A Preliminary Study on Evaluating Reparative Regeneration Potential of Human Amniotic Fluid Stem Cells Spheres in Stress Urinary Incontinence Rats

Abstract

Recent reports indicate that stem cell spheres might offer enhanced therapeutic benefits by promoting cell engraftment ability, stemness, angiogenesis, and chemotaxis. Hence, we investigated whether amniotic fluid stem cells (AFSC) spheres could provide therapeutic benefits in stress urinary incontinence (SUI) due to their urethral sphincter-specific commitment. The isolated human AFSCs were characterized by flow-cytometry-based immunophenotyping and their multidifferentiation potential (osteo-, adipo-, and chondrogenic lineages). Time-dependent (>12, 16∼20, and 48 hours) culture conditions for AFSCsphere formation were optimized. Urodynamic parameters, including leak point pressure (LPP) and intercontraction interval (ICI), were determined. hAFSCsphere with ∼150 μm diameter with minimal core necrosis at 16∼20 hours was found optimal for therapeutic application in the pudendal nerve injury-induced SUI rat model. The AFSCs demonstrated mesenchymal stem cell characteristics and multi-differentiation capabilities with retained levels of pluripotency and neural progenitor markers, SOX2 and nestin, respectively. Compared to AFSC, the AFSCsphere group showed superior LPP and ICI in rats; however, with either modest, relatively low, or unchanged levels of myogenic-lineage genes (myf5, myoD, myogenin, and desmin) between them. Bladder and external urethral sphincter histologic architecture were also improved. Notably, AFSCsphere showed the elevated levels of secretome (VEGF, IL-6, IL-8, IL-9, and MIP-1β) than AFSC, when compared to control. This could be attributed to non-myogenic pathways, such as paracrine dominance, including anti-inflammatory, angiogenic, or neurotrophic. Conclusively, our study revealed that AFSCsphere may improve urodynamics despite a significant increase in myogenic regulatory factor expression. Therefore, future studies should quantify AFSCsphere-specific properties, like stemness and cell-cell interactions, in reaching enhanced therapeutic outcomes.

Introduction

Stress urinary incontinence (SUI), especially prevalent in women, involves involuntary urine leakage during activities that elevate intra-abdominal pressure, often due to weakened pelvic floor muscles or urethral support loss from factors like childbirth, obesity, menopause, or surgery (1). Although it affects millions and significantly reduces quality of life, it is often underreported and undertreated. Management begins with clinical evaluation and may include conservative approaches such as pelvic floor exercises, bladder training, and lifestyle changes or surgical options like slings or artificial sphincters for cases unresponsive to non-invasive treatments, often yielding substantial symptom improvement (1). Recent research has evidenced that tissue engineering and regenerative intervention using stem cells derived from bone marrow, muscle, or adipose tissues could offer significant benefits for various disorders (2). However, the invasive procedure, reduced yield, and reduced differentiation potential associated with harvesting these stem cells limit their widespread application.

Amniotic fluid (AF) is a dynamic, nutrient-rich biological fluid that forms around day 12 of gestation and plays vital roles in fetal development by providing mechanical protection, antimicrobial defense, and nourishment (3). Initially derived from maternal plasma, AF composition transitions to include fetal urine, pulmonary secretions, and trans-/intramembranous exchanges as pregnancy progresses (3). AF also contains growth factors that promote cell proliferation and differentiation, enabling transdifferentiation of retinal pigment epithelial cells into retinal progenitors, ganglion cells, and rod photoreceptors, thus highlighting the regenerative potential of AF-derived stem cells (AFSCs) (3, 4).

However, the AFSCs are an underutilized cell source for research and clinical use. While sharing key features with somatic stem cells from bone marrow, adipose tissue, placenta, and umbilical cord, their embryonic origin provides advantages such as greater multipotency, tissue-specific gene expression, and clonal expansion capacity (5). These properties make AFSCs highly valuable for tissue engineering, developmental research, and regenerative medicine, including applications in patient-specific iPSC generation and organoid development, offering potential. Notably, some of the previous studies have attempted to synthesize different stem cell spheres to achieve an enhanced therapeutic efficacy. In a study, the transplantation of cord blood mesenchymal stem cells (MSCs) as spheroids enhances vascularization (6). Human cardiac stem cell spheroids were intramyocardially delivered and revealed enhanced cell engraftment ability and cardiomyogenic potential for myocardial infarct repair (7). Adipose-derived stem cells’ short-term spheroid formation has also enhanced regenerative potential by promoting stemness, angiogenesis, and chemotaxis (8).

