Skip to main content
Journal of Bacteriology logoLink to Journal of Bacteriology
. 2002 May;184(9):2379–2388. doi: 10.1128/JB.184.9.2379-2388.2002

Endotoxin of Neisseria meningitidis Composed Only of Intact Lipid A: Inactivation of the Meningococcal 3-Deoxy-d-Manno-Octulosonic Acid Transferase

Yih-Ling Tzeng 1,2, Anup Datta 3, V Kumar Kolli 3, Russell W Carlson 3, David S Stephens 1,2,4,*
PMCID: PMC134985  PMID: 11948150

Abstract

Lipopolysaccharide, lipooligosaccharide (LOS), or endotoxin is important in bacterial survival and the pathogenesis of gram-negative bacteria. A necessary step in endotoxin biosynthesis is 3-deoxy-d-manno-octulosonic acid (Kdo) glycosylation of lipid A, catalyzed by the Kdo transferase KdtA (WaaA). In enteric gram-negative bacteria, this step is essential for survival. A nonpolar kdtA::aphA-3 mutation was created in Neisseria meningitidis via allelic exchange, and the mutant was viable. Detailed structural analysis demonstrated that the endotoxin of the kdtA::aphA-3 mutant was composed of fully acylated lipid A with variable phosphorylation but without Kdo glycosylation. In contrast to what happens in other gram-negative bacteria, tetra-acylated lipid IVA did not accumulate. The LOS structure of the kdtA::aphA-3 mutant was restored to the wild-type structure by complementation with kdtA from N. meningitidis or Escherichia coli. The expression of a fully acylated, unglycosylated lipid A indicates that lipid A biosynthesis in N. meningitidis can proceed without the addition of Kdo and that KdtA is not essential for survival of the meningococcus.


Neisseria meningitidis is the leading worldwide cause of epidemic meningitis and fatal sepsis in otherwise healthy individuals. Over 500,000 meningococcal cases occur each year, a number that is frequently accentuated by large epidemic outbreaks (48). Among the important virulence factors involved in meningococcal pathogenesis, endotoxin or lipooligosaccharide (LOS) is believed to be a major component inducing the proinflammatory response of meningococcal sepsis and meningitis (25).

Meningococcal LOS is structurally related to lipopolysaccharide (LPS) of enteric gram-negative bacilli but does not have repeating O-antigens. LOS and LPS have conserved inner cores composed of heptose and 3-deoxy-d-manno-octulosonic acid (Kdo), which are anchored in the outer membrane by lipid A (33). Lipid A of many enteric pathogens is composed of a β-1′,6-linked disaccharide of glucosamine acylated with four β-hydroxymyristates (2, 3, 2′, 3′) and two acyloxyacyl linkages, laurate and myristate, at the 2′ and 3′ positions, respectively (33). Lipid A of N. meningitides, however, differs from Escherichia coli lipid A in both the acylation and the chain length of the fatty acid residues. Meningococcal lipid A is acylated with β-hydroxymyristate (2, 2′) and β-hydroxylaurate (3, 3′), and the acyloxyacyl linkages consist of two laurate residues coupled to the N-linked hydroxymyristates (27). In E. coli or Salmonella enterica serovar Typhimurium, lipid A alone is not compatible with survival, and a defect in either Kdo biosynthesis or Kdo transferase causes temperature sensitivity of growth and results in accumulation of the tetra-acylated precursor, lipid IVA (13, 14, 32, 37, 38, 45). Thus, the minimal LPS structure that results in viability is lipid A glycosylated with two Kdo residues (Re endotoxin) (1).

Extensive studies of the biosynthesis pathway of LPS in E. coli have established that addition of the two Kdo residues to the tetra-acylated lipid IVA structure is required before addition of two acyloxyacyl fatty acids (33). The Kdo transferase, encoded by the kdtA gene, catalyzes the addition of Kdo residues using CMP-Kdo (9). Endotoxins of different bacterial species contain various numbers of Kdo residues, and KdtA mediates the addition of one, two, or more Kdo residues. For example, KdtA of E. coli catalyzes the addition of two Kdo sugars, while KdtA of Haemophilus influenzae is responsible for the addition of a single Kdo sugar (19) and KdtA of Chlamydia trachomatis mediates the coupling of three Kdo sugars to lipid IVA (2). In E. coli kdtA is essential since the survival of a strain with a chromosomal kdtA::kan allele is dependent upon the presence of a functional copy of kdtA supplied in trans (1). The model of lipid A assembly, however, is not valid for all gram-negative bacteria. Here we report that a nonpolar kdtA mutant of N. meningitidis is viable and expresses a fully acylated lipid A without Kdo.

MATERIALS AND METHODS

Medium and bacterial strains.

Strains, plasmids, and primers used in this study are listed in Table 1. Meningococcal strains were grown under aerobic conditions with 3.5% CO2 at 37°C on GC agar (Difco) supplemented with 0.4% glucose and 0.68 mM Fe(NO3)3. Brain heart infusion (BHI) medium supplemented with 1.25% fetal calf serum (GIBCO BRL) was used when kanamycin selection was required. E. coli strain DH5α, used for all cloning and plasmid propagation procedures, was maintained on Luria-Bertani agar plates or in Luria-Bertani broth at 37°C. The antibiotic concentrations used for E. coli were as follows: kanamycin, 50 μg/ml; ampicillin, 100 μg/ml; and erythromycin, 300 μg/ml. The antibiotics for selecting N. meningitidis were used at the following concentrations: kanamycin, 80 μg/ml; and erythromycin, 3 μg/ml.

TABLE 1.

Strains, plasmids, and primers used in this study

Strain, plasmid, or primer Description or sequence Reference or source
N. meningitidis strains
    NMB B:2b:P1.2,5:L2 (CDC8201085) 44
    NMB249 NMB with nonpolar insertion/deletion in kdtA This study
    NMB271 NMB carrying pYT271 This study
    NMB274 NMB carrying pYT274 This study
    NMB249/271 NMB249 carrying pYT271 This study
    NMB249/274 NMB249 carrying pYT274 This study
Plasmids
    pCR2.1 TA cloning Strategene
    pUC18 Cloning vector, Ampr 51
    pUC18K Source of aphA-3 (Kmr) cassette 28
    pYT243 1.47 kb of YT81-YT82 PCR product containing kdtA coding sequence cloned into pCR2.1 This study
    pYT249 754-bp BssHII internal fragment of kdtA in pYT243 replaced by in-frame fusion of aphA-3 (SmaI) cassette This study
    pYT250 Meningococcal shuttle vector (Emr) This study
    pYT268 HindIII-BglII-digested YT91-YT92 PCR product amplified from N. meningitidis cloned into HindIII-BglII site of pCTC-Flag This study
    pYT269 HindIII-BglII-digested YT91-YT92 PCR product amplified from E. coli cloned into HindIII-BglII site of pCTC-Flag This study
    pYT271 BglI fragment of pYT268 cloned into EcoRV site of pYT250 This study
    pYT274 YT80-YT83-amplified product from pYT269 cloned into EcoRV site of pYT250 This study
Primers
    KANC 5′-GTGGTATGACATTGCCTTCTGCG3′ 23
    YT79 5′CATCATAACGGTTCTGGCAAATATTC3′ This study
    YT80 5′CTGTATCAGGCTGAAAATCTTCTCTC3′ This study
    YT81 5′CACGATGCCGCTGGCGAAC3′ This study
    YT82 5′GGATACGGCGTTATTTGGACAAAC3′ This study
    YT83 5′GCCGTCTGAAGTGCTGCAAGGCGATTAAGTTGGG3′a This study
    YT91 5′GGAAATAGAAAGAAGCTTCAATGGCTTTATG3′b This study
    YT92 5′GATTGTAAGATCTTCGCCCCCGATATC3′c This study
    YT93 5′CAGCTATTTACTAAGCTTGAATTGCTTTACACC3′b This study
    YT94 5′CATAACAAGATCTATGCGTTTTCGGTG3′c This study
a

The meningococcal uptake sequence is underlined.

b

The HindIII site is underlined.

c

The BglII site is underlined.

