Evaluation of Anti‐Tumorigenic Effects of Curcumin and Baicalein in 7,12‐Dimethylbenz[a] Anthracene‐Induced Mammary Gland Tumorigenesis in Wistar Rats

ABSTRACT

Mammary tumor is one of the most common neoplasms in females and remains a major therapeutic challenge due to the high cost and adverse effects of conventional chemotherapy. Therefore, herbal products such as curcumin, baicalein and their combination are used which have anti‐inflammatory effects and various other pharmacological effects. The present study evaluated the effects of curcumin and baicalein against mammary tumor induced by 7,12‐dimethylbenz[a]anthracene (DMBA) in Wistar rats. Thirty‐eight virgin female rats were divided into five groups: Group I (SHAM), Group II (DMBA @ 80 mg/kg BW orally single dose), Group III (DMBA @ 80 mg/kg BW orally + curcumin @ 100 mg/kg BW orally), Group IV (DMBA @ 80 mg/kg BW orally + baicalein @10 mg/kg BW i.p.), and Group V (DMBA @80 mg/kg + curcumin @100 mg/kg BW + baicalein @10 mg/kg BW). Curcumin and baicalein treatment demonstrated significant efficacy. Only small palpable growths were observed in treated groups and mild early neoplastic alterations were detected histologically, with the lowest incidence in the combination group. Curcumin and baicalein supplementation significantly ameliorated the DMBA induced changes in the body weight, hematological parameters (Hb, PCV, TEC, TLC, DLC), biochemical parameters (AST, ALT, ALKP, Total protein, glucose, BUN, Creatinine), oxidative stress parameters (NO, LPO, SOD, and Catalase), and pro‐inflammatory cytokines (IL‐I, IL‐6, TNF‐α). Moreover, immunohistochemistry and RT‐PCR of epithelial–mesenchymal transition markers (e‐cadherin, vimentin, α‐smooth muscle actin) confirmed the ameliorative effect of curcumin and baicalein, most pronounced in the combination group. These findings suggest that curcumin and baicalein may exert synergistic beneficial effects, supporting their potential as chemopreventive agents.

In Wistar rats, curcumin and baicalein inhibited the development of mammary tumors in the DMBA‐induced mammary tumor model. The treatment groups showed the protective effect by lowering oxidative stress parameters, pro‐inflammatory cytokines, and epithelial–mesenchymal transition markers.

1. Introduction

Cancer represents a diverse group of diseases that is characterized by an uncontrolled cell multiplication that can spread to neighbouring tissues. It is among the leading causes of death for both dogs and humans. Approximately 10 million cancer‐related fatalities and 19.3 million new cases are recorded in humans each year, compared to 4 million new cases in dogs [1]. For dogs over ten, cancer is the leading cause of mortality, accounting for 50% of cases and one in four fatalities [2]. In addition to developing spontaneous cancer, dogs and humans have several biological, clinical, pathological, and molecular characteristics [3]. Mammary tumor is one of the most frequently encountered cancers and the major cause of cancer‐related death in female canines and women, affecting many animal species and is regarded as a serious public health issue [3, 4]. The American Cancer Society projects that around 316,950 new cases of invasive breast cancer will be identified in women in the US in 2025. There will be roughly 59,080 new instances of ductal carcinoma in situ (DCIS), and about 42,170 will claim their lives due to breast cancer.

There is significant biological variation in canine mammary tumors, ranging from benign hyperplastic lesions to extremely malignant carcinomas. Almost half of these mammary gland tumours are malignant and have the potential to metastasize [5]. The intricate process of tumor progression involves interactions between the surrounding stromal microenvironment and neoplastic epithelial cells. Recent data suggest that aberrant epithelial‐to‐mesenchymal transition (EMT) activation in cancer cells contributes to tumor progression and metastasis [6]. EMT is a biological process that leads epithelial cells to lose their polarity and convert into a mesenchymal cell phenotype, which includes increased migratory capacity, elevated resistance to apoptosis, invasiveness, and significantly increased production of ECM (extracellular matrix) components [6].

The therapeutic management of mammary tumor is still difficult despite advancements in surgical and chemotherapeutic therapies because of high treatment costs, poor efficacy, drug resistance, and serious side effects that limit their long‐term usage in clinical practice [7]. Consequently, it is necessary to investigate safer and more economical alternatives. In this context, natural, affordable, and low‐toxicity alternatives that can prevent the development of mammary tumors or slow their progression are gaining increasing attention, as they may help affected dogs achieve improved survival and quality of life [8].

In today's world, a plethora of herbal drugs have caught the attention of the scientific community, and the whole world is trying to tap the potential of these herbal ingredients against diseases, including cancer [9]. Among them, curcumin, derived from rhizomes of the plant Curcuma longa (turmeric) and also known as diferuloylmethane, is present in all kitchens, has attracted a lot of interest that performing advantageous biological functions, such as anti‐inflammatory, antiviral, antibacterial, and antioxidant properties [10]. Subsequently, another herbal compound, i.e., baicalein, obtained from roots of plants, viz., Scutellaria baicalensis and Scutellaria lateriflora, and also called Chinese Huang Qin. Baicalein has numerous pharmacological effects, including antioxidant, anti‐inflammatory, and antiviral activity [11]. Moreover, Baicalein attenuated the bleomycin‐induced early stage of Type II EMT in lung fibrosis [12]. However, the therapeutic role of curcumin and baicalein in breast cancer and type III EMT is not well investigated. Furthermore, little is known about how they interact in combination to affect mammary carcinogenesis in models that are pertinent to canine cancer.

Before clinical use in dogs and humans, preclinical animal models are essential for comprehending the biology of mammary tumors and assessing possible treatment agents. A well‐known experimental system that closely resembles a number of the histological and molecular features of spontaneous canine mammary tumors is the 7,12‐dimethylbenz[a]anthracene (DMBA)‐induced mammary tumor model in Wistar rats [13]. By damaging DNA, DMBA causes a redox imbalance that produces a significant number of reactive oxygen species and persistent inflammation, which leads to the development of tumors and progressive epithelial proliferation [14]. Therefore, this model provides a suitable platform for evaluating the chemopreventive and anti‐neoplastic efficacy of novel therapeutic agents relevant to oncology.

Accordingly, the present study was designed to evaluate the anti‐neoplastic potential of curcumin and baicalein individually and synergistically, in a DMBA‐induced Wistar rat mammary tumor model.

2. Materials and Methods

2.1. Experimental Animals

The present study involved thirty‐eight (n = 38) healthy virgin female Wistar rats, aged six to 8 weeks, purchased from the Disease‐Free Small Animal House at the Indo‐Soviet Friendship (ISF) College of Pharmacy, Moga, Punjab. The experimental protocol was reviewed and approved by the Institutional Animal Ethics Committee (IAEC), Guru Angad Dev Veterinary and Animal Sciences University (GADVASU), Ludhiana under order no. IAEC/2021/60/19. The rats were housed individually in clean, standard polypropylene laboratory cages with autoclaved rice husk as bedding material in the Laboratory Animal Housing Facility of College of Veterinary Science, GADVASU, Ludhiana, Punjab, India. Every hygienic and sanitary measure was used in accordance with CPCSEA regulations. Animals were provided with standard laboratory animal feed (Ashirwad Feeds, Chandigarh, India) and ad libitum drinking water that was boiled and subsequently cooled to room temperature throughout the study. During the experiment, the animals were maintained under consistent environmental and dietary conditions, including a temperature of 22 ± 2°C, relative humidity of 50%–55%, and a 12‐h light/dark cycle to prevent any stress [15]. Bedding material was replaced on alternate days throughout the experimental period, and the cages were thoroughly washed with a potassium permanganate solution on that day to prevent the occurrence of any disease. Throughout the whole experiment, the animals received no medication of any type.