These studies indicate that the 3-dimensional structure of spheres eliminates the need for external support materials or cytokines, offering a scalable and efficient approach. Furthermore, stem cell spheres offer a scalable and efficient method for expanding progenitor cells without the need for genetic modification or cell sorting (9). The cell microenvironment significantly influences behaviors such as proliferation, differentiation, and apoptosis, enabling potential cell reprogramming (10). These scaffold-free spheres are closely linked to stemness and may facilitate the generation of neural progenitor-like cells. Therefore, we developed amniotic fluid stem cell spheres (AFSCspheres) and investigated their therapeutic effects in the pudendal nerve injury model of SUI rats.

Materials and Methods

The study protocol was approved by the institutional review board (IRB) of Cathay General Hospital (No. CGS-CS105001). Written informed consent was obtained from all participants. The animal studies were performed after receiving approval from the Institutional Animal Care and Use Committee (IACUC) in Taipei Veterans General Hospital (IACUC approval No. IACUC-2016-221) and Taipei Medical University (IACUC approval No. LAC2025-0076). The flowchart of the overall study is represented in Fig. 1.

Fig. 1.

The overall schematic of the study. AFSC: amniotic fluid stem cells, SUI: stress urine incontinence, LPP: leak point pressure, ICI: intercontraction interval, EUS: external urethral sphincter, VEGF: vascular endothelial growth factor, IL-6: interleukin-6, IL-8: interleukin-8, IL-9: interleukin-9, MIP-1β: macrophage inflammatory protein-1 beta. Created in BioRender. Dubey N (2025), https://BioRender.com/2lu96yl.

Harvesting and processing of amniotic fluid

AF was obtained during routine amniocentesis at 16∼20 weeks of gestation from eligible donors at Cathay General Hospital, Taipei, Taiwan, with written informed consent and institutional ethics approval. Donor eligibility was determined according to Taiwan FDA guidelines, excluding infectious diseases (hepatitis B virus, hepatitis C virus, human immunodeficiency virus, human T-cell lymphotropic virus type I and II, syphilis). AFSCs were subsequently isolated and cultured in compliance with Good Tissue Practice (GTP) regulations.

Amniotic fluid stem cells (AFSCs): isolation and characterization

In this study, human AFSCs (hAFSCs) and hAFSCsphere were provided by U-Neuron Biomedical, Inc. and processed in a GTP-compliant facility at the cell processing center of Bioresource Collection and Research Center (BCRC). The culture conditions and characterization protocols were followed as described in a previous study (11). Briefly, the hAFSCs were cultured in a commercial serum-free, chemically defined MSC medium at 37℃ in a humidified 5% CO₂ incubator. Phycoerythrin (PE)- or fluorescein isothiocyanate (FITC)-conjugated mouse anti-human monoclonal antibodies targeting CD44, CD73, CD90, CD105, and HLA-ABC, CD11b, CD19, CD31, CD45, HLA-DR, nestin, and SOX2, along with appropriate isotype controls, were used for this analysis. The cells were incubated with varying concentrations of primary or isotype control antibodies at 4℃ for 30∼60 minutes, followed by flow cytometric analysis (Becton Dickinson FACS Calibur) employing a FACSCalibur instrument, and the data were processed using CellQuest software (Becton Dickinson). All antibodies were procured from BD Pharmingen. Later, the multi-differentiation potential, i.e. adipogenic, osteogenic, and chondrogenic differentiation of AFSCs was evaluated by Alizarin Red S, Oil Red O, and Alcian Blue staining, respectively.

Development of the hAFSCsphere

hAFSCs were cultured in serum- and xeno-free medium in T175 flasks and maintained at 37℃ in a humidified 5% CO₂ incubator. Upon reaching 80%∼90% confluence, cells were detached with trypsin, washed several times with Dulbecco’s phosphate buffered saline, centrifuged, resuspended in culture medium as single-cell suspensions, and counted. For sphere formation, AFSCs were seeded onto AggreWell 400 low-adherence microwell plates (StemCell Technologies) at a density of 200∼400 cells per sphere, according to the manufacturer’s protocol, and incubated under standard culture conditions. Sphere morphology was assessed at <12 hours, 16∼20 hours (overnight), and 48 hours, and the sphere at 16 hours was selected as the optimal time point for subsequent animal experiments. To harvest spheres, aggregates were released from microwells by pipetting, filtered through a reversible 40 μm strainer to remove single cells, and collected by inverting the strainer onto a conical tube and rinsing with phosphate buffer saline (PBS) to recover the sphere.

Induction of stress urinary incontinence in rats

Female Sprague-Dawley rats (200∼300 g; Lesco Biotechnology Co., Ltd.) were housed under controlled conditions (12-hour light/dark cycle, 23℃±2℃) with free access to food and water. Under general anaesthesia, rats (n=6) underwent a midline lower abdominal incision to expose the bladder and urethra, followed by pudendal nerve injury to induce urethral sphincter insufficiency and SUI, after which the incision was sutured. In the sham group (n=4), only the abdominal incision and suturing were performed without nerve injury.