Construction of the nonpolar kdtA mutant.

A 1,476-bp PCR product was amplified from chromosomal DNA of meningococcal strain NMB using 5′ primer YT82 and 3′ primer YT81. This PCR product was cloned into pCR2.1 using a TA cloning kit (Invitrogen). The insert was released by EcoRI digestion and then subcloned into an EcoRI site of pUC18 to obtain pYT243. A fragment (754 bp) within the kdtA sequence of pYT243 was removed by BssHII digestion, and the remaining vector was gel purified and blunted with the Klenow fragment. This BssHII Klenow fragment-treated pYT243 fragment was subsequently ligated with the aphA-3 (Kmr) cassette released from pUC18K (28) by SmaI digestion. The orientation of the aphA-3 cassette was determined by colony PCR analysis with primers KanC (3′ end of the aphA-3 cassette) and YT81, and a transformant with the correct insertion was saved (pYT249). In-frame fusion of the aphA-3 cassette with kdtA was confirmed by automatic fluorescent sequencing at the Emory DNA Core Facility. Meningococcal strain NMB or the capsule-deficient strain M7 (44) was transformed with ScaI-linearized pYT249, and allelic exchange yielded kanamycin-resistant colonies, which were confirmed by colony PCR analyses to contain the kdtA::aphA-3 mutation.

Construction of meningococcal shuttle vector pYT250.

The DNA fragment of a gonococcal cryptic plasmid was released from pEG2 (7) by HindIII digestion, purified by agarose gel electrophoresis, and cloned into the unique HindIII site of a derivative of pCR2.1 (Invitrogen) in which the ampicillin resistance gene had been deleted by BsaI and ScaI digestion. The resulting plasmid, pYT237, was then cut with XbaI and NcoI to remove the kanamycin resistance gene. The vector fragment was purified, treated with the Klenow fragment, and then ligated with an EcoRI fragment (blunted with the Klenow fragment) of the erythromycin resistance gene, ermC, obtained from pAermC′G (52) to obtain pYT250.

Complementation.

Primers YT91 and YT92 were used to amplify the coding sequence of kdtA from chromosomal DNA of meningococcal strain NMB, while primers YT93 and YT94 were used to obtain kdtA from E. coli K-12 strain DH5α. The amplicons were digested with HindIII and BglII and then ligated with pFlag-CTC (Sigma), which had been cut with the same enzymes. In the resulting plasmids, pYT268 and pYT269, kdtA of N. meningitidis and E. coli, respectively, were under the control of a tac promoter and fused with an octapeptide Flag tag. A ∼4.6-kb fragment containing lacI, the tac promoter, and the kdtA coding sequence was released from pYT268 by BglI digestion, blunted with the Klenow fragment, and subcloned into the EcoRV site of a shuttle vector, pYT250, to generate pYT271. Because of the presence of a BglI site within the E. coli kdtA coding sequence, the same fragment was amplified from pYT269 by PCR using Vent polymerase (New England Biolabs) and primers YT80 and YT83. The PCR product was phosphorylated with T4 kinase and cloned into the EcoRV site of pYT250 to obtain pYT274.

Plasmids used for complementation were first methylated with HaeIII methylase (New England Biolabs) according to the manufacturer's protocol, and the reaction mixture was used directly for transformation. Transformation of meningococcal strain NMB was done by following the procedure of Janik et al. (22). Erythromycin-resistant transformants were selected, and colony PCR performed with vector-specific primers YT79 and YT80 confirmed the presence of the plasmid-encoded kdtA gene. The strains carrying pYT271 and pYT274, designated NMB271 and NMB274, respectively, were subsequently transformed with linearized pYT249, and transformants with both erythromycin and kanamycin resistance were selected.

Chromosomal DNA isolation and Southern blotting.

Meningococcal chromosomal DNA was prepared by the method of Nath (30). A Genius 2 DNA labeling and detection system (Boehringer Mannheim) was used to perform DNA hybridization. The digoxigenin-labeled probe used for detecting kdtA was generated by a random primed labeling reaction in which the YT81-YT82 PCR product was as the template and the probe for the aphA-3 cassette was made from the purified cassette fragment released from pUC18K by SmaI restriction. Chromosomal DNA was digested with PvuII overnight and resolved on a 0.7% agarose gel. DNA was transferred to a nylon membrane by using a Turboblotter apparatus (Schleicher & Schuell). Hybridization and development of the Southern blots were performed by using the manufacturer's protocol.

Western blotting.

Meningococcal strains grown overnight on appropriate selection plates were suspended in phosphate-buffered saline, and the optical density at 550 nm was determined. An aliquot of a cell suspension with an optical density at 550 nm of 0.25 (∼1.25 × 108 cells) was mixed with equal volume of 2× sodium dodecyl sulfate (SDS) loading buffer and boiled for 5 min before it was loaded onto a 1.5-mm-thick SDS-12% polyacrylamide gel electrophoresis (PAGE) minigel. After electrophoresis, the proteins were transferred to a polyvinylidene difluoride membrane with a tank transfer system (Bio-Rad) at a constant voltage (30 V) overnight in a cold room. The membrane was blocked with 10% bovine serum albumin in TTBS buffer (100 mM Tris [pH 7.5], 0.9% NaCl, 0.1% Tween 20) and probed with anti-Flag monoclonal antibody (10 μg/ml; Sigma). Alkaline phosphatase-conjugated anti-mouse immunoglobulins (ICN) were used as the secondary antibody, and the blot was developed with BCIP (5-bromo-4-chloro-3-indolylphosphate) and nitroblue tetrazolium as the substrates.

Miniscale LOS extraction and Tricine-SDS-PAGE analysis.

A minigel consisting of a 16% polyacrylamide separating gel, a 10% polyacrylamide spacer gel, and a 4% polyacrylamide stacking gel using the Tricine-SDS-PAGE system (40) was employed to resolve crude LOS samples prepared by protease K digestion of whole-cell lysates. Briefly, a few single colonies were suspended in distilled water, and the approximate protein concentrations were determined by Bradford assays (Bio-Rad) using bovine serum albumin as the standard. The protein concentration of the cell suspension was then adjusted to 1 μg/μl. A digestion mixture consisting of 8 μl of cell suspension, 28 μl of 2% SDS in TE buffer (10 mM Tris [pH 8.0], 1 mM EDTA), and 8 μl of proteinase K (25 mg/ml in 20% glycerol-500 mM Tris [pH 8.0]-10 mM CaCl2) was incubated at 60°C overnight and quenched by adding 38 μl of a loading dye solution (1 M Tris, 10% glycerol, 2% SDS, 5% β-mercaptoethanol, 0.05% bromophenol blue). The samples were heated at 95°C for 5 min before loading. After electrophoresis, the gels were fixed in a solution containing 40% ethanol and 5% acetic acid overnight and subsequently silver stained (20).

