abdominal aorta of patients undergoing open aortic aneurysm repair (n=4) or open aorto-bifemoral bypass (n=2). Patient medical comorbidities can be seen in Supplemental Table I.

Single Cell RNA-Seq and Bioinformatics Analysis

Generation of single cell suspensions for scRNA-seq was performed as follows: Aortic tissue from aneurysmal and non-aneurysmal controls was harvested at the time of surgical intervention. Briefly samples were minced, digested in 0.2% Collagenase II (Life Technologies) and 0.2% Collagenase V (Sigma) in plain medium for 1 hour at 37°C, and strained through a 70μM mesh. The scRNA-seq samples were analyzed by the University of Michigan Advanced Genomics Core on the 10X Chromium system. Libraries were sequencing on the Illumina NovaSeq 6000 sequencer to generate 151-bp paired end reads. Data processing including quality control, read alignment and gene quantification were conducted using the 10X Cell Ranger software. Seurat 4.0⁴⁸ was used to merge and process the gene expression matrices. SoupX (v 1.6.2)⁴⁹ was used to remove ambient RNA using default parameters. ScDblFinder (v 1.16.0)⁵⁰ was used to remove doublets, using default parameters. The merged data matrices were then log normalized, scaled, and principal component analysis was performed and the top 50 principal components were used for UMAP/batch correction computation. Harmony (v 1.0.1)⁵¹ UMAP coordinates were used to define cluster boundaries. Clustering resolution was set to default parameters. Clusters were labeled manually using a custom list of marker genes in line with our previous publications on human scRNA dataset⁵² and murine scRNA datasets.^53–55 The reference genomes included the human genome- hg19–3.0.0 and mouse genome - mm10. Initial quality control includes removal of genes present in < 3 cells, cells containing <200 UMI, and >10% mitochondrial genes were removed. Differentially expressed genes were identified using the likelihood ratio test. Likelihood ratio test with generalized regression was used for differential expression analysis using min.pct = 0.1, log2FC = log2(1.2) using Seurat’s FindAllMarkers function. Significance was determined by adjusted p-value < 0.05 and |log2 fold change| > log2(1.2). Clustered cells were mapped to corresponding cell types by matching cell cluster gene signatures with putative cell-type specific markers. Data Availability Statement: The human single cell RNA-sequencing data for this paper is available at GEO accession number of GSE166676 as previously described.⁵⁶ The murine single single cell RNA-sequencing data for this paper is available at GEO accession numbers of GSE118237, GSE152583, and GSE164678

Statistical Analysis

Data were analyzed using GraphPad Prism software version 6. Unless indicated otherwise, data are presented as mean ± standard error of the mean (SEM). After examining whether all variables were normally distributed by the Kolmogorov-Smirnov or Shapiro-Wilk test followed by Q-Q plots analysis and assessing the assumption of equal variances using Levene test (where a P>0.05 indicated homogeneity of variances), statistical differences were determined by Mann-Whitney U test or Student t test for comparison between 2 groups and Kruskal-Wallis with Dunn multiple comparisons test or 1-way ANOVA followed by Bonferroni multiple comparison test for comparison among ≥3 groups. P values of <0.05 were considered statistically significant. Differentially expressed genes from scRNA-seq datasets were identified using the LR test. Significance was determined by adjusted p-value < 0.05 and |log2 fold change| > log2(1.2).

Study Approval

All animal procedures were performed according to protocols approved by the Institutional Animal Care & Use Committee (IACUC) at the University of Michigan. The human aortic tissues used in this study were obtained from the he Frankel Cardiovascular Center (CVC) at the University of Michigan with the Institutional Review Board HUM00098915 from the Human Research Protection.

Data Availability

Further information for data, resources, and reagents can be found in supplemental resources or queries should be directed to and will be fulfilled by the Lead Contact, Frank Davis (davisfr@med.umich.edu).

RESULTS

Human and Murine AAA CD4⁺ T cells Display Increased Th17 and Notch Signaling

Given that the balance of T_Reg/Th17 has been shown to modulate inflammation, and that Th17 cells have been shown to negatively influence vascular inflammation¹⁷, we examined our human single-cell transcriptional profiling of aortic tissues from AAA and nonaneurysmal control samples to identify T_Reg/Th17 CD4⁺ Th cell phenotypes. Within our human single cell sequencing analysis⁵⁶, the T lymphocytes were the largest immune cell population identified in aortic tissue corresponding to cells with high gene expression of CD3D, CD3E, IL7R, and TRBC2. This demonstrated increased CD4⁺ Th17 cells in AAA tissue as compared with nonaneurysmal controls (Figure 1A). We further conducted, reanalysis of single cell RNA sequencing (scRNA-seq) datasets from the murine Angiotensin II-induced AAA model and Calcium Chloride (CaCl₂)-induced AAA model. This also demonstrated increased CD4⁺ Th17 cells and decreased T_Reg cells in murine AAA tissues compared to controls (Figure 1B). To confirm the murine scRNA-seq gene expression analysis was consistent with CD4⁺ Th cellular function, we examined murine CD4⁺ Th cells isolated from the AngII-induced AAA model and performed intracellular flow cytometry. We found that AAA CD4⁺ T cells from the blood, spleen, and local aortic tissue all demonstrated an increased Th17 phenotype (Figure 1C). Importantly, this imbalance between CD4⁺ T_Reg and Th17 phenotypes in AAA tissues resulted in an increase in aortic IL-17A by ELISA (Figure 1D).