AFSC and AFSCsphere therapy

In the rats with urethral sphincter insufficiency, 10 μL PBS containing 1×10⁶ undifferentiated AFSCs (n=6/group) and AFSCsphere were injected simultaneously in the external urethral sphincter (EUS) at 3 o’clock and 9 o’clock, with a total volume of 20 μL.

Measurement of urodynamics parameters: leak point pressure and intercontraction interval

Four weeks after the experiment of administering AFSCs and AFSCsphere, the rats were subjected to general anesthesia with ether to avoid muscle relaxation, and the leak point pressure (LPP) values were measured. A bladder catheter (PE-25) is inserted from the urethral orifice. The animals were then mounted on the tilting table and placed in a vertical position. Intravesical pressure is connected by connecting a large 50 mL syringe to the bladder catheter with a pressure sensor, with PE-50 tubing and a three-way stopcock. Intravesical pressure is pressurized to the height of the visual identification point of the leak (initiation of urine leakage). At this leakage point, the pressure is known as LPP, and the average pressure values at the 3 leakage points are measured continuously as the bladder function map data of each experimental animal. Additionally, rats received suprapubic tube implantation under 3% isoflurane 3 days before cystometry. A conscious cystometry was performed at 4 weeks after sham, PBS, or hAFSCs treatment, and five representative micturition cycles were analyzed. The time between two successive bladder contractions was considered as intercontraction interval (ICI).

Tissue sample collection, RNA isolation, and Real-time polymerase chain reaction

We froze tissue samples in liquid nitrogen and stored them at −80℃ until extraction. Total RNA was extracted with TRIzol reagent (Life Technologies) as per the manufacturer’s instructions and subsequently quantified using NanoDrop^TM Spectrophotometry (Thermo Scientific Inc.). Total RNA (5 μg) was reverse-transcribed. Real-time quantitative polymerase chain reaction (qPCR) reactions were carried out in a StepOnePlus^TM Real-Time PCR system (Applied Biosystems^Ⓡ, Life Technologies Corporation). Gene expression of myogenic regulatory factors (MRFs), including Myf5, myogenin, MyoD, and desmin, was assessed using the 2^−ΔΔCt method. β-actin was used as a reference gene. The PCR primers used for marker genes are shown in Table 1.

Table 1.

Myogenic-lineage genes and their respective primer sequences, where β-Actin was taken as a control

Gene	Sequence
Myf5-F	GGTTGCCTCTCCAGGATCTG
Myf5-R	GAAGCCCCTGGAGTTGCA
Myogenin-F	TGGCAGGAACAAGCCTTTTC
Myogenin-R	ACAGGCAGGTAGTTTTCCCCA
β-Actin-F	ATCGTCCACCGCAAATGCT
β-Actin-R	AAGCCATGCCAATCTCATCTTG
MyoD-F	CCGCTTTCCTTAACCACAAAT
MyoD-R	CGGCTGTAGATAGCAAAGTGC
Desmin-F	TCGGCTCTAAGGGCTCCTC
Desmin-R	CGTGGTCAGAAACTCCTGGTT

F: forward, R: reverse.

Histological evaluations

After recording the LPP, animals were sacrificed, and bladder tissues were collected and fixed in 10% neutral formalin. Samples were embedded in paraffin, sectioned at 4∼6 μm, and processed for hematoxylin–eosin (H&E) staining. Representative images were then captured under a light microscope. Further, the quantification of the muscle tissue surface area was assessed by analyzing the captured images of thin tissue sections (4∼6 μm) using Image-Pro Plus, version 6.0, software (Media Cybernetics).

Secretome assessments

Analysis of cytokine and growth factor profiles in conditioned media of AFSC and AFSCsphere was outsourced to a certified service provider (Bio-Rad Laboratories, Taiwan Branch). The samples were analyzed using the Bio-Plex Pro^TM Human Cytokine 27-plex assay (Cat# M500KCAF0Y) as per the manufacturer’s specifications, and the data are presented as relative fold change.

Statistical analysis

Data are presented as mean±SEM. Statistical analysis was performed using GraphPad Prism with one-way repeated-measures ANOVA, and p<0.05 was considered statistically significant.

Results

Isolation and characterization of human AFSCs

After 3∼5 passages, the hAFSCs revealed uniform, fibroblast-like morphology under phase-contrast microscopy, consistent with the typical appearance of MSCs (Fig. 2A). Flow cytometric analysis (Fig. 2B) confirmed that the cultured cells highly expressed MSC surface markers, including CD44, CD73, CD90, CD105, and HLA-ABC. All cells were also positive for neural progenitor marker nestin and stemness-associated transcription factor SOX2. Further, flow cytometric analysis demonstrated that the cultured cells lacked significant expression of hematopoietic and endothelial lineage markers (CD11b, CD19, CD31, CD45, or HLA-DR) (Fig. 2C).

Fig. 2.

Characterization of cultured hAFSCs. (A) Cultured hAFSCs sphere exhibited an adherent, spindle-shaped morphology characteristic of fibroblast-like cells (scale bar: 100 μm). (B) Flow cytometry-based immunophenotyping of hAFSCs showing positive (CD44, CD73, CD90, CD105) and HLA-ABC, in addition to biomarkers of pluripotency and neural progenitor cells i.e., nestin and SOX2, respectively. (C) Reduced expression of negative mesenchymal stem cell markers, including CD11b, CD19, CD31, CD45, or HLA-DR. (D) Osteogenesis, where hAFSCs differentiate into bone-forming osteocytes, is evidenced by calcium deposition, typically visualized with Alizarin Red staining. (E) Adipogenesis, the differentiation of hAFSCs into adipocytes, is characterized by intracellular lipid droplets stained with Oil Red O. Scale bar: 100 μm. (F) Chondrogenesis, where hAFSCs differentiate into chondrocytes that produce cartilage matrix, as evidenced by alcian blue staining. Scale bar: 100 μm. (G) Representative morphology during optimization of hAFSCs sphere over time (<12, 16∼20, and 48 hours). hAFSCs: human amniotic fluid stem cells.

Further, we characterized multi-differential (osteogenic, adipogenic, and chondrogenic). Osteogenic differentiation was confirmed by the intense red coloration following Alizarin Red S staining, which specifically binds to calcium deposits in the extracellular matrix (Fig. 2D). The uniform and dense mineralization pattern indicates active osteoblast function and matrix maturation. Adipogenic differentiation is demonstrated by Oil Red O staining, which identifies neutral lipid accumulation within the cytoplasm (Fig. 2E).

Numerous lipid droplets of varying sizes are visible, suggesting successful adipocyte formation and active lipid storage. Notably, chondrogenic differentiation is shown through Alcian Blue staining, which binds strongly to acidic proteoglycans and glycosaminoglycans within the cartilage-like extracellular matrix (Fig. 2F). The pellet culture exhibits an intense and homogeneous blue color, indicating rich proteoglycan deposition. The magnified image further reveals a dense and organized matrix structure, with intense blue staining implying increased proteoglycan accumulation.

We further optimized time-dependent AFSCsphere formation (Fig. 2G). At <12 hours, no distinct sphere was formed, and the aggregates easily fragmented due to weaker cell–cell adhesion. By 16∼20 hours (overnight culture), the sphere reached ∼150 μm in diameter, forming compact yet expandable structures that can efficiently spread and proliferate after injection, representing the optimal stage for therapeutic delivery. At 48 hours, spheres exceed 250 μm, with irregular size distribution and a densely packed core prone to necrosis from limited nutrient and oxygen diffusion, while their larger size requires higher shear force during needle passage, increasing the risk of mechanical stress and cell death. These results imply that spheres cultured for 16∼20 hours offer the optimal size, maintaining structural integrity and functional viability for clinical applications.

Assessment of in vivo engraftment and immunocompatibility of AFSCs

In agreement with the immunophenotypic characterization of isolated AFSC in our study, revealing HLA-ABC＋ (MHC-I) (Fig. 2B) and HLA-DR– (MHC-II) (Fig. 2C), the red-colored immunofluorescent signals of MHC-I (Supplementary Fig. S1) indicated tissue integration, immunocompatibility, and safety, where AFSCs could exert therapeutic activities by their immunomodulatory and paracrine mechanisms.

Impact of hAFSCsphere on urodynamics and total surface area of external urethral sphincter

LPP and ICI are the tools to determine the severity of SUI, presence of intrinsic sphincter deficiency, and therapeutic effectiveness. Our results demonstrated the highest LPP in the sham group (39.72±4.29 cmH₂O), compared to the urinary incontinence (UI) group (15.90±3.20 cmH₂O), with a substantial decline (Fig. 3A). Whereas the AFSCsphere group (44.63±1.74 cmH₂O) revealed significantly improved levels of LPP when compared to AFSC (40.19±4.09 cmH₂O) and PBS (20.97±2.26 cmH₂O). This was further confirmed by their relative quantification (Fig. 3B).

Fig. 3.

Effect of human amniotic fluid stem cells (hAFSC) treatment on urodynamics and external urethral sphincter (EUS) muscle surface area. Representative recordings of (A) leak point pressure (LPP, cmH₂O) and its (B) quantification, (C) intercontraction interval (ICI, seconds) and its (D) quantification among sham, urinary incontinence (UI), phosphate buffer saline (PBS), AFSC, and amniotic fluid stem cell spheres (AFSCspheres) groups. Data are presented as mean±SEM. (E) Comparative muscle surface area of the groups compared to UI. Data are shown as mean±SEM. *p<0.05, **p<0.01, ***p<0.001.

Further, a similar trend was also observed for ICI (Fig. 3C) in the sham group (49.50±5.77 seconds), exhibiting regular, well-defined contractions with consistent amplitude and long, stable ICIs, indicating normal bladder function. In contrast, the UI group (18.63±4.72 seconds) showed shorter ICI, weaker contractions, and less coordinated, reflecting overactivity and impaired bladder control. However, AFSC treatment (29.58±2.22 seconds) improved both contraction strength and ICI duration, showing more regular activity compared to PBS alone (23.00±2.16 seconds). However, compared to AFSC, the AFSCsphere treatment (43.22±3.42 seconds) further significantly improved contraction patterns and ICIs close to the sham group, indicating substantial restoration of bladder contractile performance and continence function. This was later corroborated through their relative quantification (Fig. 3D).

Later, we also quantified muscle surface area in different treatment groups compared to the UI group (Fig. 3E). The sham group exhibited the highest muscle surface area, reflecting intact muscle integrity. In contrast, the UI group showed the lowest ratio, indicating pronounced muscle loss. The PBS group also showed results similar to the UI group. Following the administration of AFSC and AFSCsphere, the muscle surface area was significantly improved (p<0.01); however, the effect was less in the AFSCsphere group.

Myogenic lineage-specific gene expression and histological assessment

Using qPCR, we determined the expression levels of myogenic differentiation-specific markers, including Myf5, myogenin, MyoD, and desmin (Fig. 4A). Since the significant amelioration in urodynamic parameters and muscle surface area observed in both AFSC and AFSCsphere groups, we further quantified relative myogenic gene expression in these groups, which revealed varying results. Specifically, Myf5 was significantly (p<0.01) higher in the hAFSCs-treated group (1.66±0.33) compared to the AFSCsphere group (0.61±0.47). A similar trend was observed for Myogenin (AFSC: 10.68±1.11, AFSCsphere group: 8.99±0.30, p<0.01) and desmin (AFSC: 9.13±1.39, AFSCsphere: 7.92±0.38, p<0.01). However, the MyoD was found marginally higher (AFSC: 10.63±0.83, AFSCsphere: 10.74±0.44).

Fig. 4.

Assessment of bladder and external urethral sphincter (EUS) muscle improvement after amniotic fluid stem cell spheres (AFSCspheres) therapy. (A) Relative expression of myogenic genes, including Myf5, Myogenin, MyoD, and Desmin, where β-actin was used as a control, sham (n=4), AFSC (n=6), AFSCspheres (n=6). (B) Representative hematoxylin and eosin staining-based histological analysis of bladder tissue (upper panel), and EUS muscle (middle: lower magnification, lower panel: higher magnification), and (C) muscle surface proliferation in Sham (n=4), UI (n=6), PBS (n=6), AFSC, and AFSCsphere (n=6). (D) Fold-change in the key secretome by AFSC and AFSCsphere when compared to control, which includes VEGF, IL-6, IL-8, IL-9, and MIP-1β. Data are presented as mean±SEM, with statistical differences indicated. UI: urinary incontinence, AFSCs: amniotic fluid stem cells, PBS: phosphate buffer saline, VEGF: vascular endothelial growth factor, IL-6: interleukin-6, IL-8: interleukin-8, IL-9: interleukin-9, MIP-1β: macrophage inflammatory protein beta. *p<0.05, **p<0.01, ***p<0.001.

Further, we conducted H&E staining to assess the structural improvements of the bladder and EUS muscle tissues (Fig. 4B). The sham group displayed a well-organized bladder wall structure with intact urothelium and densely packed muscle fibers. In contrast, the UI group displayed marked structural disruption, including thinning of the muscularis layer, irregular fiber alignment, and increased interstitial spaces, indicating tissue damage. The PBS-treated group showed slight improvement but retained features of degeneration, with loosely arranged muscle fibers and reduced tissue density. However, AFSC treatment resulted in a thicker and more compact epithelium and organized muscle bundles, with partial restoration of tissue architecture. A similar impact was observed in the AFSCsphere group; however, it was less than that of AFSC.

The histologic sections of EUS muscle tissue revealed a well-preserved normal muscle structure. The UI group exhibited clear tissue fibrosis and disorganized muscle fibers. No significant improvement was observed in the PBS. However, the AFSC displays enhanced recovery arrangement and ameliorated damage compared to UI and PBS. The AFSC-sphere shows the most intact muscle structure, indicating a potential regenerative or protective influence.

We further assessed muscle cell proliferation in all the treatment regimens (Fig. 4C). The sham group exhibits the highest muscle cell proliferation, serving as the baseline for healthy tissue. The UI group showed a significantly reduced proliferation, indicating the tissue injury under SUI. Consistent with histopathological results, the AFSC and AFSCsphere groups demonstrated significantly moderate recovery, reflecting a partial therapeutic effect. Taken together, AFSC and AFSCsphere treatment demonstrated substantial urodynamic recovery, reduced fibrosis, and improved muscle fiber organization in EUS, which could be attributed to their repair and regeneration capacity.

Determination of therapeutic secretome

We next determined the fold change in the key secretome by AFSC and AFSCsphere, which may be involved in reparative regeneration of EUS. Our results demonstrated a fold-change of vascular endothelial growth factor (VEGF) (AFSC：AFSCsphere=2.15：5.19), interleukin (IL)-6 (AFSC：AFSCsphere=3.78：10.05), IL-8 (AFSC：AFSCsphere=3.29：12.17), IL-9 (AFSC：AFSCsphere=6.47：8.02), and macrophage inflammatory protein-1beta (MIP-1β) (AFSC：AFSCsphere=4.65：5.75). These data implied that AFSCsphere has elevated levels of secretome than AFSC, when compared to control (Fig. 4D).

Discussion

In this study, the AFSC demonstrated remarkable therapeutic responses with AFSCsphere. In line with ours, previous studies have confirmed the fibroblast-like morphology and strong positivity for mesenchymal markers of hAFSCs (CD44, CD73, CD90, CD105), with the absence of hematopoietic marker CD45 and MHC class II antigen HLA-DR in the hAFSCs (12). Cells further demonstrated trilineage differentiation capacity, evidenced by calcium mineralization, lipid droplet formation, and glycosaminoglycan deposition. Collectively, our results validated the mesenchymal and multipotent properties of the isolated hAFSCs. Similar to our finding, the pluripotency was confirmed by the expression of pluripotency genes like SOX2 (13). Notably, under myogenic induction, hAFSCs adopted elongated, spindle-like morphology, with CM-treated cells showing superior viability compared to 5-azaC and TGF-β groups (12).

Our further study shows the growth dynamics of AFSC spheres relevant to injection-based applications. No stable sphere formed before 12 hours, whereas by 16∼20 hours, it reached ∼150 μm, remained compact yet expandable, and spread post-injection efficiently, making this the optimal therapeutic stage. By 48 hours, spheroids exceed 250 μm, develop necrotic cores from poor diffusion, and require higher shear force for injection, increasing cell death; thus, 16∼20-hour spheres maintaining integrity and viability were found suitable. Notably, 3D spheroid culture of hAFSCs more closely mimics physiological conditions and better preserves stemness, with higher expression of pluripotency genes (SOX2, OCT4, NANOG, LIN28A, MSI1) (14). These findings, consistent with MSCs from other sources, show that 3D culture sustains stem cell properties and enhances neurogenic potential more effectively than monolayers.

Further, spheroids, dense 3D cell aggregates, enhance cell therapy by sustaining cell–cell and cell–matrix interactions. MSC spheroids are especially promising, as they improve survival, maintain differentiation, and release a secretome that supports angiogenesis, reduces inflammation, and recruits host cells to aid tissue repair (15). In a rat model of urethral sphincter deficiency, spheroid transplantation restored bladder LPP more effectively than single-cell injections (16). Previous studies have demonstrated that adipose stromal vascular fraction spheroids (ad-SVFsp) significantly improved bladder function in a rat model of underactive bladder (UAB) by enhancing angiogenesis, reducing apoptosis, and promoting cell proliferation (17). Compared to single-cell ad-SVF, spheroids have shown higher growth factor expression and greater cell retention, highlighting their potential as a novel UAB therapy.

Our study demonstrates that AFSCs and AFSCsphere improved bladder function and muscle regeneration in UI models, with AFSCsphere showing the greatest recovery of continence (LPP) and contractility (ICI). While single-cell AFSCs enhanced muscle repair more strongly, spheroids provided superior restoration of functional bladder performance. We found that AFSCs and AFSCsphere were both significantly effective in improving LPP and ICI in the SUI model. However, the AFSCs sphere showed significant improvement in the ICI value in comparison to the AFSCs sphere. Consistently, the improvement of muscle surface area was found to be higher in the AFSC-treated group compared to the AFSCsphere. As observed in our study, the improvement in urodynamic parameters such as LPP and ICI in the AFSCsphere group could be attributed to enhanced vascularization. This is consistent with a seminal study in which transplanted cord blood MSCs as spheroids enhanced vascularization (6).

Our study further demonstrated the myogenic potential of hAFSCs and hAFSCspheres by upregulation of Myf5, MyoD, myogenin, and desmin. Notably, Myf5, MyoD, and myogenin are associated with sphincter cell regeneration, and Desmin overexpression promotes smooth muscle lineage proliferation (18-21). Additionally, hAFSCs restore bladder function through muscle regeneration, neural repair, and immunomodulation. Further, the therapeutic effect of hAFSCs is largely mediated through their secretome, which activates key MRFs. Myf5 drives myoblast proliferation and maintains the progenitor pool, myogenin promotes fusion and differentiation, and MyoD upregulates desmin to reinforce myofiber strength and EUS function, with Myf5 regulated by histone modifications during satellite-cell activation and Desmin essential for fusion and muscle integrity (22-24). Moreover, the upregulation of desmin enhances force transmission across the EUS and improves sphincter coordination, increasing myofiber density and structural organization to strengthen urethral closure and restore LPP and ICI through improved EUS contractility and bladder dynamics (25, 26). This regenerative cascade reverses sphincter atrophy, promotes muscle differentiation, stabilizes bladder function, augments urethral competence, and may alleviate detrusor overactivity (25, 26).

These improvements were linked to increased sphincter surface area and regeneration of injured bladder tissues, as supported by histological analysis. Further, hAFSCsphere showed maintained myogenic markers (Desmin, MyoD, Myf5, Myogenin), similar to AFSCs, indicating muscle mass and contractility, thereby restoring urodynamics in SUI models and highlighting their therapeutic potential (18). This is in line with a study showing transcriptomic alterations in the spheroid human MSCs were found, where decreases in genes responsible for cytoskeleton organization and biogenesis, mitosis, cell cycle, and extracellular matrix were reported (27). Additionally, a notable increase in genes attributed to wounding, anti-inflammatory, anti-apoptotic, and anti-tumorigenic molecules was observed. Our results also demonstrated increased muscle cell proliferation in both ASFC and AFSCsphere groups; however, the effect was higher in the AFSC group.

Further, since the therapeutic advantages of AFSCs in SUI may also be largely mediated by paracrine signalling through various bioactive factors/cytokines (28), we determined the key factors, including VEGF, IL-6, IL-8, IL-9, and MIP-1β, which may be involved in the repair of SUI through angiogenesis, immunomodulation, and tissue regeneration. VEGF, a potent pro-angiogenic factor secreted by AFSCs (29), drives neovascularization in the ischemic EUS, restoring blood supply and supporting myofiber regeneration, as evidenced by improved LPP in preclinical SUI models. In a murine model study, AFSC has been demonstrated as a reservoir of secreted pro-angiogenic soluble factors such as VEGF, IL-8, MCP-1, and SDF-1, contributing to stimulated neo-arteriogenesis in an ischemic model (30). This study also asserted that AFSC-secreted mediators can guide tissue repair by stimulating or recruiting host reparative cells.

IL-6, a pleiotropic cytokine released by AFSCs, exhibits dual immunomodulatory effects, promoting muscle progenitor and repair of the sphincter by shifting M1 to M2 macrophage (anti-inflammatory) polarization in the urethral sphincter, suppressing chronic inflammation, and supporting muscle fiber remodeling (31). This seems to be a physiological mechanism to explain the increased LPP and prolonged ICI. IL-8 (CXCL8) (32) and MIP-1β (CCL4) (33, 34), abundant in AFSC secretome, might facilitate recruitment of anti-inflammatory neutrophil, monocyte, and fibroblasts to damaged EUS tissues, enhancing wound healing and extracellular matrix deposition without excessive fibrosis. Notably, IL-9 has been reported to protect from early podocyte injury and progressive glomerulosclerosis in Adriamycin-induced nephropathy, and suggested that overexpression of IL-9 may ameliorate the renal outcome by mediating an anti-apoptotic impact on podocytes (35). Therefore, IL-9 might exert anti-apoptotic effects in damaged EUS cells. The above documented evidence on therapeutic responses is in line with increased folds of VEGF, IL-6, IL-8, IL-9, and MIP-1β in our administered AFSC, which were more prominently higher in folds in AFSCsphere group.

Further, beside nestin (neurotrophic) expression (36) in this study, the AFSC’s neurogenic potential is supported by our previous study in which our U-Neuron Biomedical Inc. (Taiwan)-manufactured hAFSCs was used, in quantified immunofluorescence staining demonstrated significantly elevated nNOS-positive nerve fibers (myelination) and α-smooth muscle actin (α-SMA) content (11) in restoring erectile function in a bilateral cavernous nerve crush injury rat model. Another recent report using U-Neuron Biomedical Inc. (Taiwan)-manufactured hAFSCs revealed an increased intracavernous pressure/mean arterial pressure, restored neuronal and endothelial markers, α-SMA expression, and decreased β-galactosidase activity, implying elevated smooth muscle integrity and suppressed cellular senescence (37).

The observed differential myogenic gene expression in the AFSCsphere, when compared to ASFC, but enhanced urodynamic parameters, could be attributed to the 3D spheroid structure, which could promote a hypoxic core (38), upregulating survival factors and anti-apoptotic pathways, improving cell retention and engraftment in the injured EUS post-transplantation, thereby contributing to enhanced urodynamic recovery despite unchanged myogenesis. This study also emphasized that 3D culture geometry of stem cells could act as a means to control the output of angiogenic factors such as VEGF, and indicated that at a specific environmental oxygen concentration, an optimal sphere size for cytokine release exists.

Spheroid culture improves engraftment, functional recovery, and expression of key regenerative markers, highlighting the value of 3D systems in advancing stem cell–based therapies (39). Further, placenta-derived MSCs cultured in PDMS-based concave microwells rapidly formed compact, size-regulated spheroids that transitioned to smooth surfaces by day 3 while maintaining high cell viability (>90%), confirming the stability and effectiveness of this 3D culture system (39). These benefits have also positioned AFSC spheroids as a promising strategy to advance regenerative therapy for faecal incontinence (40). Collectively, our results underscore the paracrine dominance-driven therapeutic potential of AFSCsphere in SUI, warranting further extensive preclinical and clinical investigations by shifting the focus from cellular replacement to microenvironment modulation. Taken together, our study revealed that AFSCsphere may improve urodynamics and histologic bladder and EUS architecture despite a significant increase in myogenic gene expression (Fig. 5).

Fig. 5.

Summary of amniotic fluid stem cell spheres (AFSCspheres)-based treatment of stress urinary incontinence (SUI). Upward and downward arrows indicate increase and decrease, respectively, while the number of arrows implies the magnitude of the expression level. AFSC: amniotic fluid stem cells, LPP: leak point pressure, ICI: intercontraction interval, EUS: external urethral sphincter, VEGF: vascular endothelial growth factor, IL-6: interleukin-6, IL-8: interleukin-8, IL-9: interleukin-9, MIP-1β: macrophage inflammatory protein-1 beta. Created in BioRender. Dubey N (2025), https://BioRender.com/xjoaax9.

Besides the positive outcomes, this preliminary study also includes a few limitations, such as quantifying the contribution of AFSCsphere-specific properties, like cell-cell interactions, in reaching improved therapeutic impacts. Quantitative viability assessment will also focus on determining whether differences in sphere size and structure correspond to actual cell survival and function. While H&E staining corroborated an improved tissue architecture, the detailed assessment, such as inflammatory cell infiltration or fibrotic changes, is still lacking. Hence, future studies will employ multiplex immunohistochemistry to quantify immune cell dynamics and enzyme-linked immunosorbent assay/multiplex assays to measure local cytokine profiles, which will directly test the hypothesized anti-inflammatory activities of AFSC spheres.

Further, while the DAPI/MHC-I staining confirms human cell engraftment in the EUS, our data do not directly quantify differences in cell numbers or survival between AFSC and AFSC sphere groups, nor do they distinguish between direct myogenic/neural differentiation of transplanted cells and host-cell responses to paracrine signals. The observed improvements in muscle architecture and urodynamics may suggest a predominant paracrine mechanism, supported by the enhanced secretome profile in spheres, but this remains speculative. Therefore, to determine the effects of conditioned media from AFSCs vs. AFSCspheres on relevant in vitro readouts (myotube survival, neurite outgrowth, endothelial tube formation), and/or blocking key candidates in vivo or in vitro using neutralizing antibodies or small-molecule inhibitors, is required to definitively identify the most critical factor. The engrafted cell numbers in AFSC vs. AFSCsphere groups should be quantified. However, our present data indicate that the secretome profile as a whole is the distinguishing characteristic of the spheres. Another limitation of this study is the lack of direct quantification of nerve fiber density and neurotrophic factor expression (e.g., brain-derived neurotrophic factor, nerve growth factor, glial cell line-derived neurotrophic factor) in the treated tissues. While we acknowledge that neural regeneration is a critical component of long-term SUI recovery, our current findings suggest that the early functional superiority of AFSC spheres could primarily be driven by paracrine-mediated microenvironment modulation. Even though the specific AFSC line used has previously demonstrated neurotrophic capabilities in other injury models (11, 37), the direct evidence in this model remains to be elucidated. Hence, future studies will specifically target neural mapping and neurotrophic profiling to delineate the direct versus indirect effects of AFSC spheres on urethral innervation. Although AFSCspheres secreted significantly higher levels of VEGF compared to AFSCs, we did not perform in vivo microvessel density analysis or correlate vessel density with LPP and ICI outcomes in the current study. Therefore, while the enhanced VEGF secretion supports the hypothesis that improved angiogenesis may contribute to the superior regenerative effects of spheres, this mechanism remains to be directly validated.

Conclusively, the enhanced therapeutic effects, such as superior urodynamics observed in the AFSCsphere treatment, even when gene expression remains unchanged or relatively low, might be ascribed to paracrine-dominance signaling, rather than solely from increased gene expression. These results underscore the therapeutic promise of hAFSCspheres and emphasize the need for rigorous preclinical and clinical studies to further establish their efficacy, mechanistic insight, and safety as a novel strategy for SUI management.

Supplementary Materials

Supplementary data including one figure can be found with this article online at https://doi.org/10.15283/ijsc25121