Preparation of LOS.

Strain NMB249 was grown on BHI medium plates with kanamycin selection overnight and used to inoculate 600 ml of BHI broth. The culture was grown for 6 to 7 h at 37°C with shaking; then 100 ml of the culture was added to 1 liter of fresh BHI broth, and the culture was allowed to grow overnight. Six liters of cells was harvested by centrifugation, and the cell pellet was dried in a SpeedVac (Savant). The dried cells were processed by the procedure described by Kahler et al. (23). The extraction solvent consisted of 90% phenol, chloroform, and petroleum ether (2:5:8).

In order to structurally characterize the LOS, further purification was necessary since the LOS extracted with 90% phenol-chloroform-petroleum ether (2:5:8) copurified with significant levels of phospholipids. The phospholipids were removed by suspending the LOS in ethanol-water (9:1, vol/vol), stirring the preparation constantly for 30 min at room temperature, and centrifuging it at 10,000 × g in a JA-20 rotor (Beckman) at 4°C for 15 min. The supernatant was removed, and the pellet was extracted repeatedly until no more phospholipid was found in the supernatant. The level of phospholipid was determined by determining the amounts of C16:0, C16:1, and C18:1 fatty acids present since these fatty acids are characteristic of the phospholipids (11). The resulting pellet was suspended in water and freeze-dried.

Compositional analysis of lipid A from mutant NMB249.

Compositional analysis was performed by preparation and combined gas chromatography-mass spectrometry (GC-MS) analysis of trimethylsilyl methyl glycosides with N-acetylation and of fatty acid methyl esters (10). For determination of Kdo, lipid A was methanolyzed with methanolic 1 M HCl at 80°C for 4 h (11). Ester-linked fatty acids were selectively liberated from a vacuum-dried sample by alkaline transesterification with sodium methoxide (0.25 M, 37°C, 15 h) (4). Combined GC-MS analysis was performed using a 50-m methyl silicone column from Quadrex Corporation.

Methylation analysis.

Methylation was carried out by using the method of Ciucanu and Kerek (8). The permethylated product was purified by using a Sep-Pak C18 cartridge (49) and then hydrolyzed with 2 M trifluoroacetic acid (120°C, 2 h), reduced with NaBH4 or NaB2H4, acetylated, and analyzed by combined GC-MS.

Dephosphorylation of lipid A.

Lipid A was placed in a 15-ml polypropylene tube. The sample was treated with cold aqueous 48% hydrogen fluoride (HF) and kept for 48 h at 4°C (26). The HF was removed by flushing under a stream of air, followed by addition of diethyl ether (600 ml) and drying with a stream of air. The diethyl ether and drying steps were repeated three times. The resulting residue was suspended in deionized water, dialyzed at 4°C for 48 h, and finally freeze-dried.

MS.

Oligosaccharides were analyzed by matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) MS by using a Hewlett-Packard LD-TOF system. The oligosaccharides were dissolved in distilled water at a final concentration of 2 μg/μl, and 1 μl was mixed with the matrix (dihydroxybenzoic acid in methanol) for analysis.

Tandem MS-MS analysis was performed by using a Q-TOF hybrid mass spectrometer (Q-TOFII; Micromass, Manchester, United Kingdom) equipped with an electrospray source (Z-spray) operated in either the positive mode or the negative mode. The samples were dissolved in methanol-chloroform (1:1) and infused into the mass spectrometer with a syringe pump (Harvard Apparatus, Cambridge, Mass.) at a flow rate of 5 μl/min. A potential of approximately 3 kV was applied to the capillary, and nitrogen was employed as both the drying gas and the nebulization gas. NaI and Glu-fibrinopeptide B were used as calibration standards in the negative and positive modes, respectively. In the MS analysis the Q1 was operated in RF-only mode with all ions transmitted into the pusher region of the time of flight analyzer, and the MS spectrum was recorded from m/z 400 to 2,000 with a 1-s integration time. For MS-MS spectra, the transmission window of the quadrupole (Q1) was set to about 3 mass units, and the selected precursor ions were allowed to fragment in the hexapole collision cell. The collision energies (40 to 55 eV) were optimized for maximized product ion yield, and argon was used as the collision gas. The MS-MS data were integrated over a period of 4 to 5 min for each precursor ion.

Electron microscopy.

Plate-grown bacteria were fixed in a solution containing 1.25% glutaraldehyde, 3.84% paraformaldehyde, and 2% dimethyl sulfoxide. Two microliters of a sample was applied to the grid surface and allowed to settle onto the surface for 5 min. Negative staining was performed with 1% ammonium phosphotungstic acid for 15 s, and the samples were analyzed with a Philips CM-10 transmission electron microscope. Fixed bacterial samples were treated with 0.01% tannic acid and then washed with cacodylate buffer before a 60-min poststaining treatment with 1% osmium tetraoxide. After samples were dehydrated with a graded ethanol wash series, they were embedded in Epon for thin-section electron microscopy.

RESULTS

Construction of the chromosomal kdtA::aphA-3 mutation in N. meningiditis.

The kdtA gene (NMB0014) was identified from the serogroup B meningococcal MC58 genome (47). The gene is located downstream of gnd and lpxC and is followed by the genes for two hypothetical proteins and murA, all transcribed in the same orientation (Fig. 1). This organization differs from that of the E. coli genome, in which kdtA is transcribed divergently from the rfa operon (33). The MC58 sequence was used to design primers and clone kdtA from the meningococcal serogroup B strain NMB. An internal fragment of kdtA was removed by BssHII digestion and replaced with a nonpolar kanamycin resistance aphA-3 cassette to generate plasmid pYT249. Inactivation of the chromosomal copy of kdtA in meningococcal strain NMB was accomplished via transformation with linearized pYT249. The allelic exchange yielded viable kanamycin-resistant transformants. Correct incorporation of the aphA-3 cassette into kdtA in one of these transformants, strain NMB249, was confirmed by PCR, Southern blotting, and sequencing analysis. Analogously, a kdtA mutation was created in a capsule-deficient derivative of strain NMB, M7.

FIG. 1.

FIG. 1.

Genetic organization of kdtA locus in the meningococcal MC58 and Z2491 genomes. lpxC, UDP-3-O-3-hydroxymyristoyl N-acetylglucosamine deacetylase gene (lipid A biosynthesis); gnd, 6-phosphogluconate dehydrogenase gene (pentose phosphate pathway); murA, UDP-N-acetylglucosamine 1-carboxyvinyltransferase gene (peptidoglycan biosynthesis); HP, hypothetical protein. The locations of primers used in this study (Table 1) are also indicated.

Reduced growth rate and electron microscopy analysis of the kdtA mutant.

The meningococcal kdtA mutant (NMB249) formed small wrinkled colonies on either BHI or GC agar plates. The growth of mutant NMB249 was assessed in BHI broth and was slower than that of the wild-type strain (the growth rate was ∼25% that of the parent strain) (Fig. 2). The morphology of this mutant was also examined by transmission electron microscopy. Thin sections of the kdtA mutant revealed bacteria with thickened, incomplete septum separation, often in tetrads (Fig. 3).