2.2. Experimental Design

After procuring the female Wistar rats (n = 38), they were acclimatized for 7 days. On the first day of the experiment, animals were divided randomly into five experimental groups, and weighing was done on an analytical weighing balance (Denver Instrument, Bohemia, NY, USA). Each of the groups had roughly comparable initial mean body weights that carried eight rats, except Group I, where six animals were taken. Groups were named based on the abbreviations of administered compounds (Table 1).

Table 1.

Experimental designs and dosage schedule.

Groups	Name of the groups	Treatment doses/route	Number of animals
I	SHAM/Vehicle	Vehicle only	06
II	DMBA control	DMBA@ 80 mg/kg BW Orally single dose	08
III	DMBA + CUR	DMBA@ 80 mg/kg BW orally single dose + Curcumin @100 mg/kg bw orally every alternate day.	08
IV	DMBA + BAIC	DMBA@ 80 mg/kg BW orally single dose + Baicalein @10 mg/kg BW i.p every alternate day.	08
V	DMBA + CUR + BAIC	DMBA@ 80 mg/kg BW single dose + Curcumin @100 mg/kg BW orally + Baicalein @10 mg/kg BW i.p every alternate day.	08

Abbreviations: BAIC, baicalein; BW, body weight; CUR, curcumin; DMBA, 7,12‐dimethylbenz[a]anthracene.

For the induction of mammary tumors, a single dose of 7,12‐dimethylbenz[a]anthracene (DMBA) @ 80 mg/kg BW (Sigma‐Aldrich, USA) orally was given to the rats of all groups (Group‐II, III, IV, and V) except the SHAM/vehicle group (Group‐I) [16]. To prepare the DMBA dose, DMBA was prepared at the required dose and diluted in 200 µL of pre‐warmed olive oil for each rat. The mixture was stirred thoroughly to obtain a uniform solution and then kept in an incubator at 37°C for a brief period to facilitate complete dissolution and ensure homogeneity. For treatment, curcumin (P.V. Biomedicals, USA) @ 100 mg/kg BW orally and baicalein (Sigma‐Aldrich, USA) @10 mg/kg BW intraperitoneally (i.p) were given to the rats of their respective group on every alternate day for 20 weeks (Table 1) [16, 17]. For each rat dosage, 100 μL of dimethyl sulfoxide (DMSO) was used separately to dilute the curcumin and baicalein. Throughout the experimental period, the animals of all the groups were rigorously monitored twice a day for any clinical signs, and the skin was meticulously examined under a light to check for mammary tumors. To track the development of mammary tumors, animals were weighed every 2 weeks and palpated their mammary glands every week from the start of the trial until its end. The experiment was ended after 20 weeks, which covered the peak carcinogenic window of DMBA and extended into the progression phase. Following completion of the 20‐week study period, blood was collected from the heart of rats under anaesthesia using ketamine (@80 mg/kg BW) and xylazine (@10 mg/kg BW) before sacrificing the animals. Thereafter, animals were humanely euthanized by administration of an anaesthetic overdose of ketamine (Neon Laboratories Ltd., Mumbai, India) @300 mg/kg BW and xylazine (Indian Immunologicals Ltd., Hyderabad, Telangana, India) @30 mg/kg BW, approximately three times the anaesthetic dose, in accordance with AVMA guidelines for euthanasia. No unexpected adverse events were observed during the experimental period.

2.3. Clinical Monitoring, Tumor Incidence and Change in Body Weight

The animals of all the groups were rigorously monitored twice a day for any clinical signs, and the skin was meticulously examined and palpated under a light to check for mammary tumors. Throughout the experimental period, all animals were weighed every 2 weeks to monitor changes in body weight.

2.4. Haemato‐Biochemical Analysis

Under anaesthesia, 1 mL of blood was collected by cardiac puncture from each animal using a sterile 2‐mL disposable syringe. Out of this, 300 μL of blood was transferred to EDTA‐containing vials @ 1 mg/mL, and 700 μL of blood was transferred to a dry, clean, sterilized vial containing no anticoagulant that was further allowed to clot for withdrawing the serum. Until the biochemical parameters were further assessed, the obtained serum samples were stored at −20°C. Various haematological parameters viz., Haemoglobin concentration (Hb), Total erythrocyte count (TEC), Packed cell volume (PCV), Total leucocyte count (TLC) and Platelet count were determined using ADVIA 2120 automatic hematoanalyzer (Siemens Healthcare Diagnostics Inc., Deerfield, IL, USA) whereas Differential Leukocyte count (DLC) was done manually after staining blood smears with Leishman stain [18].

In the collected sample, the total protein, glucose, liver function marker enzymes such as alanine aminotransferase (ALT), aspartate aminotransferase (AST) and alkaline phosphatase, kidney function tests viz., blood urea nitrogen and creatinine were estimated using commercially available kits in an automatic VITROS 350 Chemistry System (Ortho‐Clinical Diagnostics, (Johnson & Johnson Company, New Brunswick, NJ, USA).

2.5. Analysis of Oxidative Stress Parameters

Different oxidative stress parameters, such as nitric oxide (NO), lipid peroxidation (LPO), and antioxidant enzymes viz., catalase (CAT) and superoxide dismutase (SOD) were estimated using a double beam UV‐VIS spectrophotometer. Mammary tissue homogenates were prepared [14]. The supernatant of fresh, homogenized mammary gland tissue samples in 1:10 volumes of chilled PBS (pH 7.4) were used to estimate these parameters. NO, LPO, SOD, and CAT were estimated as per the given methods, respectively [19, 20, 21, 22].

2.6. Analysis of Pro‐Inflammatory Cytokine

Interleukin‐1 (IL‐1), Interleukin‐6 (IL‐6), and Tumor necrosis factor (TNF‐α) in 10% mammary tissue homogenate were estimated using commercially available rat enzyme‐linked immunosorbent assay (ELISA) kits (KRISHGEN Bio Systems, Whittier, CA, USA).

2.7. Histopathological Analysis of Mammary Glands

After a thorough gross examination of the mammary glands, small representative sections of the mammary glands were taken from all the sacrificed rats and fixed in 10% neutral buffered formalin (NBF). After proper fixation of tissues, routine tissue processing and standard Mayer's Haematoxylin and Eosin (H&E) staining were performed [23].

2.8. Immunohistochemical Analysis

Immunohistochemical analysis was performed for e‐cadherin (epithelial marker), vimentin, and α‐smooth muscle actin (mesenchymal markers) [24]. The standard protocol was used to carried following deparaffinization and hydration of the slides. Antigen retrieval was done using sodium‐citrate buffer (pH 6.0) in a microwave, followed by endogenous peroxidase blocking by 3% hydrogen peroxide and serum blocking. The tissues were treated with the primary antibodies, i.e.,e‐cadherin (Abcam, Cambridge, UK; Cat. No. ab76319; dilution 1:200), vimentin (Abcam, Cambridge, UK; Cat. No. ab137321; dilution 1:250), and α‐smooth muscle actin (Abcam, Cambridge, UK; Cat. No. ab21027; dilution 1:250) on paraffin‐embedded tissue sections of mammary tumor mounted on manually coated slides with Poly‐l‐lysine (Sigma‐Aldrich, USA), followed by overnight incubation in a humidified chamber at 4°C [24]. Thereafter, slides were incubated with VR Horse Anti‐Rabbit IgG Polymer Detection Kit, Peroxidase (Vector Laboratories, Burlingame, CA, USA; Cat. No. MP‐6401‐15) and ImmPACT® DAB Substrate, Peroxidase (HRP) (Vector Laboratories, Burlingame, CA, USA; Cat. No. SK‐4105) was used as chromogen. Gill's Hematoxylin was used to counterstain the slides. For the negative control, primary antibodies were omitted. Immunohistochemical reactivity of e‐cadherin, vimentin, and α‐smooth muscle actin was evaluated semi‐quantitatively with the following criteria.