Figure 1. Human and murine AAA CD4⁺ T cells display increased Th17 and IL-17A.

A. Integrated cluster analysis using the uniform manifold approximation and projection (UMAP) technique of single cell sequencing from human AAA (n=4 patients) and nonaneurysmal (n=2 patients) samples revealed 21 distinct cell clusters (representative). Source data are provided as a Source Data file. Dot plot demonstrating increased RORy CD4⁺ Th17 cells in human AAA tissues compared nonaneurysmal control. p<0.01 for RORy human AAA vs. control T cells. Differentially expressed genes from scRNA-seq datasets and dot plots were identified using the LR test. Significance was determined by adjusted p-value < 0.05 and |log2 fold change| > log2(1.2). B. Integrated cluster analysis using the uniform manifold approximation and projection (UMAP) technique of single cell sequencing from murine AAA (n=5 patients) and nonaneurysmal (n=3 patients) samples revealed 21 distinct cell clusters (representative). Source data are provided as a Source Data file. Dot plot demonstrating increased Rory CD4⁺ Th17 cells and less Foxp3 CD4⁺T_Reg cells in murine AAA tissues compared with nonaneurysmal controls. p<0.001 for Foxp3 expression AngII-induced AAA vs. control and Calcium chloride-induced AAA vs. control. p-value<0.01 for Rory expression for AngII-induced AAA vs. control and Calcium chloride-induced AAA vs. control. Differentially expressed genes from scRNA-seq datasets and dot plots were identified using the LR test. Significance was determined by adjusted p-value < 0.05 and |log2 fold change| > log2(1.2). C. Analytical flow cytometry of blood, spleen and aortic tissue in saline and AngII-induced murine model on day 28 (n = 5 mice, run in triplicate). T_Reg identified as Lineage– (Lin–)/CD3⁺/CD4⁺/CD25⁺/FoxP3⁺, and Th17 cells identified as Lin–/CD3⁺/CD4⁺/RORγ⁺. For lineage-negative cells (defined as Lin–), we selected for cells that were negative for the following cell markers: CD19, GR-1, and CD8. D. IL-17A measured by ELISA in aortic tissues from saline and AngII-induced aortic aneurysm model (n = 3–4 mice). E. KEGG pathway analysis and Gene Ontology biological process analysis of differentially expressed genes in T cells from AAA and non-aneurysmal control tissue. F. Dot plot demonstrating increased NOTCH1 expression in human and in murine AAA tissues compared with nonaneurysmal controls. p<0.01 for NOTCH1 human AAA vs. control T cells. P<0.001 for Notch1 expression for AngII-induced AAA vs. control, elastase-induced AAA vs. control, and Calcium chloride-induced AAA vs. control. Differentially expressed genes from scRNA-seq datasets and dot plots were identified using the LR test. Significance was determined by adjusted p-value < 0.05 and |log2 fold change| > log2(1.2). *p< 0.05, **p< 0.01 for bar graphs. Data are presented as the mean ± SEM. All data are representative of 3 independent experiments.

Given that phenotypic and cellular alterations in CD4⁺ Th cell biology have been suggested to play an important role in vascular inflammation and cardiovascular disease, we conducted pathway analysis on differentially expressed genes in the CD4⁺ Th cell populations. Gene ontology demonstrated that CD4⁺ Th cell from AAA samples had upregulation of pathways involved in T cell receptor signaling, T cell proliferation, and cytokine production. Further consistent with alterations in the T_Reg/Th17 phenotypic balance, the Th17 cell differentiation was one of the most upregulated pathways within CD4⁺ Th cell from AAA samples (Figure 1E). Lastly, Notch 1 signaling was found to be substantially upregulated in CD4⁺ Th cells from human and murine CD4⁺ Th cells in AAA samples with minimal alterations in Notch 2–4 signaling pathways(Figure 1E, F and Supplemental Figure 1). Notch signaling plays an important role in regulating CD4⁺ Th cell phenotypes in various disease states however, Notch signaling is highly context specific, and its role in CD4⁺ Th cells in AAA disease has not been defined.