FIG. 2.

FIG. 2.

Growth curves of N. meningitidis serogroup B wild-type strain NMB and kdtA::aphA-3 mutant NMB249. Growth in BHI broth at 37°C was monitored by measuring the optical density at 550 nm [OD (550 nm)].

FIG. 3.

FIG. 3.

Electron photomicrographs of thin sections of wild-type strain NMB (A) and kdtA::aphA-3 mutant NMB249 (B). Bacteria were grown overnight on GC agar plates at 37°C and resuspended and fixed as described in Materials and Methods. Scale bars, 100 nm.

Analysis of LOS composition.

To examine LOS in the kdtA mutant, proteinase K-treated whole-cell lysates were prepared and resolved by Tricine-SDS-PAGE. Silver staining revealed wild-type LOS in the parent strain but no stainable LOS in the mutant (see Fig. 7B, lane 2). Since the meningococcal Re endotoxin structure (Kdo2-lipid A) and larger structures can be visualized by silver staining (24, 41), the results obtained with the kdtA mutant indicated that Kdo was likely absent in the LOS of strain NMB249. This finding was consistent with inactivation of the Kdo transferase. To determine the precise endotoxin structure in the kdtA mutant, the kdtA mutant was subjected to phenol-chloroform-petroleum ether extraction for endotoxin isolation (23), and the LOS recovered was subjected to a detailed structural analysis.

FIG. 7.

FIG. 7.

(A) Southern blotting performed with the aphA-3 cassette (right panel) and wild-type kdtA (left panel) as the probes. PvuII-digested chromosomal DNA were resolved on a 0.7% agarose gel. Lanes 1, wild-type strain NMB; lanes 2, strain NMB249; lanes 3, strain NMB249/271; lanes 4, strain NMB249/274. Removal of the 754-bp BssHII fragment and insertion of the 800-bp aphA-3 cassette gave rise to the fragment of the same size recognized by both probes. An additional band in lane 3 of the left panel represents the second copy of meningococcal kdtA on the shuttle vector. (B) Tricine-SDS-PAGE analysis of LOS. Lane 1, strain NMB; lane 2, strain NMB249; lanes 3 and 4, two independent NMB249/271 transformants; lanes 5 and 6, two independent NMB249/274 transformants. (C) Western blot of the strains in panel B, probed with anti-Flag monoclonal antibody.

Fatty acid analysis of the LOS revealed the presence of approximately equal molar amounts of dodecanoic acid (C12:0; 1,050 nmol/mg), 3-hydroxydodecanoic acid (3-OH C12:0; 1,000 nmol/mg), and 3-hydroxytetradecanoic acid (3-OH C14:0; 975 nmol/mg). A small amount of palmitic acid (C16:0) was also observed, which was not part of the LOS and perhaps was due to the presence of a low level (∼7%) of contaminating phospholipid. The same fatty acyl residues were present at the same ratio in HF-treated LOS, except that in this case a significant level of N-acetylglucosamine (GlcNAc) was also detected (945 nm/mg). Assuming a normal lipid A structure which would have 2 mol of GlcN per mol of lipid A, we concluded that there were a total of 6 mol of fatty acid per mole of lipid A (i.e., approximately 2 mol each of C12:0, 3-OH C12:0, and 3-OH C14:0). After treatment of lipid A with sodium methoxide, C12:0 and 3-OH C12:0 were quantitatively liberated as methyl esters, showing that they had been exclusively ester linked. The mild-alkaline-treated lipid A was subjected to strong alkaline hydrolysis, which released only 3-OH C14:0 and proved that this was the amide-bound fatty acyl residue. Thus, the composition analysis suggested that NMB249 produces an LOS with the lipid A expected for N. meningitidis. However, what proved to be very unusual was that the LOS contained no detectable glycosyl components other than the GlcN that was derived from the lipid A. In fact, not even a detectable level of Kdo was present in the LOS preparation.

MALDI-TOF mass analysis of LOS.

The results described above suggested that the LOS from NMB249 consisted only of lipid A since no glycosyl residues could be detected and since the LOS had the fatty acylation pattern typical of N. meningitidis lipid A. Further structural analysis by MS confirmed this conclusion. Lipid A from two different NMB249 preparations was analyzed by MALDI-TOF MS. The results are shown in Fig. 4. The [M-H]− ions varied somewhat between the two preparations, probably due to slight variations in the growth conditions. These ions were m/z 1836, 1756, 1713, 1633, 1574, 1558, 1451, and 1435. If both LOS preparations were considered, the major species were m/z 1756 and 1713, followed by m/z 1633; the different molecular ions were due to variations in phosphate, phosphoethanolamine (PEA), and fatty acyl substitution patterns. Table 2 shows the proposed composition of each ion together with the calculated ion masses. All of the molecular species observed were consistent with the conclusion that the LOS consisted only of lipid A and did not contain any detectable Kdo or core glycosyl residues. The data also support the conclusion that the major LOS molecular species contained the normal lipid A fatty acid components. Much of the heterogeneity was removed by treatment of the LOS with aqueous HF (26), which removed all phosphate substituents. MALDI-TOF MS analysis in the positive mode of the HF-treated LOS revealed a major [M+Na]+ ion at m/z 1576 (the calculated value was m/z 1577) and a minor ion at m/z 1394. The m/z 1576 ion is consistent with a molecule having the composition GlcN2-C12:02-βOH C12:02-βOH C14:02, and the ion at m/z 1394 is consistent with a molecule having the composition GlcN2-C12:01-βOH C12:02-βOH C14:02. The m/z 1576 ion would have been derived from the major LOS species at m/z 1836, 1756, 1713, and 1633. The m/z 1394 ion would have been derived from the LOS species present at the next highest concentration, m/z 1574, and m/z 1451. An ion derived from the minor LOS species at m/z 1558 and 1435 (i.e., m/z 1378) was not detected, perhaps because a sufficient amount was not present.

FIG. 4.

FIG. 4.

MALDI-TOF spectra of two LOS preparations from NMB249 (A and B) and of HF-treated LOS from NMB249 (C). The spectra in panels A and B were collected in the negative mode, and the spectrum in panel C was collected in the positive mode.

TABLE 2.

Proposed compositions of LOS preparation from NMB249 based on MALDI-TOF MS analysis

Observed ion (m/z) Calculated ion (m/z) Proposed compositiona
1836 1836.3 P2-PEA1-GlcN2-C12:02-βOH C12:02-βOH C14:02
1756 1756.3 P1-PEA1-GlcN2-C12:O2-βOH C12:O2-βOH C14:02
1713 1713.2 P2-GlcN2-C12:02-βOH C12:02-βOH C14:02
1633 1633.3 P1-GlcN2-C12:02-βOH C12:02-βOH C14:02
1558 1558.0 P1-PEA1-GlcN2-C12:01-βOH C12:02-βOH C14:02
1451 1451.0 P1-GlcN2-C12:01-βOH C12:02-βOH C14:02
1435 1435.0 P1-GlcN2-C12:02-βOH C12:01-βOH C14:02
a

C12:0, lauric acid; βOH C12:0, β-hydroxylauric acid; βOH C14:0, β-hydroxymyristic acid.

Analysis of phosphate substitutions in lipid A.