2.8.1. Criteria for Semi‐Quantitative Analysis of E‐Cadherin

E‐cadherin expression was classified into three grades: cases showing > 75% cancer positive cells (E‐cad positive (+) group), cases having 25% to 75% positive cells (E‐cad heterogeneous (+/‐) group), and < 25% of cancer‐positive cells (E‐cad negative (‐) group). The E‐cad (+) tumors were classified as preserved E‐cad expression type (Pr type), whereas the (+/‐) and (‐) tumor groups were classified as reduced E‐cad expression type (Rd type) [25].

2.8.2. Criteria for Semi‐Quantitative Analysis of Vimentin and α‐smooth Muscle Actin

Immunoreactivity of vimentin and α‐smooth muscle actin was expressed into four grades i.e., + or +1 (cases showing < 10% positive cells), ++ or +2 (> 10% but < 50% positive cells), +++ or +3 (> 50% but < 90% positive cells) and ++++ or +4 (> 90% positive cells) [26]. Vimentin expression was deemed positive for EMT if the cytoplasm of neoplastic cells exhibited distinct positive staining in malignant epithelial‐like cells dispersed throughout the acini or at random among the epithelial cells. Positive expression or labelling shown by endothelial cells, fibroblasts, inflammatory cells, viz., lymphocytes and macrophages, was regarded as a positive control and disregarded for EMT. No grade will be given to these types of cells showing immunoreactivity of vimentin.

2.9. Analysis of mRNA Expression of E‐Cadherin, Vimentin, and α‐Smooth Muscle Actin in the Mammary Gland Homogenate

2.9.1. Extraction of RNA

The total RNA was extracted using the manufacturer's protocol of RNeasy® Mini Kit (50) (Qiagen, Hilden, Germany; Cat. No. 74104) and transcribed to cDNA using the High‐Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA; Cat. No. 4368814) as per the manufacturer's instructions. The components of the kit were thawed on ice for preparation of the saturated reverse transcription master mix (2X).

2.9.2. Optimization of cDNA for Real‐Time PCR Reaction

The information on the primers has been listed in Table 2 [27, 28]. For the quantitative evaluation of mRNA transcript levels of e‐cadherin, vimentin, α‐smooth muscle actin, and β ‐actin in the mammary glands of the rats, real‐time qRT‐PCR was performed using a BIO‐RAD model CFX96^TM Optics Module real‐time PCR.

Table 2.

Primer sequences of E‐cadherin, Vimentin, alpha smooth muscle action and β‐ actin for PCR.

Primer	Primer sequence	Product size (bp)
E‐cadherin	F 5′AAAGCAGGAAGAAAACACCACTC 3′	72
	R 5′AAAGGGCACGCTATCAACATTAG 3′
Vimentin	F 5′ CTTCGCCAACTACATCGACA 3′	400
	R 3′ CTGCAGCTCCTGGATCTCTT 3′
α‐smooth muscle actin	F 5′ CTCATCCACGAAACCACCTAT 3′	211
	R 5′ CGCCGATCCAGACAGAATA 3′
β ‐ actin	F 5′ ACGTTGACATCCGTAAAGAC 3′	200
	R 5′ GAAGGTGGACAGTGAGGC 3′

2.9.3. Reaction Conditions

The reaction mixture was prepared according to a standardized real‐time PCR reaction with Applied Biosystems by Life Technologies SYBR® Green PCR kit. The composition of master mix included nuclease‐free water (2 μL), SYBR (5 μL), primers (forward‐0.5 μL and reverse‐0.5 μL), and cDNA template (2 μL, i.e., 120 ng/μL). The total concentration of the master mix was 10 μL. The reaction was in duplicates and carried out in Real Time PCR using the following cycling parameters that have been found optimum for amplification of gene fragments with β‐actin as an endogenous control. The temperature‐time combination used for different primers is shown in Table 3.

Table 3.

Conditions for SYBR Green Real Time PCR for E‐cadherin, Vimentin, α‐smooth muscle actin and β‐actin.

Temperature‐time combination for E‐cadherin, alpha smooth muscle actin and β‐actin
Step	Temperature (°C)	Time		Number of cycles
I	95	5 min	Initial denaturation	1
II	95	20 s	Denaturation	35
III	60	20 s	Annealing
IV	72	30 s	Extension
V	Melt curve
Temperature‐time combination for Vimentin
I	95	10 min	Initial denaturation	1
II	95	15 s	Denaturation	40
III	60	1 min	Annealing
IV	72	30 s	Extension
V	Melt Curve

Following amplification, a melting curve analysis was performed. Relative changes in gene expression levels were calculated [29]. Data were represented as fold upregulation/downregulation.

Fold change=2^‐DDCt

$$\text{DDCt}=[{\left(\text{Ctofgeneofinterest}–\text{Ctofhousekeepinggene}\right)}_{\text{treatmentgroup}}–{\left(\text{Ctofgeneofinterest}–\text{Ctofhousekeepinggene}\right)}_{\text{Controlgroup}}]$$

2.10. Statistical Analysis

Data obtained from various experiments were expressed as Mean ± Standard Error Mean (SEM). Data were analysed using one‐way analysis of variance (ANOVA), followed by Tukey's post hoc test for multiple comparisons among groups. A value of p ≤ 0.05 was taken as significant. All the data was analysed by using SPSS/10.0 software.

3. Results

3.1. Morbidity, Mortality, and % of Survivability

All rats of group I (control group) survived till the end of the experiment and showed no signs of illness. In the DMBA group (Group‐II), 50% of rats (n = 4) showed respiratory distress after 1 month of DMBA administration, whereas animals of other groups showed no such signs of illness. Two rats of Group‐III, one rat of Group IV, and V showed a slight decrease in feed intake. Further, the mortality in Groups I, II, III, IV, and V was found to be 0% (n = 0/6), 25% (n = 2/8), 25% (n = 2/8), 12.5% (n = 1/8), and 12.5% (n = 1/8), respectively. These rats were excluded during the analysis of results.

3.2. Effect on Body Weight

The effect of all the chemicals, viz., DMBA, Curcumin, and Baicalein, on the body weights of all experimental groups during 20 weeks of experiment is shown in the form of Mean ± SE in Table 4. The mean body weight in Groups 1, III, IV, and V showed a 37.19%, 32.59%, 33.48%, and 34.54% increase at the end of the experiment, respectively, compared to the first day of treatment. However, in the DMBA‐treated group (Group‐II), the mean body weight was found to be decreased by 15.05%.

Table 4.

Effect of DMBA, Curcumin, and Baicalein on body weight of all experimental groups.