Notch signaling regulates CD4⁺ T_Reg/Th17 cell phenotypes in abdominal aortic aneurysms

Since our data suggest that Notch levels are altered in CD4⁺ Th cells in human AAA tissues and murine models, we sought to understand its role in AAA development and the regulation of CD4⁺ T_Reg/Th17 cell phenotypes. To achieve this end, we examined aortic aneurysm development in our Notch signaling–deficient mice.⁵⁷ This was achieved with a cassette encoding the Notch inhibitor Dominant negative mastermind like protein 1 (DNMAML) at the ROSA26 locus downstream of a floxed stop codon sequence that prevents transcription of DNMAML, crossed with CD4⁺-Cre mice on a C57BL/6 background compared with littermate control.²³ Specifically, male mice deficient in CD4⁺ Th cell Notch signaling (Dnmaml^fl/flCD4^cre+) and littermate controls (Dnmaml^fl/flCD4^cre+) were injected intraperitoneally with a single dose of an AAV vector expressing the mouse D377Y gain-of-function proprotein convertase subtilisin/kexin type 9 (PCSK9), which resulted in sustained hypercholesterolemia as described previously.⁴³ Following this, mice were fed a saturated fat enrich diet for 6 weeks and received either saline or AngII infusion (1000 ng/min/kg) for the last 4 weeks (Figure 2A). The use of a saturated fat diet and AngII infusion to induce AAAs recapitulates important clinical risk factors including dyslipidemia and hypertension. Following 4 weeks of AngII (1,000 ng/kg/min) infusion, body weight and plasma lipid profiles were comparable between the two groups. Nevertheless, CD4⁺ Th cell-specific deficiency of Notch signaling (Dnmaml^fl/flCD4^cre+) significantly decreased AAA diameter and incidence (Figure 2B–D). Depletion of T cell specific Notch signaling within the AngII-induced AAA murine model was confirm be decreased Hey1 and Hes1 expression (Figure 2E). In order to examine CD4⁺ Th cell phenotypes, intracellular flow cytometry was performed, and it demonstrated a decreased numbers of Th17 cells (CD4+RORγ⁺) and reciprocal increase in T_Reg cells (CD4⁺CD25⁺FoxP3⁺), as a percentage of total CD4⁺ Th cells, in the mice lacking Notch signaling (Dnmaml^fl/flCD4^cre+) compared with the Notch-competent littermate controls (Figure 2F and 2G). In agreement with this, aortas from Dnmaml^fl/flCD4^cre+ mice demonstrated decreased IL-17A on ELISA and reciprocal increase in Il10 and tgfb expression (Figure 2H and Supplemental Figure 2A). Taken together, these results suggest that inhibition of global Notch signaling in CD4⁺ Th cells reduces Th17 cell differentiation and prevents aortic aneurysm development.

Figure 2. Depletion of Notch signaling within T cells prevents AAA and alters Th cell phenotype.

A. Experimental design of CD4⁺ Th cell–specific Notch-deficient mice (Dnmaml^fl/flCD4^Cre+) and littermate controls in the AngII-induced AAA murine model. Mice were fed high fat diet for 6 weeks and infused with saline or AngII infusion (1,000 ng/min/kg) for 4 weeks. B. Representative ultrasound images of the abdominal aorta at day 28 in Dnmaml^fl/flCD4^Cre+ and littermate controls (Dnmaml^fl/flCD4^Cre-) that received either saline or AngII infusion. C, D. Maximal abdominal aortic diameter and aneurysm incidence as determined by ultrasound measured by two observers in Dnmaml^fl/flCD4^Cre+ and littermate controls with either saline or AngII infusion (n=3–11 mice). E. Hes1 and Hey1 expression in aortic CD4⁺ Th cells between Dnmaml^fl/flCD4^Cre+ and littermate controls (n = 3 mice). *p<0.05, **p<0.01 for ANOVA. F, G Analytical flow cytometry of aortic suspensions in saline and AngII-induced murine model on day 28 (n = 3–5 mice). T_Reg identified as Lineage– (Lin–)/CD3⁺/CD4⁺/CD25⁺/FoxP3⁺, and Th17 cells identified as Lin–/CD3⁺/CD4⁺/RORγ⁺. For lineage-negative cells (defined as Lin–), we selected for cells that were negative for the following cell markers: CD19, GR-1, and CD8. (n=3–5 mice) H. IL-17A measured by ELISA in aortic tissues from saline and AngII-induced aortic aneurysm model (n = 3 mice). *p<0.05, **p<0.01 for Welch’s t-test. Data are presented as the mean±SEM.

To further define which specific Notch receptor within CD4⁺ T cells may drive pathologic T cell inflammation during AAA development we returned to our human and murine scRNA-seq dataset which demonstrated that Notch1 appeared to be the most significantly elevated Notch receptor in AAA disease (Figure 1F). Further, prior work in other inflammatory disease states and tissues has linked Notch1 activation and Th17/T_Reg differentiation.^29,31 To evaluate the role of Notch1 within CD4⁺ T cells, mice with a CD4⁺ T cell specific depletion of Notch1 (Notch1^fl/flCD4^cre+) and littermate controls (Notch1^fl/flCD4^cre-) underwent the AngII-induced AAA model (Figure 3A). Following 4 weeks of AngII (1,000 ng/kg/min) infusion Notch1^fl/flCD4^cre+ mice had significantly decreased AAA maximal aortic diameter and AAA incidence (Figure 3B, C). Additionally, Notch1 downstream signaling as determined by Hey1 and Hes expression was decreased in Notch1^fl/flCD4^cre+ mice following AngII infusion compared to controls (Figure 3D). Analysis of T cell phenotype demonstrated that mice lacking the Notch1 CD4⁺ Tcell displayed a decreased in proinflammatory Th17 cell infiltration within the aortic wall as well as decreased IL17A expression. It was also noted that following AngII-infusion Notch1^fl/flCD4^cre+ mice had increased regulatory T cells within the aortic wall (Figure 3E, F). Overall, these data suggest that during AAA development Notch signaling, specifically Notch1 signaling, regulate Th17/T_Reg phenotypic balance during AAA development and inhibition of T cell specific Notch1 can decrease aortic dilation.