The MALDI-TOF results described above showed that several molecular species lacked one phosphate and varied in the presence or absence of one PEA substituent. In species that lacked one phosphate group, it was necessary to determine if the second phosphate group was the glycosidically linked phosphate or the 4′ phosphate. Therefore, the LOS was methylated, and partially methylated alditol acetates (PMAAs) were prepared and analyzed by GC-MS. In this procedure the GlcN residues that are phosphorylated at the 4′ position retain the phosphate in their PMAA derivative and are not observed during GC-MS analysis, while the reducing-end GlcN or GlcN-1-phosphate residues of the lipid A are observed as the PMAA of 6-linked GlcN (35). The results showed that only 6-linked GlcN was present, which was derived from the lipid A reducing-end GlcN residue. Since there was no detectable terminally linked GlcN, these results support the conclusion that the 4′ position in all of the LOS molecules is phosphorylated and, therefore, the species that lack phosphate are missing the glycosidically linked phosphate residue. Several of the LOS species contain a single PEA substituent. The location of this residue would be either as a PEA-P-4′-GlcN- substituent or as a -GlcN-1-P-PEA substituent. Mild acid hydrolysis of the LOS with 1% acetic acid at 100°C for 1 h would convert -GlcN-1-P-PEA to -GlcN but would leave PEA-P-4′-GlcN intact. MALDI-TOF MS analysis of the LOS after mild acid hydrolysis showed that there were two ion species, m/z 1756 and 1633, due to molecules with a single P-PEA substituent and a single -P substituent, respectively. Thus, it is likely the PEA group, when it is present in the LOS, exists as a P-PEA group at the 4′ position.

The structure of the LOS after removal of the phosphate substituents was further analyzed by tandem MS-MS analysis (Fig. 5A). The [M+Na]+ ion, m/z 1577, gave primary fragments due to the loss of either β-hydroxylaurate (−215, m/z 1361), β-hydroxylauryl (−199, m/z 1379), laurate (−199, m/z 1379), or lauryl (−183, m/z 1394) fatty acyl components, due to cleavage between the glycoside bonds (m/z 807 and 791), and due to cleavage of the glycoside ring of the GlcN residue at the C-3-C-4 and C-1-O-5 bonds (m/z 880) and at the C-4-C-5 and C-1-O-5 bonds (m/z 851). This fragmentation pattern is shown in Fig. 5B. The remaining fragments are due to the loss of β-hydroxylaurate, β-hydroxylauryl, or laurate from several of the primary fragments. A scheme showing how these ions might arise is given in Fig. 5C. This fragmentation pattern is completely consistent with the typical symmetrically acylated lipid A reported for N. meningitidis.

FIG. 5.

FIG. 5.

Tandem MS-MS spectrum of the m/z 1577 ion of HF-treated LOS from NMB249 (A), structure and primary fragmentation of this molecule (B), and rationale accounting for the observed secondary fragments (C).

From the results described above, it is clear that the LOS of the kdtA mutant consists primarily of lipid A that is not glycosylated but has variable phosphorylation. There are also minor molecular species present that lack either a lauryl or β-hydroxylauryl substituent. The structures of the major lipid A structures of this mutant are shown in Fig. 6.

FIG. 6.

FIG. 6.

Summary of the structures of the various lipid A molecules isolated from NMB249.

Complementation of mutant NMB249 with kdtA from N. meningitidis and E. coli.

To confirm that the phenotype of the NMB249 mutant was caused by inactivation of KdtA and to test whether KdtA of E. coli can substitute for the meningococcal KdtA, we performed complementation experiments using a meningococcal shuttle vector, pYT250. Based on the meningococcal MC58 genome and the E. coli K-12 genome, kdtA was amplified from N. meningitidis NMB and E. coli DH5α and cloned into pYT250 to generate pYT271 and pYT274, respectively, as described in Materials and Methods. The second copy of kdtA was constructed so that it was controlled by a tac promoter to avoid possible promoter effects. A Flag octapeptide tag (DYKDDDDK) was also incorporated into the C termini of the KdtA proteins encoded on the shuttle vectors so that KdtA expression in meningococci could be monitored.

Plasmids pYT271 and pYT274 were first introduced into parent meningococcal strain NMB, generating Emr transformants. To introduce the kdtA mutation, these strains were subsequently transformed with linearized pYT249, and Emr/Kmr transformants were obtained. Transformants were selected in which colony PCR analyses with chromosome-specific primers confirmed insertion of the aphA-3 cassette into the chromosomal copy of kdtA and PCR analyses with shuttle vector-specific primers confirmed that the second copy of kdtA was intact. In addition, Southern blotting was performed with probes specific for meningococcal kdtA or the aphA-3 cassette, and the results showed that insertion of the aphA-3 cassette was correct (Fig. 7A).

To confirm complementation, proteinase K-treated whole-cell lysates were prepared from parent strain NMB, mutant strain NMB249, and two independent transformants of the complemented strains, NMB249/271 and NMB249/274. Tricine-SDS-PAGE analysis of the LOS samples (Fig. 7B) demonstrated that a wild-type LOS phenotype was restored by introduction of either the meningococcal or E. coli kdtA. Expression of Flag-tagged KdtA proteins from the shuttle vector in strains NMB249/271 and NMB249/274 was demonstrated by immunoblotting (Fig. 7C).

DISCUSSION

LPS biosynthesis in E. coli and other enteric bacteria has been extensively studied and has been used as a paradigm to infer steps in endotoxin assembly and the requirement for Kdo2-lipid A for viability of other gram-negative bacteria. However, endotoxin assembly and the minimal structure in N. meningiditis are distinct from endotoxin assembly and the minimal structure in E. coli. Previously, Steeghs et al. have shown that meningococci can be viable without any endotoxin (43). Furthermore, we showed in this study that meningococci that express only lipid A can survive. In contrast to E. coli, the Kdo transferase KdtA was not essential in N. meningitidis. In addition, the kdtA meningococcal mutation resulted in synthesis of fully acylated lipid A without Kdo glycosylation, indicating that meningococcal lipid A biosynthesis differs from lipid A biosynthesis in enteric gram-negative bacteria.

In E. coli and Salmonella, the Kdo transferase KdtA functions upstream of the late acyltransferases responsible for the linkage of acyloxyacyl chains. As the late acyltransferases, HtrB (LpxL or WaaM) and MsbB (LpxM or WaaN) exhibit much higher reactivity for Kdo2-lipid IVA (6); consequently, lipid IVA is the major component that accumulates in all mutants with defects in Kdo (either biosynthesis or transfer). Expression of completely acylated lipid A in the meningococcal kdtA mutant suggests that the late acyltransferases in N. meningitidis can act on lipid IVA substrates without a Kdo linkage. The meningococcal late acyltransferases, which are HtrB and MsbB homologues, may have similar reactivities for both lipid IVA and Kdo2-lipid IVA. Alternatively, the late acyltransferases may prefer lipid IVA as a substrate and function prior to KdtA in meningococci. These two possibilities can be distinguished only by in vitro assays.