Time period (weeks)	Body weight (g)
	I (SHAM)	II (DMBA)	III (DMBA + CUR)	IV (DMBA + BAIC)	V (DMBA + CUR + BAIC)
0th week	171.33 ± 2.80	171.25 ± 2.68	171.25 ± 1.70	171.25 ± 1.66	171.25 ± 2.32
2nd week	175.51 ± 2.68	172.70 ± 2.88	173.57 ± 1.88	173.67 ± 1.58	174.12 ± 2.27
4th week	178.35 ± 2.79	173.80 ± 2.98	175.70 ± 1.59	175.90 ± 1.72	176.25 ± 2.40
6th week	182.43 ± 3.06	169.07 ± 2.78	178.12 ± 1.60	178.62 ± 1.61	179.95 ± 2.65
8th week	187.68 ± 3.37	167.30 ± 2.61	182.00 ± 0.98	182.70 ± 1.75	184.60 ± 2.36
10th week	193.05 ± 3.51	164.00 ± 2.34	186.25 ± 1.62	186.45 ± 1.79	189.45 ± 2.36
12th week	198.50 ± 3.19	160.72 ± 2.49	193.35 ± 1.64	194.50 ± 1.60	195.37 ± 2.71
14th week	206.88 ± 3.54	158.02 ± 2.64	199.97 ± 2.18	200.95 ± 1.75	203.42 ± 3.21
16th week	216.71 ± 3.26	154.80 ± 2.57	208.90 ± 2.38	210.20 ± 1.76	212.60 ± 2.63
18th week	226.00 ± 3.70	150.60 ± 2.19	218.65 ± 2.92	219.35 ± 2.20	222.15 ± 2.61
20th week	235.05 ± 3.71	145.47 ± 2.34	227.07 ± 2.74	228.60 ± 1.87	230.40 ± 2.737

Up to the fourth week of the experiment, no significant difference in mean body weight was observed among any of the groups. However, following 4 weeks of DMBA administration, a significant reduction in body weight was noted in the DMBA‐treated group compared to all other groups (Groups I, III, IV, and V) and persisted until the end of the experiment (Table 4). No significant differences were observed in the body weights of Groups III, IV, and V when compared with the control group (Group I) or among themselves. Although the differences among Groups III, IV, and V were not statistically significant, the mean body weight of Group V was found to be very close to that of the SHAM control group (Group I).

3.3. Incidence of Mammary Tumors

Upon physical examination of rats, Group I showed normal mammary glands (Figure 1a). In Group II (DMBA group), mammary tumors started to develop after 12 weeks of DMBA administration in 75% of rats, whereas the remaining 25% of rats developed tumors after 14 weeks of DMBA administration (Figure 1b). A total of nine tumors were developed in the DMBA group with an average of 1.50 tumors per animal. Four rats exhibited one tumor each, one rat carried two tumors, and the remaining one rat displayed three tumors. In most of the cases, tumors involved the cranial inguinal mammary gland (66.67%), followed by cervical (22.22%) and thoracic (11.11%) mammary gland. Tumor masses revealed oval to spherical shape with unilobular to multilobular (Figure 1c). In most of the cases, consistency of the tumorous mass was soft to hard, and the surrounding epidermis was intact except in three tumors where superficial to deep ulcerations were seen. On cutting the tumors, a yellowish‐white surface was seen in the majority of the cases. In addition to this, one tumorous mass had brown areas of necrosis with pus.

Figure 1.

Physical examination of mammary glands. a: Group I (SHAM) showing normal mammary gland. b: Group II (DMBA) showing tumors on different mammary glands. c: Group II (DMBA treated) showing multilobulated tumors involving the cervical mammary gland. d: Rats of Groups I, II, III, IV, and V, respectively, showing no tumorous growth on the mammary gland of Groups III, IV, and V, respectively, on visual examination. e: Small soft nodular structures on the mammary gland of Groups III, IV, and V, respectively, after sacrificing.

In Group‐III, IV and V no tumor was observed on visual examination till the end of experimental period (Figure 1d). However, after deskinning, all rats of Group‐III and IV showed small soft swelling of inguinal mammary gland which were not appreciable before sacrificing the animal whereas in Group V only 42.86% of rats (n = 3/7) showed similar changes (Figure 1e).

3.4. Haemato‐Biochemical Studies

DMBA group (Group‐II) showed a significant decrease in mean Hb, PCV, and TEC level as compared to Group‐I. Other treatment groups i.e., Group‐III, Group‐IV and Group‐V showed significantly lowered values of Hb, PCV and TEC as compared to Group‐II (Figure 2a‐c). Further, Groups III, IV, and V did not show any significant difference in comparison to each other and Group‐I.

Figure 2.

Hemato‐biochemical analysis of all the experimental groups. a: Hemoglobin concentration (Hb). b: Packed cell volume percentage (PCV). c: Total Erythrocyte Count (TEC). d: Total Leukocyte Count (TLC). e: Relative Neutrophil count. f: Relative Lymphocyte Count. g: Serum Glucose level. h: Serum Total Protein Concentration. i: AST level. j: ALT level. k: ALKP level. l: BUN concentration. m: Creatinine level. The data are expressed as mean ± SE of all rats in each group. *p < 0.05(vs. SHAM group); **p < 0.05(vs. DMBA treated group).

The mean TLC and neutrophil count were significantly increased, and the mean lymphocyte count was significantly less in Group II when compared to Group I (Figure 2d‐f). The levels of these parameters in other treatment groups Group III, Group IV, and Group V showed significantly less values as compared to Group‐II. However, the levels of these parameters in the treatment groups (Groups III, IV, and V) did not differ significantly from Group I or from one another (Figure 2d‐f). With comparison to Group I, the values of all the hematological parameters were found to be more normal in Group‐V out of all the treatment groups (Groups III, IV, and V).

In serum analysis, the mean glucose level was found to be significantly higher, and the mean value of total protein was significantly lower in Group‐II when compared to Group‐I. However, treatment groups such as Group‐III, IV, and V revealed significantly lower values of mean glucose levels and significantly more values of total protein respectively in comparison to Group‐II and did not show any significant change when compared to each other and Group‐I (Figure 2g, 2h).

Further, the mean levels of AST, ALT, ALKP, BUN and creatinine showed significantly higher values in Group‐II as compared to Group‐I. The levels of these parameters were significantly less in treatment groups viz., Group‐III, Group‐IV, and Group‐V when compared with Group‐II respectively whereas non‐significantly changed from each other as well as from Group‐I (Figure 2i‐m).

3.5. Analysis of Oxidative Stress Parameters

The mean level of NO was found to be significantly high in Group II when compared with Group I. Further, the levels were significantly lowered in Group‐III, and IV, and Group V as compared to Group‐II, and did not show any significant difference as compared to Group‐I (Figure 3a). Further, the mean level of LPO was also found to be significantly high in Group II as compared to Group‐I. The levels were significantly lowered in Group‐III, Group‐IV, and Group‐V as compared to Group‐II; however, they did not show a significant change as compared to Group‐I (Figure 3b). Moreover, Groups II, III, and IV also showed significant change from each other. The anti‐oxidant enzymes such as CAT and SOD activity in Group II were found to be significantly less as compared to Group‐I respectively whereas in Group III, Group‐IV and Group‐V the activities of these antioxidants were significantly more as compared to Group‐II and did not show any significant change as compared to Group‐I. From each other, Groups III, IV, and V had not shown any significant change in the values of the CAT and SOD (Figure 3c, d). However, Group‐V showed more comparable levels of CAT and SOD to the SHAM group (Group‐I), suggesting the synergistic ameliorative effect of curcumin and baicalein as compared to their individual effects.

Figure 3.

Oxidative Stress Parameters in mammary gland tissue of all the experimental groups. a: Nitric oxide level. b: Lipid peroxidation level. c: Catalase activity. d: Superoxide dismutase activity. The data are expressed as mean ± SE of all rats in each group. *p < 0.05(vs. SHAM group); **p < 0.05(vs. DMBA treated group).

3.6. Pro‐Inflammatory Cytokine Analysis

In the present study, Interleukin‐1 (IL‐1), Tumor necrosis factor‐alpha (TNF‐α), and Interleukin‐6 (IL‐6) levels were significantly high in the Group‐II as compared to Group‐I. Further, the levels of these cytokines were significantly lowered in Group‐III, Group‐IV, and Group‐V as compared to Group‐II and did not show any significant change from each other and from Group‐I (Figure 4a‐c).

Figure 4.

Level of Pro‐inflammatory cytokines in mammary gland tissue of all the experimental groups. a: IL‐1level. b: TNF‐αlevel. c: IL‐6level. The data are expressed as mean ± SE of all rats in each group. *p < 0.05(vs. SHAM group); **p < 0.05(vs. DMBA treated group).

3.7. Histopathological Analysis of the Mammary Gland

On microscopic examination, Group I (SHAM) displayed normal architecture of mammary glands, i.e., a typical ductal epithelial lining was externally surrounded by a layer of myoepithelial cells, which were further surrounded by a massive number of adipocytes/fatty tissue and supported by a small amount of fibrous connective tissue (Figure 5a).

Figure 5.

Histopathological examination of mammary glands of different experimental groups. a: Group I (SHAM) displayed normal architecture, having tubules surrounded by massive fatty tissue with a small amount of fibrous connective tissue, H&E, Bar = 100μm. b: Group II (DMBA) displayed Complex carcinoma showing proliferation of epithelial cells in the form of cords (yellow arrow) and elongated myoepithelial cells in reticulate form (Black arrow), H&E, Bar = 50μm. c: Group II (DMBA) showing Malignant myoepithelioma showing oval to spindle‐shaped cells in a reticulate pattern with a moderate amount of eosinophilic cytoplasm and poorly defined cell borders, H&E, Bar = 100μm. d: Group II (DMBA) displayed Papillary carcinoma showing proliferation of epithelial cells in the form of papillary projections with minimal stroma, H&E, Bar = 50μm. e: Group III (DMBA + CUR) displayed dilatation of ducts with a cluster of dead tiny cells in their lumen (arrow), suggesting a stage of cell death, H&E, Bar = 50μm. f: Group‐III displayed hyperplastic change with increased cellularity of epithelial cells and number of small ducts surrounding fatty tissue, H&E, Bar = 200μm. g: Group III (DMBA + CUR) displayed dilated ducts (arrow) with accumulation of secretory material and decreased amount of surrounding connective tissue, suggesting dysplastic change, H&E, Bar = 50μm. h: Group IV (DMBA + BAIC) displayed stage of cell death H&E, Bar = 20μm. i: Group‐IV displayed hyperplastic change H&E, Bar = 100μm. j: Group‐IV displayed dysplastic change H&E, Bar = 50μm. k: Group‐V displayed mild dilatation of ducts surrounding adipose tissue, H&E, Bar = 50μm. l: Group‐V displayed normal architecture of mammary gland, Bar = 50μm.

Group II (DMBA‐treated) revealed two cases of complex carcinoma, two cases of malignant myoepithelioma, and two cases of simple carcinoma. The rats bearing more than one tumor in different mammary glands were found to be of the same type histologically. Complex carcinoma revealed neoplastic proliferation of both epithelial and myoepithelial cells in various patterns, viz., tubulo‐acinar, papillary, cribiform, and solid pattern (Figure 5b). Neoplastic cells showed nuclear pleomorphism, prominent nucleoli, coarse chromatin, and numerous mitotic figures. At some places, necrosis (inside the lumen of tubules), haemorrhages, and mononuclear cell infiltration were also observed. Further, malignant myoepithelioma showed neoplastic proliferation of only myoepithelial cells, varied from oval to spindle shape (Figure 5c). Myoepithelial cells were arranged in a solid pattern with eosinophilic cytoplasm in moderate amounts, with poorly defined cell borders. The round to fusiform nucleus of these cells was arranged in the centre and had one or more prominent nucleoli along with fine stippling of chromatin. Variation in the size of cells and nuclei was fully appreciated with a variable number of mitotic figures. Simple carcinomawas characterized by neoplastic proliferation of only epithelial cells in the form of numerous papillary projections with a thin fibrovascular core (Figure 5d). Mitotic figures were frequently observed in this tumor.

Group III (DMBA + CUR) showed only early changes of tumor development, i.e., stage of cell death, hyperplasia, and dysplasia, along with normal architecture of the mammary gland in some areas. The stage of cell death showed moderately dilated ducts with clusters of tiny cells in their lumens. These free luminal cells exhibited tiny hyperchromatic nuclei and eosinophilic cytoplasm (Figure 5e). Hyperplastic changes showed proliferation of cells that formed numerous terminal ducts (Figure 5f). Mononuclear cell infiltration was also observed in a few places. In addition to this, some areas showed dysplastic change, i.e., increased dilated ducts with the decrease in surrounding connective tissue and prominent nucleoli in epithelial cells (Figure 5g). One case showed mixed morphological changes, i.e., stage of cell death along with hyperplasia and dysplastic changes. In these cases, the massive amount of fatty tissue was also found same as in the normal mammary gland.

Group IV (DMBA + BAIC) showed similar morphological changes of tumor development in different proportions in all the rats (Figure 5h‐j). Further, Group V (DMBA + CUR + BAIC) revealed a stage of cell death in only one rat and hyperplasia in another rat. Two rats revealed mild dilation of ducts surrounding connective tissue with abundant adipose tissue, which was considered normal (Figure 4k). In the remaining rats, the mammary gland displayed normal architecture (Figure 4l).

Group‐II cancerous lesions encompassed the entire tissue section, as the samples were collected from the visibly enlarged mammary growth. In contrast, no neoplastic cell proliferation was observed in the tissues of the other groups, and hence, no area was covered by affected lesions.

3.8. Immunohistochemical Analysis to Study EMT

3.8.1. Immunoreactivity of E‐Cadherin

In the present study, E‐cadherin immunoreactivity was expressed by the membranes of all normal epithelial cells of the mammary glands of Group I (Figure 6a). In contrast, mammary tumors of Group II (DMBA group) revealed immunoreactivity of E‐cadherin by neoplastic epithelial cells in two different patterns, viz., preserved (Pr) and reduced (Rd) (Figure 6b, c). Among two cases of simple carcinoma, one case showed preserved (> 75% neoplastic cells) and another case showed reduced (< 75% neoplastic cells) immunoreactivity of E‐cadherin. In two cases of complex carcinoma, one case showed preserved and another case showed reduced immunoreactivity of e‐cadherin by neoplastic epithelial cells, whereas in two cases of myoepithelial carcinoma, no immunoreactivity of e‐cadherin was observed. Group‐III, IV, and V revealed only a positive expression of E‐cadherin by all epithelial cells, similar to Group‐I (Figure 6d, e).

Figure 6.

Immunohistochemical analysis of EMT markers. a: Group I mammary gland showing preserved E‐cadherin immunoreactivity by epithelial cells of acini, IHC, Bar = 20 µm. b: Simple carcinoma of Group II showing preserved E‐cadherin immunoreactivity by epithelial cells, IHC, Bar = 20 µm. c: Complex carcinoma of Group II showing reduced E‐cadherin immunoreactivity by epithelial cells, IHC, Bar = 50 µm. d: Group III mammary gland showing preserved E‐cadherin immunoreactivity by epithelial cells, IHC, Bar = 50 µm. e: Group V mammary gland showing preserved E‐cadherin immunoreactivity by epithelial cells, IHC, Bar = 20 µm. f: Group I mammary gland showing normal vimentin immunoreactivity by fibroblasts and adipocytes of interstitial tissue between the acini, IHC, Bar = 50 µm. g: Carcinoma of Group II showing ++ vimentin immunoreactivity (> 10% to < 50% epithelial like cells immunopositive with vimentin) showing epithelial mesenchymal transition, IHC, Bar = 20 µm. h: Group IV mammary gland showing normal vimentin immunoreactivity by interstitial connective tissue only, IHC, Bar = 50 µm. i: Group III showing α‐smooth muscle immunoreactivity to normal myoepithelial cells (arrow) surrounding epithelial cells of acini, IHC, Bar = 50 µm. j: Group IV mammary gland showing α‐smooth muscle immunoreactivity to normal myoepithelial cells and smooth muscle fibers of blood vessels (arrow), IHC, Bar = 20 µm. k: Complex carcinoma of Group II showing α‐smooth muscle immunoreactivity to proliferated neoplastic myoepithelial cells (white arrow) and myofibroblasts (black arrow), IHC, Bar = 50 µm.

3.8.2. Immunoreactivity of Vimentin

Immunoreactivity of vimentin was mainly seen around endothelial cells of blood vessels and fibroblasts of interstitial tissue, i.e., intralobular or periductal stromal cells of Group‐I mammary gland that was considered normal (Figure 6f). However, in Group II (DMBA‐treated), immunoreactivity of vimentin was also observed in the epithelial like cells of the tubule suggesting these cells had lost the epithelial characteristics undergone epithelial to mesenchymal transition. In cases of simple carcinoma and malignant myoepithelioma, immunoreactivity of vimentin was +1 because only a few countable epithelial‐like cells showed immunoreactivity (Figure 6g). In case of complex carcinoma, many epithelial‐like cells within the solid and cribiform pattern of carcinoma showed immunopositivity with vimentin, so graded as ++ (Figure 6h). Further, in Groups III, IV and V, reactivity of vimentin was found to be similar with Group‐I and no epithelial cell was found to be immunopositive with vimentin suggesting no epithelial to mesenchymal transition (Figure 6i).

3.8.3. Immunoreactivity of α‐smooth Muscle Actin

Immunoreactivity of α‐smooth actin was observed in the myoepithelial cells and smooth muscle fibers of the endothelial wall of mammary glands of all the groups (Figure 6j, k), which is considered normal. However, in addition to this, Group‐II also showed immunoreactivity of α‐smooth muscle by smooth muscle fibers (myofibroblasts) in the interstitial connective tissue along with myoepithelial cells and smooth muscle fibers of the endothelial wall (Figure 6l). Simple carcinoma and myoepithelioma showed + to ++ immunoreactivity of α‐smooth muscle actin, complex carcinoma showed ++ to +++ immunoreactivity.

3.9. Relative Expression of mRNA of Epithelial and Mesenchymal Proteins in the Mammary Tissue of Experimental Groups

The PCR reaction using specific primers for the epithelial and mesenchymal proteins and an endogenous control ( β ‐actin) was shown in the amplification curve (Figure 7a). The melting temperature of the PCR product of each protein and β ‐actin, as shown in the melt curve, was 84°C for e‐cadherin, 78.5°C for vimentin, 80.5°C for α‐smooth actin, and 85°C for β ‐actin (Figure 7b).

Figure 7.

Analysis of e‐cadherin, vimentin, α‐smooth muscle actin, and β‐actin by real‐time PCR. a: Amplification curve of e‐cadherin, an epithelial marker. b: Amplification curve of α‐smooth muscle actin, a mesenchymal marker. c: Amplification curve of vimentin, a mesenchymal marker. d: Amplification curve of β‐actin. e: Melting curve of e‐cadherin. f: Melting curve of α‐smooth muscle actin. g: Melting curve of vimentin. h: Melting curve of β‐actin. i: Fold changes in mRNA expression of e‐cadherin, vimentin, and α‐smooth muscle actin in different experimental groups.

Further, fold changes in mRNA expression of epithelial and mesenchymal proteins of all experimental groups is depicted in Figure 7c. Group‐II showed significantly high values of E‐cadherin (676.77 ± 92.17), Vimentin (960.78 ± 226.09), and α‐smooth muscle actin (1050.78 ± 334.59) as compared to Group‐I (1 ± 0, 1 ± 0, 1 ± 0). However, the values were significantly less in the treatment groups i.e., Groups III (51.68 ± 7.07, 34.19 ± 5.59 and 10.39 ± 2.88), Group‐IV (44.57 ± 20.37, 27.90 ± 3.86 and 9.82 ± 2.55) and Group‐V (16.80 ± 10.82, 15.86 ± 10.30 and 6.03 ± 2.16) as compared to Group‐II and did not show any significant change as compared to Group‐I. Further, the expression of all the proteins in the Group‐V was found to be very close to the SHAM group as compared to other treatment groups (Group‐III and IV), suggesting the best group for amelioration against the effects of DMBA on the mammary glands of rats.

4. Discussions

The present study was designed to evaluate the chemopreventive potential of two bioactive phytocompounds, curcumin and baicalein, individually and in combination, against mammary tumorigenesis in a well‐established DMBA‐induced rat model. Tumor development was assessed through a comprehensive evaluation of tumor incidence, body weight changes, hematological and biochemical parameters, inflammatory cytokines, oxidative stress indices, histopathology, and molecular as well as immunohistochemical analysis of epithelial–mesenchymal transition (EMT) markers. The most common occupational carcinogen, DMBA, was administered by injecting a single dose at 80 mg/kg BW intraperitoneally to all experimental groups except the SHAM control group (Group I). However, mammary tumors developed exclusively in the DMBA‐only group (Group II) that might be attributed to its metabolic activation by cytochrome P450 enzymes into DMBA‐3,4‐diol‐1,2‐epoxide (DMBA‐DE), which forms DNA adducts and initiates malignant transformation [16, 30]. In contrast, no visible tumor growth was observed in rats treated with curcumin, baicalein, or their combination (Groups III, IV, and V), clearly demonstrating their protective, chemopreventive efficacy.

To evaluate inflammation along the cancer axis, key pro‐inflammatory cytokines such as IL‐1, IL‐6, and TNF‐αwere assessed, as these mediators play pivotal roles in tumor initiation and progression [31]. TNF‐α is a central regulator of inflammatory responses and has been implicated in promoting mammary carcinogenesis [32]. IL‐6 contributes to multiple stages of carcinogenesis, including cellular proliferation, survival, and metastatic progression, whereas IL‐1β has been associated with tumor invasion, angiogenesis, and modulation of apoptosis [33, 34]. In the present study, DMBA‐challenged rats exhibited significantly elevated levels of IL‐1, IL‐6, and TNF‐α, indicating that DMBA induces a strong inflammatory microenvironment, likely mediated by its reactive metabolites generated during metabolic activation [35]. In contrast, treatment with curcumin and baicalein significantly normalized the levels of these cytokines, demonstrating their potent anti‐inflammatory properties. This suggests that the phytocompounds either attenuated DMBA‐induced inflammatory signalling or prevented the establishment of a pro‐tumorigenic inflammatory milieu. Notably, the combination‐treated group showed greater suppression of cytokine levels compared to either agent alone, indicating a synergistic anti‐inflammatory effect. This enhanced cytokine modulation likely contributed to the observed inhibition of tumor development and EMT activation.

Further, the alterations in pro‐inflammatory cytokines were closely associated with the observed changes in body weight. A significant decline in mean body weight of the DMBA‐treated group, consistent with various previous reports, could be attributed to elevated levels of tumor and host‐derived pro‐inflammatory cytokines such as TNF‐α and IL‐6, which are well‐known mediators of cancer‐related cachexia and promote metabolic dysregulation and energy imbalances [16, 36, 37]. Persistent inflammatory signalling thus contributes to progressive body weight decline during tumor development. Conversely, animals treated with curcumin and baicalein showed improved body weight trends, likely due to their anti‐inflammatory effects, as evidenced by significantly reduced levels ofIL‐1, IL‐6, and TNF‐α. Notably, the combination‐treated group exhibited body weights closest to those of the SHAM group, indicating a synergistic protective effect.

Tumor initiation and progression are strongly influenced by the excessive generation of free radicals, including reactive oxygen species (ROS) and reactive nitrogen species (RNS) [38]. Elevated levels of ROS and RNS can cause extensive cellular damage by interacting with polyunsaturated fatty acids (PUFAs), proteins, and nucleic acids, leading to lipid peroxidation and the formation of malondialdehyde (MDA), a well‐recognized biomarker of oxidative stress and an important indicator of redox imbalance in cancer [39]. In the present study, a significant increase in free radical levels and lipid peroxidation (LPO) was observed exclusively in the DMBA‐treated group, likely due to the generation of reactive metabolites during DMBA metabolism [16, 40]. The elevated nitrite levels may be attributed to increased nitric oxide production and its subsequent oxidation by nitric oxide synthase in epithelial and immune cells during carcinogenesis [41]. Furthermore, levels of SOD and CAT were evaluated, which are vital antioxidant defence enzymes [42]. We observed that these enzymes were significantly reduced in the DMBA group only, possibly due to their excessive utilization in combating the heightened oxidative stress of reactive metabolites of DMBA. In contrast, treatment with curcumin and baicalein significantly decreased nitrite and LPO levels while restoring CAT and SOD activities, demonstrating their potent antioxidant properties. These findings are consistent with previous reports highlighting the redox‐modulating effects of these phytocompounds [41].

Complete blood count in cancer reveals the status of cellular immunity of an animal. haemoglobin percentage, packed cell volume, and total erythrocyte count are markers of anemia [43]. In the present study, anemia markers were significantly decreased in the DMBA group, suggesting DMBA induced anemia. This hematological alteration can be directly correlated with the elevated pro‐inflammatory cytokines (TNF‐α, IL‐1β, and IL‐6) observed in the same group. These cytokines are known to promote iron sequestration, suppress erythropoietin production, and shorten erythrocyte lifespan, thereby contributing to anemia [44]. Additionally, the heightened oxidative stress demonstrated by increased lipid peroxidation (MDA), elevated nitrite levels, and reduced antioxidant enzymes (SOD and CAT) may have further aggravated erythrocyte damage. Reactive metabolites generated during DMBA metabolism can induce oxidative injury to erythrocyte membranes and proteins, leading to hemolysis and reduced red blood cell survival [44]. Thus, the observed anemia in the DMBA group appears to be a combined consequence of chronic inflammation and oxidative stress. Treatment with curcumin and baicalein significantly prevented the decline in these erythrocytic parameters, which may be attributed to their demonstrated antioxidant and anti‐inflammatory effects. By reducing cytokine levels and restoring antioxidant enzyme activity, these phytocompounds likely protected erythrocyte integrity and improved hematopoietic balance. Previous studies have similarly reported the protective role of curcumin against DMBA‐induced, particularly through inhibition of iron‐catalyzed lipid peroxidation and reduction of erythrocyte hemolysis [45]. Furthermore, total leukocyte count (TLC) and neutrophil count were significantly elevated in the DMBA group, reflecting systemic inflammation and oxidative stress. Increased leukocytosis may be associated with enhanced free radical production and lipid peroxidation during DMBA metabolism, consistent with the elevated cytokine and oxidative stress markers observed in this group [46]. Administration of curcumin and baicalein significantly attenuated these increases, further confirming their anti‐inflammatory and redox‐modulating properties. Notably, TLC values were more effectively normalized in the combination‐treated group, followed by the baicalein group, compared to the curcumin group alone. This trend aligns with the superior oxidative stress profile observed in the baicalein group and supports a synergistic interaction between the two phytocompounds in mitigating inflammation and oxidative damage.

Serum biochemical parameters serve as important indicators of organ function and systemic metabolic status during carcinogenesis [47]. It also assesses the individual organ health and ability to perform properly during chemotherapy [48]. In the present study, liver function markers (AST, ALT, and ALP), renal function markers (BUN and creatinine), serum glucose, and total protein levels were evaluated to assess the systemic impact of DMBA and the protective effects of curcumin and baicalein. The DMBA‐challenged group exhibited significantly elevated levels of AST, ALT, and ALP, indicating hepatocellular injury and compromised liver function [49]. These alterations may be attributed to the toxic metabolites generated during DMBA metabolism, which induce oxidative stress and inflammatory responses within hepatic tissues. The previously observed increase in pro‐inflammatory cytokines (IL‐1, IL‐6, TNF‐α) and oxidative stress markers (MDA, nitrites) in this group further supports the involvement of redox imbalance and chronic inflammation in DMBA‐induced liver damage. Similar biochemical disturbances have been reported in earlier studies using the DMBA mammary tumor model [50]. In contrast, treatment with curcumin and baicalein significantly restored these enzyme levels toward normal, suggesting a hepatoprotective effect. This protective action may be attributed to their demonstrated ability to reduce inflammatory cytokines, decrease nitric oxide generation, and enhance antioxidant enzyme activities (SOD and CAT), thereby mitigating oxidative injury to hepatic cells [51, 52]. By modulating these interconnected inflammatory and redox pathways, the phytocompounds likely either prevented DMBA‐induced hepatic damage or facilitated functional recovery of affected tissues.

A significant elevation in serum glucose levels was observed in the DMBA‐treated group. This hyperglycaemia may be attributed to DMBA‐induced pancreatic damage resulting from oxidative stress and inflammatory injury of reactive metabolites generated during DMBA metabolism, which may impair pancreatic β‐cell function, thereby disrupting insulin regulation and glucose homeostasis [53]. Additionally, increased serum glucose levels may reflect the heightened metabolic demands of rapidly proliferating neoplastic cells. Cancer cells are known to exhibit enhanced glucose uptake and glycolytic activity (Warburg effect) to sustain rapid growth and survival [54, 55]. Therefore, the elevated glucose concentration in the DMBA group likely represents both metabolic dysregulation and tumor‐associated energy requirements. In contrast, curcumin‐ and baicalein‐treated groups showed significantly lower serum glucose levels compared to the DMBA‐only group. This normalization may be attributed to their antioxidant and anti‐inflammatory properties, which likely protected pancreatic tissue from oxidative injury and restored metabolic balance. Moreover, the absence of tumor formation in these groups eliminated the increased metabolic demand associated with neoplastic proliferation.

The kidneys play a crucial role in maintaining systemic homeostasis by eliminating metabolic waste products and toxic substances [56]. In the present study, significantly elevated levels of blood urea nitrogen (BUN) and creatinine were observed in the DMBA‐treated group, indicating renal toxicity and impaired kidney function that may be attributed to oxidative stress and inflammatory injury induced by reactive DMBA metabolites [57]. In contrast, treatment with curcumin and baicalein significantly reduced BUN and creatinine levels compared to the DMBA‐only group, suggesting a renal protective effect. This protection is likely mediated through their antioxidant and anti‐inflammatory properties, which mitigate oxidative injury, suppress cytokine overproduction, and preserve renal cellular integrity [57, 58]. Furthermore, DMBA intoxication resulted in a significant reduction in serum total protein levels. This decline may be attributed to oxidative damage to proteins, hepatic and renal inflammation, impaired protein synthesis, altered metabolic activity, and increased protein oxidation [59]. Since the liver is the primary site of plasma protein synthesis, the elevated hepatic enzymes (AST, ALT, and ALP) observed in the DMBA group suggest compromised liver function, which likely contributed to decreased protein production [60]. Additionally, renal dysfunction, as evidenced by increased BUN and creatinine levels, may have further aggravated protein imbalance through altered filtration and metabolic disturbances [61]. In contrast, treatment with curcumin and baicalein restored serum total protein levels toward normal values. This improvement correlates with the normalization of hepatic and renal biomarkers observed in the treated groups. By attenuating oxidative stress and suppressing inflammatory cytokines, these phytocompounds likely preserved hepatocellular integrity and renal function, thereby maintaining normal protein synthesis and metabolic homeostasis.

Furthermore, the combined administration of curcumin and baicalein produced biochemical parameters, including liver enzymes, renal markers, glucose, and total protein levels close to those of the SHAM control group, indicating a strong synergistic protective effect. This enhanced efficacy correlates with the superior antioxidant and anti‐inflammatory profile observed in the combination group, suggesting that simultaneous targeting of oxidative stress, inflammatory pathways, and metabolic dysregulation provides greater organ protection and maintenance of systemic homeostasis than individual therapy.

On gross examination, tumors were only observed in the DMBA‐treated group and further confirmed by histopathological examination. No overt tumors were detected in the curcumin and baicalein‐treated groups; however, early preneoplastic alterations were found on histopathological examination that warranted further molecular investigation. Moreover, to understand the type‐III epithelial‐mesenchymal transition, semi‐quantitative immunohistochemistry and quantitative qRT‐PCR analyses of e‐cadherin (epithelial marker) and mesenchymal markers (vimentin and α‐smooth muscle actin) were performed. Type‐III EMT is described as the transition from epithelial organisation to mesenchymal properties, either morphologically or molecularly, in cancer [62].

E‐cadherin and Vimentin have opposing but connected functions in Type‐III EMT. Downregulating e‐cadherin, a transmembrane adhesion protein that preserves intercellular adherence and polarity of epithelial cell which, is a crucial step in promoting tumor cell detachment and its movement. On the other hand, vimentin, which is an intermediate filament protein, serves as a characteristic marker of mesenchymal differentiation that encourages cytoskeletal remodelling, enhanced motility, and the capacity of altered epithelial cells to invade [63]. In the present study, the DMBA‐treated group (Group II) revealed variable immunoreactivity of E‐cadherin, where some tumors showed strong expression while others revealed reduced immunoreactivity. The preserved E‐cadherin immunoreactivity by neoplastic epithelial cells could indicate that they have not yet undergone EMT, whereas the areas with reduced expression of E‐cadherin suggest cells that have started to lose epithelial characteristics and acquire mesenchymal properties [64]. This transition was further confirmed by positive vimentin immunoreactivity in epithelial‐like cells that lost E‐cadherin, indicating a partial EMT state. It described the transition of epithelial organisation of cells to mesenchymal organisation that involves the gain of vimentin by the neoplastic epithelial cells that had lost their E‐cadherin, suggesting Type‐III EMT [63, 64].

Furthermore, the expression of α‐smooth muscle actin (α‐SMA) by myofibroblasts within tumor stroma was taken into consideration that had also increased in Group‐II only. These myofibroblasts contribute significantly to the advancement of tumors by creating a favourable environment to tumor progression and metastasis, i.e., by altering the extracellular matrix (ECM), modifying the epithelial‐to‐mesenchymal transition (EMT) in cancer cells, and secreting growth factors that promote cancer cells' proliferation, invasion, and migration. This is thought to be mostly accomplished by communicating between tumor‐associated myofibroblasts, cancer cells, and extracellular matrix (ECM) [65, 66]. These IHC findings related to the expression of e‐cadherin, vimentin, and α‐smooth muscle actin were not observed in Groups III, IV, and V, which received curcumin, baicalein, or their combination, as no tumors developed in these groups, demonstrating the ameliorative effects of these compounds in preventing tumor formation and EMT.

The observed protein‐level changes were molecularly confirmed by quantitative measurement of these proteins' mRNA expression using RT‐PCR, which further supported the immunohistochemistry findings. Both IHC and RT‐PCR showed a coordinated elevation of EMT‐related markers in the DMBA‐treated group (Group II) only. E‐cadherin expression is typically expected to decrease during epithelial–mesenchymal transition (EMT). However, in the present study, quantitative analysis revealed an increased E‐cadherin expression in Group II, which can be attributed to the active proliferation of neoplastic epithelial cells observed exclusively in this group, as no other group developed tumors. Therefore, the elevated E‐cadherin levels in Group II reflect tumor‐associated epithelial proliferation rather than EMT. Further, the reduction in E‐cadherin expression by neoplastic epithelial cells was evident in immunohistochemical observations, indicative of EMT. Vimentin expression was found to be elevated at the mRNA level, which can be attributed to the presence of proliferating endothelial cells within the tumor vasculature, activated stromal fibroblasts, and epithelial cells undergoing partial EMT in Group‐II. This finding was further supported by vimentin‐positive immunostaining observed in these cellular populations. Additionally, there was an increase in α‐smooth muscle actin (α‐SMA), which correlates to immunoreactivity in stromal myofibroblasts that support tumor growth and extracellular matrix remodelling [66].

In contrast, Groups III, IV, and V (treated with curcumin, baicalein, or their combination, respectively) exhibited no tumor development, minimal or absent immunoreactivity, and no significant alterations in mRNA expression of any of the evaluated markers as compared to the SHAM group (Group‐I). These findings suggest that the treatment compounds effectively inhibited epithelial proliferation and EMT‐associated molecular activation. The results further demonstrate a strong concordance between protein‐level (IHC) and transcriptional (RT‐PCR) data, confirming that while DMBA induces EMT and stromal activation, curcumin and baicalein suppress these processes at both the molecular and cellular levels. When compared with the SHAM group, the combination‐treated group exhibited marker levels that were closer to normal than those observed in the groups treated with curcumin or baicalein alone. This finding demonstrates the synergistic effect of the combined treatment in suppressing tumor formation and the subsequent type III EMT, as compared to the individual treatments.

Quantitative analysis of mRNA expression of EMT‐markers using RT‐PCR offered molecular validation of the protein‐level alterations seen by IHC [67]. This method strengthened our understanding by detecting transcriptional activation linked to EMT by a carcinogen DMBA and further validated that herbal drugs, viz., curcumin and baicalein, modulate the tumor‐inducing pathways of DMBA and prevent the induction of tumors, which complemented the qualitative information from IHC.

The present study demonstrated that both curcumin and baicalein exert significant anti‐tumor effects, primarily attributable to their antioxidant and anti‐inflammatory properties. Comparative evaluation revealed that combined administration of curcumin and baicalein produced a synergistic effect, resulting in superior chemopreventive efficacy compared to either compound alone. These findings suggest that the two phytocompounds may act through complementary molecular pathways to reduce oxidative stress, inflammatory signalling, and interfere with the fundamental cellular events required for neoplastic transformation. So, their combined use may contribute to improved overall health status, reduced tumor incidence, and enhanced longevity. Collectively, this study provides experimental evidence supporting the chemopreventive potential of curcumin and baicalein, particularly in combination, and highlights their relevance not only in human cancer biology but also in the broader context of Veterinary oncology.

Author Contributions

Priyanka Syal: writing – original draft, visualization, supervision, data curation, formal analysis, investigation, methodology. Nittin Dev Singh: conceptualization, investigation, methodology, project administration, supervision, resources. Geeta Devi Leishangthem: software, visualization, conceptualization. Harmanjit Singh Banga: writing – review and editing, validation, supervision, visualization.

Conflicts of Interest

The authors declare no conflicts of interest.

Data Availability Statement

The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.