Figure 3. Depletion of T cell-specific Notch 1 signaling prevents AAA and alters Th cell phenotype.

A. Experimental design of CD4⁺ Th cell–specific Notch1-deficient mice (Notch1^fl/flCD4^Cre+) and littermate controls (Notch1^fl/flCD4^Cre-) in the AngII-induced AAA murine model. Mice were fed high fat diet for 6 weeks and infused with saline or AngII infusion (1,000 ng/min/kg) for 4 weeks. B. Representative ultrasound images of the abdominal aorta at day 28 in Notch1^fl/flCD4^Cre+ and littermate controls that received either saline or AngII infusion. C Maximal abdominal aortic diameter and aneurysm incidence as determined by ultrasound measured by two observers in Notch1^fl/flCD4^Cre+ and littermate controls with either saline or AngII infusion (n=3–9 mice). D. Hes1 and Hey1 expression in aortic CD4⁺ Th cells between Notch1^fl/flCD4^Cre+ and littermate controls (n=3–9 mice, run in triplicate). **p<0.01 for ANOVA. E. Analytical flow cytometry of aortic suspensions in Notch1^fl/flCD4^Cre+ and littermate controls following 28 days of AngII (n = 3–5 mice). T_Reg identified as Lineage– (Lin–)/CD3⁺/CD4⁺/CD25⁺/FoxP3⁺, and Th17 cells identified as Lin–/CD3⁺/CD4⁺/RORγ⁺. For lineage-negative cells (defined as Lin–), we selected for cells that were negative for the following cell markers: CD19, GR-1, and CD8. F. IL-17A measured by ELISA in aortic tissues Notch1^fl/flCD4^Cre+ and littermate controls with saline and AngII-induced aortic aneurysm model (n = 3–5 mice). *p<0.05, **p<0.01 for ANOVA. Data are presented as the mean±SEM.

MLL1 is Increased in Human and Murine CD4⁺ Th cells Regulates Notch1 Receptor Expression and Th17/T_Reg phenotype

Since we identified that Notch signaling can regulate CD4⁺ Th cell differentiation and Notch signaling is increased in AAA CD4⁺ Th cells, we sought to examine the regulation of Notch receptor genes in AAA CD4⁺ Th cells. Our group and others have identified that CMEs can control immune cell differentiation and are relevant in aortic aneurysm development, and since MLL1 has been shown to regulate Notch signaling in human cancer cell lines^23,58 we examined the role of the histone methyltransferase MLL1 in aortic CD4⁺ Th cells. Human and murine aortic tissues were analyzed for MLL1 expression. MLL1 was found to be significantly elevated in both whole aortic tissue from human AAA and two murine AAA models (AngII-induced AAAs and elastase-induced AAAs) (Figure 4A–B). Given this represents whole tissue expression of MLL1 we then analyzed MLL1 expression within on CD4⁺ Th cells from scRNAseq datasets from human and murine tissues. This demonstrated that MLL1 was significantly increased in human AAA CD4⁺ Th cells compared to T cells isolated from nonaneurysmal control patient samples (Figure 4C–D). In addition, when we analyzed previously published scRNA-seq datasets from multiple murine AAA models we found that MLL1 was increased in CD4⁺ Th cells isolated from the AngII-induced, elastase-induced, and calcium chloride-induced AAA murine model (Figure 4E–F). To gain increasing mechanistic insight into the difference between CD4⁺ Th cells that express MLL1 and those that do not, we conducted pathway analysis on differentially expressed genes in MLL1⁺ and MLL1⁻ CD4⁺ Th cells populations. As expected, gene ontology demonstrated that MLL1⁺ CD4⁺ Th cells from AAA samples had upregulation of pathways involved chromatin remodeling and histone regulation in comparison MLL1⁻ CD4⁺ Th cells populations. However, MLL1⁺ CD4⁺ Th cells also displayed upregulation in T cell receptor signaling, Th17 cell differentiation, and Notch signaling thereby suggesting that MLL1 is instrumental to the activation of Notch signaling and Th17 cell differentiation (Figure 4G). We further confirmed the importance of MLL1 in regulating Notch1 signaling by conducted chromatin immunoprecipitation on CD4⁺ Th cells in the AngII-induced AAA model. CD4⁺ T cells isolated from AAA tissues displayed elevated MLL1 expression and increased presence of the MLL1-specific epigenetic mark, H3K4 trimethylation (H3K4me3), on the Notch1 promoter (Figure 4H) suggesting that increased Notch receptors in AAA CD4⁺ Th cells may be in part due to upregulated MLL1.

Figure 4. Histone methyltransferase MLL1 is increased in CD4⁺ T cells in human and murine AAA tissues.

A. Aortic tissue from patients with AAA (n=19 patients) and atherosclerotic controls (n=6 patients) were collected. No statistical differences were found between groups with respect to sex, age, or comorbid conditions. MLL1 gene expression was measured by qPCR. B. Mll1 mRNA levels, relative to 18S, were determined by qPCR in murine suprarenal abdominal aortas of C57BL/6J mice injected intraperitoneally with AAV-Pcsk9.D377Y and infused with saline or Ang II (1000 ng/kg/min) for 28 days. (n = 3–6 mice/group). Mll1 mRNA levels, relative to 18S, were determined by qPCR in infrarenal abdominal aortas of C57BL/6J mice at day 14 after elastase exposure or heat-inactivated elastase exposure for 30 minutes (n = 6 mice/group). C, D. Integrated cluster UMAP analysis and dot plots of MLL1 gene expression in CD4⁺ T cells from human AAA and non-aneurysmal control tissue analyzed by scRNA-seq. p<0.01 for MLL1 human AAA vs. control T cells. Differentially expressed genes from scRNA-seq datasets and dot plots were identified using the LR test. Significance was determined by adjusted p-value < 0.05 and |log2 fold change| > log2(1.2). E, F. Integrated cluster UMAP analysis and dot plots of MLL1 gene expression in CD4⁺ T cells from three separate murine AAA models; AngII-induced AAA model, elastase-induced AAA model, and CaCl₂-induced AAA model. p<0.001 for Mll1 expression for AngII-induced AAA vs. control, elastase-induced AAA vs. control, and Calcium chloride-induced AAA vs. control. Differentially expressed genes from scRNA-seq datasets and dot plots were identified using the LR test. Significance was determined by adjusted p-value < 0.05 and |log2 fold change| > log2(1.2). G. KEGG pathway analysis and Gene Ontology biological process analysis of differentially expressed genes in MLL⁺ vs. MLL1⁻ T cells from aortic tissue. H. Mll1 mRNA levels, relative to 18S, were determined by qPCR in murine CD4⁺ T cells of C57BL/6J mice injected intraperitoneally with AAV-Pcsk9.D377Y and infused with saline or Ang II (1000 ng/kg/min) for 28 days. (n = 5 mice/group conducted in triplicate). ChIP analysis for H3K4me3 at Notch1 promoter was performed (n=3 mice/group run in triplicate). For all ChIP experiments, isotype-matched IgG was run in parallel. Dotted line represents isotype control. *p<0.05, **p<0.01 for Welch’s t-test. Data are presented as the mean±SEM.

Given that the AAA CD4⁺ Th cells demonstrate a skewed differentiation toward the Th17 phenotype or away from the T_Reg phenotype, we examined if genetic blockade of MLL1, specifically in CD4⁺ Th cells could reverse the increased Notch signaling in AAA tissues to more physiologic levels and reduce Th17 differentiation. Specifically, mice with a CD4⁺ Th cell-specific depletion of MLL1 (Mll1^fl/flCD4^cre+) and littermate controls (Mll1^fl/flCD4^cre-) underwent the AngII-induced AAA model with temporal monitoring of aortic dilation (Figure 5A). Mll1^fl/flCD4^cre+ mice were less susceptible to AngII-induced AAA formation with significantly decreased abdominal aortic diameter (Figure 5B–D). To determine the transcriptional effects of CD4⁺ Th cell-specific MLL1 deficiency on gene expression, in vivo Th cells were sorted from our Mll1^fl/flCD4^cre+ and Mll1^fl/flCD4^cre- mice after 28-days of saline or AngII infusion and ChIP was conducted. We found a significant reduction in both MLL1 specific H3K4me3 on the Notch1 promoter as well as decrease Notch1 gene expression in Mll1^fl/flCD4^cre+ mice following AngII infusion (Figure 5E). We further analyzed downstream Notch signaling genes and found in Mll1^fl/flCD4^cre+ Hes1 expression was significantly decreased (Figure 5F). Taken together, this suggests that the absence of MLL1 prevented Notch1 expression and downstream signaling activity. Given the decrease Notch1 signaling in the mice with Th cell-specific MLL1 genetic depletion we sought to determine if this impacted T cell phenotype during AAA development. We performed flow cytometry and found Mll1^fl/flCD4^cre+ mice displayed decreased in proinflammatory Th17 cell infiltration within the aortic wall as well as decreased IL17A expression and reciprocal increase in Il10 and tgfb expression. This was coupled with a reciprocal increase in T_Reg expression with the aortic wall (Fig 5G, H and Supplemental Figure 2C).

Figure 5. Depletion of CD4⁺ T-specific MLL1 prevents AAA and alters Th cell phenotype.

A. Experimental design of CD4⁺ T cell–specific MLL1-deficient mice (Mll1^fl/flCD4^Cre+) and littermate controls (Mll1^fl/flCD4^Cre-) in the AngII-induced AAA murine model. Mice were fed high fat diet for 6 weeks and infused with saline or AngII infusion (1,000 ng/min/kg) for 4 weeks. B. Representative ultrasound images of the abdominal aorta at day 28 in Mll1^fl/flCD4^Cre+ and littermate controls that received either saline or AngII infusion. C, D. Maximal abdominal aortic diameter and aneurysm incidence as determined by ultrasound measured by two observers in Mll1^fl/flCD4^Cre+ and littermate controls with either saline or AngII infusion (n=3–7 mice). E. CD4⁺ cells were isolated and ChIP analysis for H3K4me3 at Notch1 promoter was performed (n=3 mice/group run in triplicate). For all ChIP experiments, isotype-matched IgG was run in parallel. Dotted line represents isotype control. In addition, Notch1 gene expression was analyzed by qPCR. **p<0.01 for ANOVA. F. Hes1 expression in aortic CD4⁺ T cells between Mll1^fl/flCD4^Cre+ and littermate controls (n = 5 mice/group, run in triplicate). G. Analytical flow cytometry of aortic suspensions in Mll1^fl/flCD4^Cre+ and littermate controls following 28 days of AngII (n = 3–4 mice). T_Reg identified as Lineage– (Lin–)/CD3⁺/CD4⁺/CD25⁺/FoxP3⁺, and Th17 cells identified as Lin–/CD3⁺/CD4⁺/RORγ⁺. For lineage-negative cells (defined as Lin–), we selected for cells that were negative for the following cell markers: CD19, GR-1, and CD8. *p<0.05, **p<0.01 for Welch’s t-test. H. IL-17A measured by ELISA in aortic tissues Mll1^fl/flCD4^Cre+ and littermate controls with saline and AngII-induced aortic aneurysm model (n = 4–5 mice). I. Naïve T cells were MACs isolated and polarized toward Th17 differentiation for 7 days in the presence or absence of MM-102 2ug/ml. Media was collected for analysis of IL-17 and IL-22 via ELISA. *p<0.05, **p<0.01, ***p<0.001 for ANOVA. Data are presented as the mean±SEM.

To compliment these genetic investigations of MLL1 as a therapeutic target for AAAs, we conducted in vitro pharmacological inhibition of MLL1 to determine the impact on Th17 polarization. Specfically, CD4⁺ T cells were isolated and in vitro polarized toward Th17 state in the presence or absence of a MM-102, an MLL1 inhibitor. We demonstrate that MM-102 treatment decreased TH17 polarization and corresponding IL-17 and IL-22 production in vitro (Figure 5I). These data identify that MLL1 is important in CD4⁺ Th cells for AAA development and that in vivo T cell Notch1 signaling and Th17/T_Reg phenotypic state is controlled, at least partly, by MLL1.

DISCUSSION

In this study, we identified that CD4⁺ Th cell function is important for aortic aneurysm development and that Notch signaling is crucial for physiologic CD4⁺ Th cell differentiation in AAA disease. We specifically showed that Notch 1 signaling is upregulated in CD4⁺ Th cells in both human AAAs and two well established murine AAA models, which correlates to increased Th cell differentiation toward Th17 and elevated levels of IL-17A. Inhibition of Notch signaling through various genetic methods reduced CD4⁺ Th17 cell differentiation and increased levels of anti-inflammatory T_Reg resulting in decreased AAA development. The epigenetic enzyme, MLL1, was found to be a key regulator of Notch 1 receptor expression and downstream signaling and, thus, CD4⁺ Th cell differentiation. Increased MLL1 in AAA CD4⁺ Th cells was found to drive Th17 differentiation through Notch signaling. Ultimately, CD4⁺ Th cell-specific genetic depletion of MLL1 prevented aberrant Notch 1 signaling activation, decreased pro-inflammatory Th17 infiltration, and decreased AAA formation, offering promise as a translational target for therapy (Figure 6).

Figure 6. MLL1 Regulates T Cell Phenotype via Notch Signaling During Abdominal Aortic Aneurysm Development.

MLL1 increases Notch1 expression via H3K4me3 resulting in elevating Notch1 signaling and Th17 polaization during AAA development.

Recently, there has been growing investigations implicating a pathological role of increased IL-17A and an imbalanced Th17/T_Reg ratio in a variety of cardiovascular disease states including ischemic heart disease, hypertension, stroke, atherosclerosis, and heart failure.^7,59 Regarding aortic aneurysmal disease, human AAA tissues display a marked reduction in peripheral CD4⁺CD25⁺ T_Reg cells.¹⁹ Additionally, murine models have demonstrated that T_Reg cell-deficient CD80^−/−/CD86^−/− or CD28^−/− mice showed enhanced susceptibility to angiotensin II-induced AAA, whereas adoptive transfer of T_Reg cells into CD28^−/− mice reduced aneurysm formation and rupture.¹² Separately for Th17 cells, independent murine models have demonstrated that CD4⁺ T cell-producing IL-17 promoted the formation of AAA while genetic and pharmacological neutralization of IL-17 or use of RORγt antagonists restricted the AAA disease development.^17,58 However, these preceding studies failed to investigate the aberrant pathways within T cells that drive pathological increase of Th17 infiltration and decreased of T_Reg differentiation within aortic tissue.

Herein, we demonstrate that human and murine CD4⁺ Th cells display upregulated Notch1 signaling that likely mediates T cell polarization toward a proinflammatory Th17 state and reduces T_Reg during AAA progression. Samples from AAA patients have shown elevation Notch (1–4) signaling within serum and aneurysm wall samples thereby suggesting that Notch signaling plays a significant role in the pathogenesis of the disease. Prior murine investigations have demonstrated that in vivo blocking of Notch (1–4) signaling with a using either a pharmacological agent (DAPT⁶⁰ or non-specific a γ-secretase inhibitor⁶¹) or global genetic depletion limits AAA development.⁶² These investigations although insightful, mainly focused on the role of Notch signaling in macrophage inflammatory cytokine production⁵⁸ or vascular smooth muscle cell dysfunction.⁶² To date, Notch signaling has not been specifically investigated in CD4⁺ Th cell inflammation in AAA disease. We and others have previously shown that Notch signaling can impact Th17^23,24 and drive Treg differentiation^23,27,28 in a variety of disease states. Specifically, investigations in immune regulation in cardiac transplantation have demonstrated that targeted inhibition of Notch1 in T cells increased local T_Reg presence within transplantation tissue and provided greater suppressive properties with reduction in inflammatory cytokines ultimately promoting graft survival.²⁸ Our findings support the notion that inhibition of Notch1 in T cells can increase the presence of T_Reg within the aortic wall resulting in decreased IL17A inflammation and decrease aortic aneurysm development. However, it should be noted that targeting of Notch signaling needs to be specific. Prior studies have demonstrated that global Notch receptor inhibition can have significant side effects particularly particular gastrointestinal toxcicity. In contrast targeted inhibition of specific Notch receptors with humanized antibodies has been shown to limit pathological Notch signaling without an adverse side effect profile in multiple disease states, thereby representing a more viable therapeutic approach. The ability to modulate Notch 1 signaling within T cells and thereby influence the local Th17/T_Reg in the aortic wall offers opportunity to decrease aortic wall dilation

Given the importance of Notch 1 signaling to regulating Th17/T_Reg inflammation within the aortic wall we sought to determine what was activating Notch signaling within CD4⁺ Th cells. In this study, we found that the epigenetic enzyme MLL1, a histone methyl transferase, regulates Notch 1 signaling in CD4⁺ Th cells during AAA via selective addition of the activating H3K4me3 mark on the Notch1 promoter. Increased MLL1-mediated Notch 1 signaling also alters the T_Reg/Th17 ratio. To date, there is limited literature demonstrating the role of epigenetic histone modifications in regulation of cellular function, particularly monocyte/macrophage phenotype, during AAA development.^63,64 Initial investigations found histone deacetylases were increased in AAA tissues from humans and AngII-infused mice. Further, inhibition of class I or class IIa histone deacetylases improved survival and decreased AAA formation in mice however the cell-specific mechanisms were not fully investigated and the genes these deacetylases regulated were unknown.^65,66 More recent studies have attempted to provide cell specific information by analyzing immune cell subsets within AAA disease. Specially, isolation of regulatory T lymphocytes (CD4⁺CD25⁺FOXP3⁺) from human AAA tissue had reduced acetylation on histone 3 and increased histone deacetylase enzymes compared to healthy controls but failed to correlate changes in histone acetylation to regulatory T lymphocyte function.⁶⁴ In contrast to histone acetylation, the role of histone methylation has not been investigated in AAA disease. Limited prior research in oncology had shown that pathologic changes in Notch signaling were regulated by the histone methyltransferase MLL1³⁸; however, this relationship had not been evaluated in Th cells. Since similar CMEs are known to drive Th lineage via direct regulation of the key transcription factors, we decided to test MLL1 as a potential regulator of Th cell differentiation in the setting of AAA development.³⁹ We also knew from our own prior work that MLL1 was increased in pathologic inflammation in diabetic tissue repair, making it a good candidate to examine in CD4⁺ Th cells.⁵⁷

Given the importance of MLL1, we investigated if genetic inhibition of MLL1 altered T_Reg/Th17 phenotype and reduced AAA development. CD4⁺ Th cell-specific depletion of MLL1 resulted in a reduction of AAA formation and decreased Th17 infiltration. This thereby suggests the epigenetic enzyme MLL1 as a promising therapeutic target for AAA disease. Indeed, epigenetic therapies have been shown to be effective in the treatment of cancer with drugs resulting in dose dependent inhibition of cell proliferation, invasion, and cell migration. More recently, epigenetic therapies have are beginning to be examined in cardiovascular disease.³⁴ Inflammation is a chronic hallmark of atherogenesis, which in turn manifests as genome-wide and gene-specific DNA hypermethylation and histone modification.^67,68 Histone deacetylase inhibition has also been shown to prevent atherosclerosis development in murine models.^69,70 Lastly, epigenetic therapies for atherosclerosis are currently undergoing phase III clinical trials including Apabetalone, a bromodomain and extra-terminal protein inhibitor, which has demonstrated mixed results (NCT02586155).⁷¹ Current clinically available MLL1 inhibitors were initially designed for the treatment of acute leukemias and the disruption of the menin-MLL1 interaction. These therapeutics demonstrated beneficial impact of hematologic disease progression as well as displayed a manageable side effect profile of transient transaminase, gastrointestinal toxicities (nausea, diarrhea), and in rare cases cytopenias.⁷¹ Given the side effect profiles associated with systemic MLL1 inhibition, a cell-specific targeting method will likely be needed inhibit MLL1 in CD4⁺ T cells preventing the phenotypic increase in Th17 cell populations during AAA development. Classically CD4⁺ T cells have been notoriously difficult to uniquely target compared to other cellular populations, however recent investigations have demonstrated that lipid nanoparticles conjugated to CD4 specific antibodies can offer a viable platform to target CD4⁺ T cells and specifically deliver therapeutic agents. Ramishetti et al. demonstrated that systemic intravenous administration siRNA containing CD4⁺ targeted lipid nanoparticles led to efficient binding and uptake into CD4⁺ T lymphocytes in several anatomical sites including the spleen, inguinal lymph nodes, blood, and the bone marrow without notable uptake in other immune cell populations.⁷² Taken together, these results suggest that lipid nanoparticles may open new avenues for the manipulation of T cell functionality but further research is needed in the in vivo setting to determine if these lipid nanoparticles can successfully utilized as a platform to alter MLL1 epxression and function in CD4⁺ T cells.⁷²

Although this study provides valuable insight into the mechanism(s) behind dysregulated Notch signaling and T_Reg/Th17 inflammation in AAA development, some limitations must be addressed. First, the human AAA samples are taken from end-stage disease and therefore may not represent the entire etiology of AAA formation. Additionally, control samples, aortic tissue was isolated from patients with atherosclerotic occlusive disease but no history of aneurysmal disease at the time of open aorto-bifemoral bypass. These non-aneurysmal atherosclerotic samples were intentionally chosen as a comparison group to reduced confounding patient factors (ie. age and cardiovascular comorbidities) as well as uncover potential pathways that are specific for AAA and not involved in atherosclerosis development. Secondly, for the murine AAA investigations there is no murine model that fully recaptilates all aspects of human AAA pathology. As such we utilized a variety of murine models including the AngII-induced AAA model, the elastase-induced AAA model, and the Calcium chloride-induced murine model which all demonstrate upregulation Notch 1 signaling, although to varying degrees, which is in agreement with human CD4+ T cell pathology. Further we utilized only the AngII-induced murine AAA model in male mice to demonstrate that CD4⁺ T cell-specific depletion of Notch1 or MLL1 limited in AAA diameter and growth. Future studies will utilize female AAA mice to confirm a sex independent response in aneurysmal disease. Lastly, we recognize that other epigenetic enzymes or vascular cell types may regulate aberrant CD4⁺ T cell function during AAA development as well.⁶³

In conclusion, our study provides important mechanistic evidence that the histone methyltransferase MLL1 regulates Notch1 signaling with CD4⁺ Th cells during AAA development and promotes pathological Th17 phenotypic state. This pathway may serve as a potential therapeutic target to prevent aortic dilation.

Supplementary Material

-Supplemental Tables 1–2

-Supplemental Figures

-Major Resource Table

What Are the Clinical Implications?

Abdominal aortic aneurysm (AAA) progression is driven in part by maladaptive CD4⁺ T-cell responses, yet the epigenetic mechanisms governing T-cell polarization in this disease remain poorly defined. Using single-cell RNA sequencing of human AAA tissue, we identify marked upregulation of the histone methyltransferase MLL1 and Notch1 signaling specifically within CD4⁺ T cells, representing novel human data linking epigenetic regulation to aneurysmal inflammation. Complementary murine AAA models demonstrate that CD4⁺ T cells adopt a predominant Th17 phenotype with increased MLL1 expression, and mechanistic studies reveal enhanced MLL1-mediated H3K4me3 enrichment at the Notch1 promoter, establishing a direct epigenetic mechanism for Notch1 activation. Critically, CD4⁺ T cell–specific deletion of either MLL1 or Notch signaling significantly attenuates AAA formation, suppresses pathogenic Th17 responses, and restores T_Reg balance, providing causal in vivo evidence that the MLL1–Notch1 axis drives aneurysmal progression. Collectively, these findings uncover a previously unrecognized epigenetic pathway regulating T-cell differentiation in AAA and position MLL1 as a potential therapeutic target to modulate inflammation and limit aortic dilation in patients with aneurysmal disease.

NONSTANDARD ABBREVIATIONS AND ACRONYMS

AAA

Abdominal aortic aneurysm

AAV

Adeno-associated virus

Ang II

Angiotensin II

MAML

Mastermind-like protein 1

Rorγ

RAR-related orphan receptor gamma

Th17

T helper 17 cell

T_Reg

Regulatory T cell