The only other example of incorporation of acyloxyacyl chains into lipid A prior to addition of Kdo is found in Pseudomonas aeruginosa (15, 29). Inhibiting the function of the CMP-Kdo synthetase with a synthetic compound in P. aeruginosa results in inhibition of bacterial growth and accumulation of fully acylated lipid A (15). Lipid A from P. aeruginosa contains β-hydroxydecanoate (β-OH C10:0) at the 3 and 3′ positions and β-hydroxylaurate (β-OH C12:0) at the 2 and 2′ positions, and the acyloxyacyl chains are either laurate (C12:0) or β-hydroxylaurate at the 2 and 2′ positions. This symmetric acylation pattern is similar to that of meningococci. The incorporation of acyloxyacyl fatty acids may take place before Kdo glycosylation in gram-negative bacteria that synthesize lipid A with symmetric short-chain fatty acids. Alternatively, the late acyltransferases in both organisms may display broader substrate specificity.

We demonstrated in this study that the KdtA homologue of E. coli can functionally complement the meningococcal kdtA mutation. Meningococcal KdtA exhibits 39% identity and 54% similarity with the E. coli enzyme, and the E. coli KdtA enzyme has been shown to transfer Kdo residues to analogs of E. coli lipid A with various numbers of acyl chains (four to six acyl chains) (3). Since the meningococcal lipid A is symmetrically acylated on both glucosamines, in contrast to the lipid A of E. coli, the location and length of the fatty acids of lipid A appear not to be determinants of the substrate specificity for KdtA. Recently, KdtA from Legionella pneumophila has been shown to transfer Kdo residues to lipid IVA of E. coli despite significant differences in the lipid A structures (5).

The tetrapac cell morphology of N. meningitidis expressing only lipid A is interesting, since a meningococcal lpxA mutant which does not produce lipid A is said to have a wild-type morphology as determined by electron microscopy (43). A tetrapac phenotype described for the tpc mutation in Neisseria gonorrhoeae is believed to have a defect in murein hydrolase activity (12). Outer membrane structure changes triggered by the marked truncation of LOS may cause a compensatory reduction in murein hydrolase activity or other cell division enzymatic activities required for septum separation. Other changes in outer membrane structure may also occur, such as a compensatory increase in membrane short-chain fatty acids (34, 42). Capsular polysaccharide has been shown to be essential for the survival of the meningococcal lpxA mutant (42). However, we were able to generate the kdtA mutation in a capsule-deficient meningococcal background, indicating that capsular polysaccharide was not required for viability of the meningococcal kdtA mutation. The phospholipid anchor of capsular polysaccharide polymers (17) may help stabilize the outer membrane of the meningococcal mutant without endotoxin (42), but capsule is not critical when lipid A is present.

The LOS isolated from the kdtA mutant consists primarily of four unglycosylated lipid A species that reflect variability of phosphoryl substitutions in the molecule. Although we cannot completely exclude the possibility that there are other minor species that might be detected by different extraction procedures (32), the endotoxin present in this mutant was variably phosphorylated, unglycosylated lipid A. The lipid A produced in the kdtA mutant differed in the phosphoryl substitution pattern at the 1 and 4′ positions. Either a phosphate or a PEA group occupies each of the 4′ positions of all four structures, while the 1 (glycosidic) position is phosphorylated in two of the four structures (Fig. 6). Negatively charged groups at the 1 and 4′ positions of the lipid A disaccharide are considered to be important for interactions with divalent cations, such as Mg2+ and Ca2+, forming ionic bridges that link the LPS (LOS) molecules together (18). In some bacteria the 4′ phosphate is missing or replaced by neutral sugars (4, 21, 36, 50). Thus, the negative charge at the 4′ position has been proposed to be dispensable, while the negative charge at the glycosidic position is necessary (18). In previous studies it has been shown that wild-type meningococcal strain NMB and five LOS mutants derived from NMB with various outer core oligosaccharide compositions are all phosphorylated with either a phosphate or a PEA group at the glycosidic position (24), while LOS from the wild-type strain, an lgtF mutant, and a galE mutant are not phosphorylated at the 4′ position (35). It is intriguing that lipid A from the meningococcal kdtA mutant can be unphosphorylated at the glycosidic position, suggesting that some structural requirement (e.g., glycosidic phosphorylation) may be optional in the absence of Kdo linkages.

Several lipid A analogs, either chemically synthesized or isolated from bacteria such as Rhodobacter sphaeroides and Rhodobacter capsulatus, exhibit potent endotoxin antagonistic activities (16, 33, 39, 46). In addition, foreign acyltransferases with altered fatty acid specificities can function in heterologous bacteria. For example, the β-hydroxymyristate chains at the 3 and 3′ positions of E. coli lipid A could be replaced by β-hydroxylaurate and/or β-hydroxydecanoate when a meningococcal lpxA gene was used to complement an lpxA2 allele in E. coli (31). The finding that N. meningitidis can synthesize an intact lipid A without glycosylation suggests that this system can be a versatile expression system for assembly of diverse intact bacterial lipid A structures. The additional acid hydrolysis steps required for the removal of the inner core glycosyl linkage would be eliminated in the production of these intact lipid A structures.

In summary, we found that KdtA of N. meningitidis is not essential for lipid A production or meningococcal survival. Detailed structural characterization demonstrated that the meningococcal kdtA mutation resulted in synthesis of a fully acylated variably phosphorylated lipid A instead of the tetra-acylated lipid IVA seen in gram-negative enteric bacteria. These results support the conclusion that assembly of lipid A is not the same in enteric and nonenteric gram-negative bacteria.

Acknowledgments

This work was supported by Public Health Service grants AI-33517 and AI40247 from the National Institutes of Health to D.S.S.

We are grateful to John Heckels for sharing pEG2. We thank Lawrance Melson at the Microscopy Core Facility, Emory University, for the electron microscopy analysis, Yoon Kim Miller and Larry Martin for excellent technical assistance, and Lane Pucko for administrative assistance.

REFERENCES

  • 1.Belunis, C. J., T. Clementz, S. M. Carty, and C. R. Raetz. 1995. Inhibition of lipopolysaccharide biosynthesis and cell growth following inactivation of the kdtA gene in Escherichia coli. J. Biol. Chem. 270:27646-27652. [DOI] [PubMed] [Google Scholar]
  • 2.Belunis, C. J., K. E. Mdluli, C. R. Raetz, and F. E. Nano. 1992. A novel 3-deoxy-d-manno-octulosonic acid transferase from Chlamydia trachomatis required for expression of the genus-specific epitope. J. Biol. Chem. 267:18702-18707. [PubMed] [Google Scholar]
  • 3.Belunis, C. J., and C. R. Raetz. 1992. Biosynthesis of endotoxins. Purification and catalytic properties of 3-deoxy-d-manno-octulosonic acid transferase from Escherichia coli. J. Biol. Chem. 267:9988-9997. [PubMed] [Google Scholar]
  • 4.Bhat, U. R., L. S. Forsberg, and R. W. Carlson. 1994. Structure of lipid A component of Rhizobium leguminosarum bv. phaseoli lipopolysaccharide. Unique nonphosphorylated lipid A containing 2-amino-2-deoxygluconate, galacturonate, and glucosamine. J. Biol. Chem. 269:14402-14410. [PubMed] [Google Scholar]
  • 5.Brabetz, W., C. E. Schirmer, and H. Brade. 2000. 3-Deoxy-d-manno-oct-2-ulosonic acid (Kdo) transferase of Legionella pneumophila transfers two Kdo residues to a structurally different lipid A precursor of Escherichia coli. J. Bacteriol. 182:4654-4657. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Brozek, K. A., and C. R. Raetz. 1990. Biosynthesis of lipid A in Escherichia coli. Acyl carrier protein-dependent incorporation of laurate and myristate. J. Biol. Chem. 265:15410-15417. [PubMed] [Google Scholar]
  • 7.Christodoulides, M., J. S. Everson, B. L. Liu, P. R. Lambden, P. J. Watt, E. J. Thomas, and J. E. Heckels. 2000. Interaction of primary human endometrial cells with Neisseria gonorrhoeae expressing green fluorescent protein. Mol. Microbiol. 35:32-43. [DOI] [PubMed] [Google Scholar]
  • 8.Ciucanu, I., and F. Kerek. 1984. A simple and rapid method for the permethylation of carbohydrates. Carbohydr. Res. 131:209-217.
  • 9.Clementz, T., and C. R. Raetz. 1991. A gene coding for 3-deoxy-d-manno-octulosonic-acid transferase in Escherichia coli. Identification, mapping, cloning, and sequencing. J. Biol. Chem. 266:9687-9696. [PubMed] [Google Scholar]
  • 10.Darvill, A. G., P. Albersheim, M. McNeil, J. M. Lau, W. S. York, T. T. Stevenson, J. Thomas, S. Doares, D. J. Gollin, P. Chelf, et al. 1985. Structure and function of plant cell wall polysaccharides. J. Cell Sci. Suppl. 2:203-217. [DOI] [PubMed] [Google Scholar]
  • 11.Edebrink, P., P. E. Jansson, M. M. Rahman, G. Widmalm, T. Holme, M. Rahman, and A. Weintraub. 1994. Structural studies of the O-polysaccharide from the lipopolysaccharide of Moraxella (Branhamella) catarrhalis serotype A (strain ATCC 25238). Carbohydr. Res. 257:269-284. [DOI] [PubMed] [Google Scholar]
  • 12.Fussenegger, M., A. F. Kahrs, D. Facius, and T. F. Meyer. 1996. Tetrapac (tpc), a novel genotype of Neisseria gonorrhoeae affecting epithelial cell invasion, natural transformation competence and cell separation. Mol. Microbiol. 19:1357-1372. [DOI] [PubMed] [Google Scholar]
  • 13.Goldman, R., W. Kohlbrenner, P. Lartey, and A. Pernet. 1987. Antibacterial agents specifically inhibiting lipopolysaccharide synthesis. Nature 329:162-164. [DOI] [PubMed] [Google Scholar]
  • 14.Goldman, R. C., C. C. Doran, and J. O. Capobianco. 1988. Analysis of lipopolysaccharide biosynthesis in Salmonella typhimurium and Escherichia coli by using agents which specifically block incorporation of 3-deoxy-d-manno-octulosonate. J. Bacteriol. 170:2185-2191. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Goldman, R. C., C. C. Doran, S. K. Kadam, and J. O. Capobianco. 1988. Lipid A precursor from Pseudomonas aeruginosa is completely acylated prior to addition of 3-deoxy-d-manno-octulosonate. J. Biol. Chem. 263:5217-5223. [PubMed] [Google Scholar]
  • 16.Golenbock, D. T., R. Y. Hampton, N. Qureshi, K. Takayama, and C. R. Raetz. 1991. Lipid A-like molecules that antagonize the effects of endotoxins on human monocytes. J. Biol. Chem. 266:19490-19498. [PubMed] [Google Scholar]
  • 17.Gotschlich, E. C., B. A. Fraser, O. Nishimura, J. B. Robbins, and T. Y. Liu. 1981. Lipid on capsular polysaccharides of gram-negative bacteria. J. Biol. Chem. 256:8915-8921. [PubMed] [Google Scholar]
  • 18.Gronow, S., and H. Brade. 2001. Lipopolysaccharide biosynthesis: which steps do bacteria need to survive? J. Endotoxin Res. 7:3-23. [PubMed] [Google Scholar]
  • 19.Helander, I. M., B. Lindner, H. Brade, K. Altmann, A. A. Lindberg, E. T. Rietschel, and U. Zahringer. 1988. Chemical structure of the lipopolysaccharide of Haemophilus influenzae strain I-69 Rd-/b+. Description of a novel deep-rough chemotype. Eur. J. Biochem. 177:483-492. [DOI] [PubMed] [Google Scholar]
  • 20.Hitchcock, P. J., and T. M. Brown. 1983. Morphological heterogeneity among Salmonella lipopolysaccharide chemotypes in silver-stained polyacrylamide gels. J. Bacteriol. 154:269-277. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Holst, O., D. Borowiak, J. Weckesser, and H. Mayer. 1983. Structural studies on the phosphate-free lipid A of Rhodomicrobium vannielii ATCC 17100. Eur. J. Biochem. 137:325-332. [DOI] [PubMed] [Google Scholar]
  • 22.Janik, A., E. Juni, and G. A. Heym. 1976. Genetic transformation as a tool for detection of Neisseria gonorrhoeae. J. Clin. Microbiol. 4:71-81. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Kahler, C. M., R. W. Carlson, M. M. Rahman, L. E. Martin, and D. S. Stephens. 1996. Inner core biosynthesis of lipooligosaccharide (LOS) in Neisseria meningitidis serogroup B: identification and role in LOS assembly of the alpha1,2 N-acetylglucosamine transferase (RfaK). J. Bacteriol. 178:1265-1273. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Kahler, C. M., L. E. Martin, G. C. Shih, M. M. Rahman, R. W. Carlson, and D. S. Stephens. 1998. The (α2→8)-linked polysialic acid capsule and lipooligosaccharide structure both contribute to the ability of serogroup B Neisseria meningitidis to resist the bactericidal activity of normal human serum. Infect. Immun. 66:5939-5947. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Kahler, C. M., and D. S. Stephens. 1998. Genetic basis for biosynthesis, structure, and function of meningococcal lipooligosaccharide (endotoxin). Crit. Rev. Microbiol. 24:281-334. [DOI] [PubMed] [Google Scholar]
  • 26.Kenne, L., B. Lindberg, M. M. Rahman, and M. Mosihuzzaman. 1993. Structural studies of Vibrio fluvialis M-940 O-antigen polysaccharide. Carbohydr. Res. 242:181-189. [DOI] [PubMed] [Google Scholar]
  • 27.Kulshin, V. A., U. Zahringer, B. Lindner, C. E. Frasch, C. M. Tsai, B. A. Dmitriev, and E. T. Rietschel. 1992. Structural characterization of the lipid A component of pathogenic Neisseria meningitidis. J. Bacteriol. 174:1793-1800. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Menard, R., P. J. Sansonetti, and C. Parsot. 1993. Nonpolar mutagenesis of the ipa genes defines IpaB, IpaC, and IpaD as effectors of Shigella flexneri entry into epithelial cells. J. Bacteriol. 175:5899-5906. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Mohan, S., and C. R. Raetz. 1994. Endotoxin biosynthesis in Pseudomonas aeruginosa: enzymatic incorporation of laurate before 3-deoxy-d-manno-octulosonate. J. Bacteriol. 176:6944-6951. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Nath, K. 1990. A rapid DNA isolation procedure from petri dish grown clinical bacterial isolates. Nucleic Acids Res. 18:6462.. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Odegaard, T. J., I. A. Kaltashov, R. J. Cotter, L. Steeghs, P. van der Ley, S. Khan, D. J. Maskell, and C. R. Raetz. 1997. Shortened hydroxyacyl chains on lipid A of Escherichia coli cells expressing a foreign UDP-N-acetylglucosamine O-acyltransferase. J. Biol. Chem. 272:19688-19696. [DOI] [PubMed] [Google Scholar]
  • 32.Raetz, C. R., S. Purcell, M. V. Meyer, N. Qureshi, and K. Takayama. 1985. Isolation and characterization of eight lipid A precursors from a 3-deoxy-d-manno-octylosonic acid-deficient mutant of Salmonella typhimurium. J. Biol. Chem. 260:16080-16088. [PubMed] [Google Scholar]
  • 33.Raetz, C. R. H. 1996. Bacterial lipopolysaccharides: a remarkable family of bioactive macroamphiphiles, p. 1035-1063. In F. C. Neidhardt (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., vol. 1. American Society for Microbiology, Washington, D.C. [Google Scholar]
  • 34.Rahman, M. M., V. S. Kolli, C. M. Kahler, G. Shih, D. S. Stephens, and R. W. Carlson. 2000. The membrane phospholipids of Neisseria meningitidis and Neisseria gonorrhoeae as characterized by fast atom bombardment mass spectrometry. Microbiology 146:1901-1911. [DOI] [PubMed] [Google Scholar]
  • 35.Rahman, M. M., D. S. Stephens, C. M. Kahler, J. Glushka, and R. W. Carlson. 1998. The lipooligosaccharide (LOS) of Neisseria meningitidis serogroup B strain NMB contains L2, L3, and novel oligosaccharides, and lacks the lipid-A 4′-phosphate substituent. Carbohydr. Res. 307:311-324. [DOI] [PubMed] [Google Scholar]
  • 36.Rau, H., U. Seydel, M. Freudenberg, J. Weckesser, and H. Mayer. 1995. Lipopolysaccharide of Rhodospirillum salinarum 40: structural studies on the core and lipid A region. Arch. Microbiol. 164:280-289. [DOI] [PubMed] [Google Scholar]
  • 37.Rick, P. D., L. W. Fung, C. Ho, and M. J. Osborn. 1977. Lipid A mutants of Salmonella typhimurium. Purification and characterization of a lipid A precursor produced by a mutant in 3-deoxy-d-mannooctulosonate-8-phosphate synthetase. J. Biol. Chem. 252:4904-4912. [PubMed] [Google Scholar]
  • 38.Rick, P. D., and M. J. Osborn. 1977. Lipid A mutants of Salmonella typhimurium. Characterization of a conditional lethal mutant in 3-deoxy-d-mannooctulosonate-8-phosphate synthetase. J. Biol. Chem. 252:4895-4903. [PubMed] [Google Scholar]
  • 39.Rietschel, E. T., T. Kirikae, F. U. Schade, U. Mamat, G. Schmidt, H. Loppnow, A. J. Ulmer, U. Zahringer, U. Seydel, F. Di Padova, et al. 1994. Bacterial endotoxin: molecular relationships of structure to activity and function. FASEB J. 8:217-225. [DOI] [PubMed] [Google Scholar]
  • 40.Schagger, H., and G. von Jagow. 1987. Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Anal. Biochem. 166:368-379. [DOI] [PubMed] [Google Scholar]
  • 41.Shih, G. C., C. M. Kahler, R. W. Carlson, M. M. Rahman, and D. S. Stephens. 2001. gmhX, a novel gene required for the incorporation of l-glycero-d-manno-heptose into lipooligosaccharide in Neisseria meningitidis. Microbiology 147:2367-2377. [DOI] [PubMed] [Google Scholar]
  • 42.Steeghs, L., H. de Cock, E. Evers, B. Zomer, J. Tommassen, and P. van der Ley. 2001. Outer membrane composition of a lipopolysaccharide-deficient Neisseria meningitidis mutant. EMBO J. 20:6937-6945. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Steeghs, L., R. den Hartog, A. den Boer, B. Zomer, P. Roholl, and P. van der Ley. 1998. Meningitis bacterium is viable without endotoxin. Nature 392:449-450. [DOI] [PubMed] [Google Scholar]
  • 44.Stephens, D. S., J. S. Swartley, S. Kathariou, and S. A. Morse. 1991. Insertion of Tn916 in Neisseria meningitidis resulting in loss of group B capsular polysaccharide. Infect. Immun. 59:4097-4102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Strain, S. M., I. M. Armitage, L. Anderson, K. Takayama, N. Qureshi, and C. R. Raetz. 1985. Location of polar substituents and fatty acyl chains on lipid A precursors from a 3-deoxy-d-manno-octulosonic acid-deficient mutant of Salmonella typhimurium. Studies by 1H, 13C, and 31P nuclear magnetic resonance. J. Biol. Chem. 260:16089-16098. [PubMed] [Google Scholar]
  • 46.Takayama, K., N. Qureshi, B. Beutler, and T. N. Kirkland. 1989. Diphosphoryl lipid A from Rhodopseudomonas sphaeroides ATCC 17023 blocks induction of cachectin in macrophages by lipopolysaccharide. Infect. Immun. 57:1336-1338. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Tettelin, H., N. J. Saunders, J. Heidelberg, A. C. Jeffries, K. E. Nelson, J. A. Eisen, K. A. Ketchum, D. W. Hood, J. F. Peden, R. J. Dodson, W. C. Nelson, M. L. Gwinn, R. DeBoy, J. D. Peterson, E. K. Hickey, D. H. Haft, S. L. Salzberg, O. White, R. D. Fleischmann, B. A. Dougherty, T. Mason, A. Ciecko, D. S. Parksey, E. Blair, H. Cittone, E. B. Clark, M. D. Cotton, T. R. Utterback, H. Khouri, H. Qin, J. Vamathevan, J. Gill, V. Scarlato, V. Masignani, M. Pizza, G. Grandi, L. Sun, H. O. Smith, C. M. Fraser, E. R. Moxon, R. Rappuoli, and J. C. Venter. 2000. Complete genome sequence of Neisseria meningitidis serogroup B strain MC58. Science 287:1809-1815. [DOI] [PubMed] [Google Scholar]
  • 48.Tikhomirov, E., M. Santamaria, and K. Esteves. 1997. Meningococcal disease: public health burden and control. World Health Stat. Q. 50:170-177. [PubMed]
  • 49.Waeghe, T. J., A. G. Darvill, M. McNeil, and P. Albersheim. 1983. Determination, by methylation analysis, of the glycosyl-linkage compositions of microgram quantities of complex carbohydrates. Carbohydr. Res. 123:281-304. [Google Scholar]
  • 50.Weintraub, A., U. Zahringer, H. W. Wollenweber, U. Seydel, and E. T. Rietschel. 1989. Structural characterization of the lipid A component of Bacteroides fragilis strain NCTC 9343 lipopolysaccharide. Eur. J. Biochem. 183:425-431. [DOI] [PubMed] [Google Scholar]
  • 51.Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33:103-119. [DOI] [PubMed] [Google Scholar]
  • 52.Zhou, D., and M. A. Apicella. 1996. Plasmids with erythromycin resistance and catechol 2,3-dioxygenase- or beta-galactosidase-encoding gene cassettes for use in Neisseria spp. Gene 171:133-134. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES