Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2006 Jan;44(1):108–118. doi: 10.1128/JCM.44.1.108-118.2006

Characterization of a Strain of Community-Associated Methicillin-Resistant Staphylococcus aureus Widely Disseminated in the United States†

Fred C Tenover 1,*, Linda K McDougal 1, Richard V Goering 2, George Killgore 1, Steven J Projan 3, Jean B Patel 1, Paul M Dunman 4
PMCID: PMC1351972  PMID: 16390957

Abstract

A highly stable strain of Staphylococcus aureus with a pulsed-field gel electrophoresis type of USA300 and multilocus sequence type 8 has been isolated from patients residing in diverse geographic regions of the United States. This strain, designated USA300-0114, is a major cause of skin and soft tissue infections among persons in community settings, including day care centers and correctional facilities, and among sports teams, Native Americans, men who have sex with men, and military recruits. The organism is typically resistant to penicillin, oxacillin, and erythromycin (the latter mediated by msrA) and carries SCCmec type IVa. This strain is variably resistant to tetracycline [mediated by tet(K)]; several recent isolates have decreased susceptibility to fluoroquinolones. S. aureus USA300-0114 harbors the genes encoding the Panton-Valentine leucocidin toxin. DNA sequence analysis of the direct repeat units within the mec determinant of 30 USA300-0114 isolates revealed differences in only a single isolate. Plasmid analysis identified a common 30-kb plasmid that hybridized with blaZ and msrA probes and a 3.1-kb cryptic plasmid. A 4.3-kb plasmid encoding tet(K) and a 2.6-kb plasmid encoding ermC were observed in a few isolates. DNA microarray analysis was used to determine the genetic loci for a series of virulence factors and genes associated with antimicrobial resistance. Comparative genomics between USA300-0114 and three other S. aureus lineages (USA100, USA400, and USA500) defined a set of USA300-0114-specific genes, which may facilitate the strain's pathogenesis within diverse environments.


Staphylococcus aureus continues to be a majorcause of health care-associated infections (1, 18, 19, 45, 53). Recently, strains of methicillin (oxacillin)-resistant S. aureus (MRSA) have been recovered from infections in community settings (8, 11, 27, 44, 49, 64) and among the urban poor in San Francisco, California (12). Most community MRSA strains harbored the lukF-PV and lukS-PV determinants, which encode the Panton-Valentine leucocidin (PVL) toxin (20, 26, 28, 35, 43). Using pulsed-field gel electrophoresis (PFGE), we recently described two major types of community-associated MRSA, designated USA300 and USA400 (46), both of which typically harbor PVL. USA400 isolates were associated with the deaths of four children in Minnesota and North Dakota in 1999 (6), all of whom were treated with cephalosporins. An isolate of the same lineage as USA400 (also known as S. aureus MW-2) was responsible for a series of infections in health care settings across Canada (61), infections in Native Americans (31) and among children in day care (33), and an outbreak of S. aureus infection on a maternity ward of a hospital in New York (62). USA300 isolates have been recovered from a variety of community populations, including children (5, 39), correctional facility inmates (7, 10), participants in sports teams (9, 40), men who have sex with men (8, 34, 42), and military recruits (72). Over the last 3 years, outbreak investigations conducted by the Centers for Disease Control and Prevention (CDC) in diverse geographic locations and with diverse patient populations often yielded the same USA300 PFGE pattern, designated USA300-0114, from wound cultures and other clinical specimens (40). These isolates yielded indistinguishable macrorestriction PFGE profiles with five restriction endonucleases, were consistently erythromycin resistant, clindamycin susceptible, and D-zone test (clindamycin induction) negative, harbored staphylococcal cassette chromosome mec (SCCmec) type IVa, and carried the genes for PVL (40). S. aureus USA300 strains have been isolated by Hidron et al. from patients admitted to an urban hospital in Atlanta, Georgia (34), and by Chavez-Bueno et al. from children in Dallas, Texas (13). This study further characterized the antimicrobial susceptibility patterns and genetic traits of this strain by using plasmid analysis, a series of PCR assays, and DNA microarrays.

MATERIALS AND METHODS

Bacterial strains.

One hundred eighty-seven isolates of S. aureus from the CDC strain collection (from outbreak investigations, surveillance studies, and the Staphylococcus reference laboratory), identified on the basis of catalase, coagulase, and sugar fermentation patterns (4), demonstrated the SmaI PFGE profile identified as USA300 (46). These isolates underwent antimicrobial susceptibility testing, SCCmec typing, and testing for several genes encoding toxins and virulence factors. Thirty isolates from diverse geographic locations in the United States and showing variable antimicrobial susceptibility patterns were selected for further studies, including DNA sequence analysis of the mec-associated direct repeat unit (dru) region (48), agr grouping, and plasmid analysis. Fourteen of the 30 isolates, including 6 that were USA300-0114, underwent DNA microarray analysis; all 6 USA300-0114 isolates also underwent staphylococcal protein A (spa) typing, and 1 USA300-0114 isolate was analyzed by multilocus sequence typing (MLST).

Antimicrobial susceptibility testing.

The antimicrobial susceptibility profiles of the isolates were determined by the broth microdilution method with cation-adjusted Mueller-Hinton broth (Becton Dickinson Microbiology Systems, Cockeysville, Md.), as described in the CLSI (formerly NCCLS) publication M7-A7 (52). The antimicrobial agents tested were clindamycin, chloramphenicol, erythromycin, gentamicin, levofloxacin, linezolid, oxacillin, penicillin, quinupristin-dalfopristin, rifampin, tetracycline, trimethoprim-sulfamethoxazole, and vancomycin. Quality control strains included S. aureus ATCC 29213, Enterococcus faecalis ATCC 25922, and S. aureus ATCC 43300. Inducible clindamycin resistance was determined using a disk diffusion D-zone test as described by the Clinical and Laboratory Standards Institute (15).

Pulsed-field gel electrophoresis.

PFGE was performed as described previously (46), using a contour-clamped homogeneous electric field apparatus DR-II, DR-III, or CHEF Mapper (Bio-Rad, Hercules, CA). Running parameters were as follows: volts, 200 (6 V/cm); temperature, 14°C; initial switch, 5 s; final switch, 40 s; and time, 21 h.

Gel pattern analysis.

Gels were photographed and digitized using a FOTO/Analyst Archiver system (Fotodyne, Inc., Hartland, WI), and saved as TIFF images for use with BioNumerics software (Applied Maths, Kortrijk, Belgium). The reference standard S. aureus NCTC 8325, which was included in the 1st, 7th, 14th, 20th, and last lanes of each gel, was normalized to the global standard S. aureus NCTC 8325. Percent similarities were calculated using Dice coefficients, and the unweighted-pair group method using arithmetic averages was used for cluster analyses. Band position tolerance and optimization were set at 1.25% and 0.5%, respectively.

SCCmec typing.

SCCmec typing was performed essentially as described by Okuma et al. (54).

PCR assays.

PCR detection of ermA, ermB, ermC, and msrA was performed as described by Sutcliffe et al. (68). The PCR primers for tet(K) were tetKFwd, 5′ TAG GGG GAA TAA TAG CAC ATT 3′, and tetKRev, 5′ AAT CCG CCC ATA ACA AAT A 3′. Primers for blaZ were blaZfwd, 5′ GGC CCT TAG GAT AAA CAA AAG 3′, and blaZrev, 5′ CAG TTC ACA TGC CAA AGA GTT 3′. Isolates were screened via PCR for carriage of the genes encoding staphylococcal enterotoxin A (SEA), SEB, SEC, SED, SEE, SEH, and toxic shock syndrome toxin 1 as previously described (45a). The presence of the genes encoding PVL (lukS-PV and lukF-PV) was assessed using the PCR assay described by Lina et al. (43).

agr grouping.

Multiplex PCR-based agr grouping was performed using the primer sets for agr group I, agr group II, and agr group III described by Moore and Lindsay (47). The primers for agr group IV were agrIV forward, 5′ CAC TTA TCA TCA AAG AGC C 3′, and agrIV reverse, 5′ GTA TTT CAT CTC TTT AAG G 3′. Cycling conditions consisted of an initial denaturation step at 94°C for 2 min, followed by 30 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 1 min, followed by a primer extension period of 5 min at 72°C. The primers were validated against a set of 16 control strains prior to use in the study.

Plasmid analysis.

Plasmid DNA was isolated using a modified protocol for the QIAGEN plasmid mini kit (Valencia, CA). A loopful of bacteria from a Trypticase blood agar plate incubated overnight at 35°C was suspended in 500 μl of cold QIAGEN cell suspension buffer. Fifty microliters of lysostaphin (0.5 mg/ml) was added, followed by a 30-min incubation at 37°C. Plasmid profiles were determined by agarose (0.75%) gel electrophoresis before and after restriction of DNA with HindIII. Digoxigenin-labeled DNA probes were generated by PCR using DNA from the following control organisms: S. aureus RN4220 (msrA), S. aureus RN2442 (ermC), S. aureus CDC82-7701 [tet(K)], and S. aureus 01057 (blaZ). Four identical agarose gels containing uncut plasmid DNA from 11 isolates of S. aureus USA300-0114 with different phenotypes and genotypes were prepared, and the DNA was transferred to Zeta-Probe membranes by vacuum blotting (Boekel Scientific, Feasterville, Pa.) and probed individually using the four probes listed above as previously described (45a).

Multilocus sequence typing and spa typing.

MLST was performed as described by Enright et al. (23, 24). spa typing was performed as described by Shopsin et al. (67).

Microarray analysis.

The genetic compositions of S. aureus pulsed-field types (PFTs) USA100-0022, USA300-0114, USA400-0051, and USA500-0004 isolates were determined using S. aureus Affymetrix GeneChips (Saur2a) (Affymetrix, Santa Clara, CA), as previously described (21); multiple isolates of the USA300 and USA400 PFTs were analyzed. Chromosomal DNA from each isolate was interrogated for the presence or absence of the 7,792 loci represented on the Saur2a chip (21). Briefly, chromosomal DNA was purified from each isolate, fragmented, and biotinylated at the 3′ end. Then, 1.5 μg of labeled DNA was hybridized to a GeneChip, and adjusted “present” and “absent” determinations were made for each locus represented on the array (21).

Direct repeat unit sequencing.

Sequence analysis of the mec-associated dru region was performed as described by Goering et al. (29, 30), using the nucleotides 5′ GTTAGCATATTACCTCTCCTTGC 3′ and 5′ GCCGATTGTGCTTGATGAG 3′ as forward and reverse primers, respectively. PCR was performed with an initial denaturation step at 94°C for 2 min, followed by 30 cycles of 94°C for 1 min, 52°C for 1 min, and 72°C for 1 min. DNA sequencing was performed using an ABI PRISM 3100-Avant genetic analyzer (Applied Biosystems, Foster City, CA).

RESULTS

PFGE analysis.

A dendrogram of SmaI macrorestriction fragment patterns showing the relationship of USA300-0114 to other isolates in the USA300 PFT and other USA PFTs is presented in Fig. 1. USA300-0114 is one of several PFGE patterns within the USA300 PFT. As previously reported, the closest PFT to USA300 is USA500, which is also sequence type (ST) 8 as determined by MLST (46). USA300 PFGE patterns are distinct from other MRSA PFGE patterns (e.g., USA100, USA200, and USA400).

FIG. 1.

FIG. 1.

PFGE profiles of SmaI macrorestriction patterns of S. aureus isolates of various USA types (Centers for Disease Control and Prevention, unpublished data); 46). PFTs, SCCmec types, results of the PCR assay for PVL toxin genes (pos, positive; neg, negative), and sequence types determined by MLST are shown.

USA300-0114 characteristics.

The antimicrobial resistance patterns of 187 oxacillin-resistant USA300 isolates were determined by the broth microdilution method. The isolates were generally susceptible to chloramphenicol (100%), clindamycin (98%), gentamicin (100%), linezolid (100%), quinupristin-dalfopristin (100%), rifampin (99%), trimethoprim-sulfamethoxazole (100%), and vancomycin (100%) but were less susceptible to levofloxacin (84%) and tetracycline (83%). On the other hand, 97% of isolates were resistant to erythromycin. Of these, only three showed inducible clindamycin resistance by use of the D-zone test; one additional isolate was constitutively resistant to clindamycin. Of the 30 isolates selected for additional testing, all were positive by PCR for SCCmec type IVa. All six USA300-0114 isolates that underwent spa typing were spa type YHGFMBQBLO, and the one USA300-0114 isolate analyzed by MLST was identified as ST8.

Table 1 describes the 30 isolates selected for the additional studies. The geographic locations (states) of isolation (when known), antimicrobial resistance patterns, plasmid profiles, and resistance genotypes are listed. Multiplex PCR demonstrated that all 30 isolates were agr group I. The dru regions within the mec determinants of the 30 isolates were sequenced. All of the isolates were dru type 9g, except for one isolate from Colorado, which was type 9h (Table 2).

TABLE 1.

Description of USA300-0114 isolates characterized in this study

Isolate no. State of isolation; population cluster (reference) Antimicrobial resistance patternb Plasmid profile (kb) Resistance genotype detected by PCR
1 Pennsylvania; college football team (9) Penr Oxar Eryr 30, 3.1 blaZ mecA msrA
2 Pennsylvania; college football team (9) Penr Oxar Eryr 30, 3.1 blaZ mecA msrA
3 Mississippi; prisoners (7) Penr Oxar Eryr Tetr 30, 4.3, 3.1 blaZ mecA msrA tet(K)
4 Georgia; prisoners (10) Penr Oxar Eryr 30 blaZ mecA msrA
5 State unknown; nasal surveillance survey Penr Oxar Eryr Tetr 30, 4.3, 3.1 blaZ mecA msrA tet(K)
6 State unknown; nasal surveillance survey Penr Oxar Eryr 30, 3.1 blaZ mecA msrA
7 Tennessee; children (5) Penr Oxar Eryr 30, 3.1 blaZ mecA msrA
8 Tennessee; children (5) Penr Oxar Eryr Tetr LvxI 30, 4.3, 3.1 blaZ mecA msrA tet(K)
9 Texas; children Penr Oxar Eryr 30, 3.1 blaZ mecA msrA
10 Texas; prisoners (10) Penr Oxar Eryr Tetr 30, 4.3, 3.1 blaZ mecA msrA tet(K)
11 Texas; prisoners (10) Penr Oxar Eryr CliInd 30, 3.1, 2.6 blaZ mecA msrA ermC
12 Texas; outpatient Penr Oxar Eryr CliInd 30, 3.1, 2.6 blaZ mecA msrA ermC
13 Texas; outpatient Penr Oxar Eryr 30, 3.1 blaZ mecA msrA
14 Colorado; fencer (9) Penr Oxar Eryr 30, 3.1 blaZ mecA msrA
15 Colorado; fencer (9) Penr Oxar Eryr 30, 3.1 blaZ mecA msrA
16 Washington; adult Penr Oxar Eryr 30, 3.1 blaZ mecA msrA
17 Washington; adult Penr Oxar Eryr 30, 3.1 blaZ mecA msrA
18 Nevada; child Penr Oxar Eryr Tetr LevI 30, 4.3, 3.1 blaZ mecA msrA tet(K)
19 California; MSMa (8) Penr Oxar Eryr CliCon 30 blaZ mecA msrA ermC
20 California; college football team (8) Penr Oxar Eryr LvxI 30, 3.1 blaZ mecA msrA
21 California; prisoner (8) Penr Oxar Eryr LvxI 30, 3.1 blaZ mecA msrA
22 California; children (8) Penr Oxar Eryr Tetr LvxI 30, 4.3, 3.1 blaZ mecA msrA tet(K)
23 California; MSM (8) Oxar Tetr LvxI; β-lactamase negative 4.3, 3.1 mecA tet(K)
24 Missouri; professional football team Penr Oxar Eryr 30, 3.1 blaZ mecA msrA
25 California; professional football team (8) Penr Oxar Eryr 30, 3.1 blaZ mecA msrA
26 California; professional football team (8) Penr Oxar Eryr 30, 3.1 blaZ mecA msrA
27 California; professional football team (8) Penr Oxar Eryr 30, 3.1 blaZ mecA msrA
28 Pennsylvania; young adult with necrotizing pneumonia Penr Oxar Eryr 30, 3.1 blaZ mecA msrA
29 Texas; patient with influenza Penr Oxar Eryr CliInd 23, 3.1, 2.6 blaZ mecA ermC
30 Hawaii; seawater Penr Oxar; β-lactamase negative 3.1 mecA
a

MSM, men who have sex with men.

b

Cli, clindamycin; Con, constitutive; Ery, erythromycin; I, intermediate; Ind, inducible; Lvx, levofloxacin; Oxa, oxacillin; Pen, penicillin; Tet, tetracycline.

TABLE 2.

Sequences of dru regions found in 30 USA300-0114 isolatesa

dru type Sequence
9g 5′ATAAGAGGAATAGTAAAAGCAATTCTAAGTAAAATTGCAG
ATAAGAGGTTTGTTAAAAGCAGTTCTCAGTAAAATTACAG
ATAAGAGGTACGTTAAAAGCAGTTCTAAGTAAAATTGCAG
ATAAGAGGTTTGTTAAAAGCAGTTCTAAGTAAAATTGCAG
ATAAGAGGTACGTTAAAAGCAATTCCATGCAAAATTGCTG
ATAAGGGGTAAGTTAAAAGCAGTTCTCAGTAAAATTGCAG
ATAAGAGGTACGTTAAAAGCAGTTCTAGGCAAAATTGCAG
ATAAGAGGTGCGTTAAAAGCAGTTCTCAGTAAAATTGCTG
ATAAGGGGTAAGTTAAAAGCAATCCTAAGTAAAATTGCAG3′
9h 5′ATAAGAGGAATAGTAAAAGCAATTCTAAGTAAAATTGCAG
ATAAGAGGTTTGTTAAAAGCAGTTCTCAGTAAAATTACAG
ATAAGAGGTACGTTAAAAGCAGTTCTAAGTAAAATTGCAG
ATAAGAGGTTTGTTAAAAGCAGTTCTAAGTAAAATTGCAG
ATAAGAGGTACGTTAAAAGCAGTTCTAAGTAAAATTGCAG
ATAAGAGGTTTGTTAAAAGCAGTTCTAAGTAAAATTGCAG
ATAAGAGGTACGTTAAAAGCAATTCCATGCAAAATTGCTG
ATAAGGGGTAAGTTAAAAGCAGTTCTCAGTAAAATTGCAG
ATAAGAGGTACGTTAAAAGCAATCCTAAGTAAAATTGCAG3′
a

As noted in the text, type 9g was found in 29 of the 30 isolates, while type 9h was found in only 1 isolate. Sequences (from top to bottom) are listed as they occurred in tandem in the 5′ to 3′ direction. Sequence analysis was based on using ATAAGAGGTA CGTTAAAAGC AGTTCTAAGT AAAATTGCAG as the consensus sequence (30).

Plasmid characterization.

Eighteen (60%) of the 30 isolates contained 30-kb plasmids that were similar by restriction endonuclease analysis. Each 30-kb plasmid hybridized with both the blaZ and msrA probes (Table 1). Twenty-eight of the 30 isolates contained a 3.1-kb cryptic plasmid. The two isolates that lacked the 30-kb plasmid were β-lactamase negative and erythromycin susceptible. Seven tetracycline-resistant isolates each had a 4.3-kb plasmid that hybridized with the tet(K) probe. Three isolates with inducible clindamycin resistance each had a 2.6-kb plasmid that hybridized with the ermC probe. Isolate 19 was positive by PCR for ermC and showed constitutive clindamycin resistance but lacked a 2.6-kb plasmid (Table 1). The location of the ermC determinant is presumed to be chromosomal. Isolate 29, which was negative for msrA by PCR, contained a 23-kb plasmid that hybridized only with the blaZ probe.

Virulence factor characterization.

All 30 isolates were positive by PCR for lukS-PV and lukF-PV, indicating the presence of the genes encoding PVL. All 30 were negative by PCR for the genes encoding SEA, SEB, SEC, SED, SEE, and SEH and toxic shock syndrome toxin 1.

By use of Affymetrix GeneChips (Saur2a), all of the six USA300-0114 isolates were highly related, with an average of only six genes differing between any two isolates [e.g., the presence or absence of tet(K)]. USA300-0114 isolates contained 20 of the 46 putative antimicrobial resistance genes and 117 of the 289 putative virulence factor or regulatory genes represented on the Saur2a chip (Table 3).

TABLE 3.

USA300-0114 putative antimicrobial resistance and virulence factor genes

Gene COL ORF no.a COL description Result forb:
Comment
USA300-0114 USA400 USA500-0004 USA100
Resistance genes
    arsB SA1823 Arsenical pump membrane protein + + + +
    arsC SA1824 Arsenate reductase + − + −
    bacA SA0743 Bacitracin resistance protein + + + +
    blaZ AF086644-cds1 beta-Lactamase + + + +
    cadB AF134905-cds1 Low-level cadmium resistance + + + −
    ddh SA2535 2-Hydroxyacid dehydrogenase (associated with vancomycin resistance) + + + +
    fosB SA2326 Fosfomycin resistance protein + − + +
    Hypothetical SA2413 Drug resistance transporter + + + +
    Hypothetical SA0772 Aluminum resistance protein + + + +
    Hypothetical SA1327 Aluminum resistance protein + + + +
    Hypothetical SA2348 Drug transporter + + + +
    Hypothetical SA2437 Drug resistance transporter + + + +
    mecA SA0033 Penicillin-binding protein 2 + + + +
    msrA SA1397 Peptide methionine sulfoxide reductase + + + +
    msrA SA2683 Peptide methionine sulfoxide reductase + + + +
    msrA SA1459 Peptide methionine sulfoxide reductase + + + +
    msrSA AB016613-cds3 Erythromycin resistance protein + + − −
    norA SA0754 Drug transporter + + + +
    semB SA2347 Drug resistance transporter + + + +
    vga SA2036 ABC transporter + + + +
Virulence genes
    Regulatory genes
        agrA SA2026 Accessory gene regulator protein A (type 1) + + + +
        agrB SA2023 Accessory gene regulator protein B (type 1) + + + +
        agrB SA2023 Accessory gene regulator protein B (type 1) + − + − USA400 agr type III; USA100 agr type II
        agrD Accessory gene regulator protein D (type 1) + − + − USA400 agr type III; USA100 agr type II
        icaR SA2688 Intercellular adhesion regulator + + + +
        sarA SA0672 Staphylococcal accessory regulator A + + + +
        sarR SA2287 Staphylococcal accessory regulator R + + + +
        sarS (sarH1) SA0096 Staphylococcal accessory regulator S + + + +
        sarT SA2506 Staphylococcal accessory regulator T + ± + + USA400 87.5% positive
        sarU SA2507 Staphylococcal accessory regulator U + + + +
        sarV SA2258 Staphylococcal accessory regulator V + + + +
        saeS SA0765 Sensor histidine kinase + + + +
        saeR SA0766 Response regulator + + + +
        mgrA SA0746 Transcriptional regulator + + + +
        arlS SA1450 Sensor histidine kinase + + + +
        arlR SA1451 Response regulator + + + +
        rot SA1812 Transcriptional regulator + + + +
        svrA SA0416 Transcriptional regulator + + + +
        srrA SA1535 Response regulator + + + +
        TRAP SA1891 RNAIII-activating protein + + + +
        yycG SA0020 Sensory box histidine kinase + + + +
    Cell surface genes
        Amidase SA2666 N-Acetylmuramoyl-l-alanine amidase domain protein + + + +
        cap5A SA0136 Capsular polysaccharide synthesis + + + +
        cap5B SA0137 Capsular polysaccharide synthesis + + + +
        cap5C SA0138 Capsular polysaccharide synthesis + + + +
        cap5D SA0139 Capsular polysaccharide synthesis + + + +
        cap5E SA0140 Capsular polysaccharide synthesis + + + +
        cap5F SA0141 Capsular polysaccharide synthesis + + + +
        cap5G SA0142 Capsular polysaccharide synthesis + + + +
        cap5H SA0143 Capsular polysaccharide synthesis + − + + USA400 capsule type 8
        cap5I SA0144 Capsular polysaccharide synthesis + − + + USA400 capsule type 8
        cap5J SA0145 Capsular polysaccharide synthesis + − + + USA400 capsule type 8
        cap5K SA0146 Capsular polysaccharide synthesis + − + + USA400 capsule type 8
        cap5L SA0147 Capsular polysaccharide synthesis + + + +
        cap5M SA0148 Capsular polysaccharide synthesis + + + +
        cap5N SA0149 Capsular polysaccharide synthesis + + + +
        cap5O SA0150 Capsular polysaccharide synthesis + + + +
        cap5P SA0151 Capsular polysaccharide synthesis + + + +
        capA SA2687 CapA protein + + + +
        capB SA2686 CapB protein + + + +
        capC SA2685 CapC protein + + + +
        clfA Clumping factor A + + + +
        clfB SA2652 Clumping factor B + + + +
        ebh SA1472 Pathogenicity protein + − + −
        ebh SA1472 Pathogenicity protein + − + −
        ebh SA1472 Pathogenicity protein + − + −
        ebh SA1472 Pathogenicity protein + + + −
        ebh SA1472 Pathogenicity protein + ± + + USA400 87.5% positive
        ebh SA1472 Pathogenicity protein + + + +
        Hypothetical (SA1267) Similar to streptococcal adhesin emb + + + +
        icaA SA2689 IcaA protein + + + +
        icaB SA2691 IcaB protein + + + +
        icaC SA2692 IcaC protein + + + +
        icaD SA2690 IcaD protein + + + +
        isaA SA2584 Immunodominant antigen A + + + +
        isaB SA2660 Immunodominant antigen B + + + +
        sdrC SA0608 SdrC protein + + + +
        sdrE SA0610 SdrE protein + + + −
        sai-1 SA1139 29-kDa cell surface protein + + + +
        fnbA Fibronectin-binding protein A + − + −
        fnbB Fibronectin binding protein B + − + −
        Hypothetical (SA2284) Similar to accumulation- associated protein + ± + + USA400 87.5% positive
        pls homolog SA2505 LPXTG motif cell wall anchor domain protein + − + +
        Hypothetical SA2676 LPXTG motif cell wall anchor domain protein + + + +
        Hypothetical SA2676 LPXTG motif cell wall anchor domain protein + + − +
        Hypothetical Predicted ORF LPXTG motif cell wall anchor domain protein + + − +
        Hypothetical Predicted ORF LPXTG motif cell wall anchor domain protein + + + +
        Hypothetical SA1781 LPXTG motif cell wall anchor domain protein + + + +
        Hypothetical SA0119 LPXTG motif cell wall anchor domain protein + + + +
        Hypothetical SA1141 LPXTG motif cell wall anchor domain protein + + + +
        spa SA0095 Immunoglobulin G binding protein + + + +
        isdB SA1138 LPXTG motif cell wall anchor domain protein + + + +
        Hypothetical SA1806 LPXTG motif cell wall anchor domain protein + + + −
        Hypothetical SA1806 LPXTG motif cell wall anchor domain protein + + + +
        fmtB (mrp) SA2150 Cell wall protein + + + −
        fmtB (mrp) SA2150 Cell wall protein + − + −
    Exoenzymes
        aur SA2659 Aureolysin + + + +
        coa SA0209 Coagulase + + + +
        splA SA1869 Serine protease + + + +
        splB SA1868 Serine protease + + + +
        splC SA1867 Serine protease + + + +
        splD SA1866 Serine protease + + + +
        splE SA1865 Serine protease + ± + − USA400 62.5% positive
        splF Serine protease + + + +
        hysA SA2194 Hyaluronate lyase + − + − USA400 and USA500 alleles present
        geh SA0317 Lipase precursor + + + +
        sspA SA1057 V8 protease + + + +
        sspB SA1970 Serine protease + + + +
        sspB SA1056 Staphopain + + + +
        lip SA2694 Lipase + + + +
        plc SA0078 1-Phosphatidylinositol phosphodiesterase precursor + + + +
    Exotoxins and enterotoxins
        set10 (SA0386) Exotoxin 10 + + + +
        set11 (SA0387) Exotoxin 11 + + + +
        set12 (SA0388) Exotoxin 12 + + + +
        set13 SA0473 Exotoxin 5; N315 exotoxin 13 + + + +
        set14 SA0474 Exotoxin 4; N315 exotoxin 14 + + + +
        set7 SA0469 Exotoxin 2; N315 exotoxin 7 + + + +
        set8 SA0470 Exotoxin 2; N315 exotoxin 8 + + + +
        set9 (SA0385) Exotoxin 9 + + − +
        Hypothetical BAB94252_1 Similar to MW-2 exotoxin 21 + − + −
        Exotoxin 2 SA0472 Exotoxin 2 + + + +
        Exotoxin 3 SA0468 Exotoxin 3 + − + −
        Exotoxin 3 SA0478 Exotoxin 3 + − + −
        ent SA0886 Staphylococcal enterotoxin + ± + − USA400 87.5% positive
        entB SA0172 Isochorismatase + + + +
        Enterotoxin SA1657 Similar to enterotoxin A + + + +
        sei SA0887 Staphylococcal extracellular enterotoxin type I + ± + − USA400 87.5% positive
        hld SA2022 delta-Hemolysin + + + +
        hlb (SA1811) Truncated beta-hemolysin + + + +
        hlgA SA2419 gamma-Hemolysin + + + +
        hlgB SA2422 Leucocidin precursor + + + +
        hlgC SA2421 Leucocidin precursor + + + +
        lukD SA1880 Leucotoxin LukD + + + +
        lukF SA2004 Leucocidin precursor + + + +
        lukF-PV AB006796 PVL + ± − − USA400 62.5% positive
        lukM SA2006 Leucotoxin LukM + + + +
        lukS SA1881 Synergohymenotropic toxin + + + +
        lukS-PV AB006796 PVL + ± − − USA400 62.5% positive
        Hypothetical SA2295 Similar to secretory antigen precursor SsaA + + + +
        Hypothetical SA2557 Similar to secretory antigen precursor SsaA + + + +
        Hypothetical SA0507 Similar to autolysin + + + +
        ssaA SA2291 Secretory antigen precursor SsaA + + + +
a

ORFs in parentheses refer to S. aureus strain N315.

b

+, presence of gene; −, absence of gene; ±, gene was not present in any isolates of the PFT tested.

In addition to the plasmid-mediated resistance genes noted above, all USA300-0114 isolates carry the genes for arsenic (arsB and arsC) (37), bacitracin (bacA) (22), cadmium (cadD) (17), and fosfomycin (fosB) (71) resistance. The strain also contains a number of putative drug transporters, including members of the EmrB/QacA family of transporters (COL-SA2413), quinolone (norA) (70), an ABC transporter (vga), the Bcr/CflA subfamily of transporters (COL-SA2437), and the putative multidrug transport protein (COL-SA2348).

USA300-0114 isolates contain a number of virulence determinants, which can be broadly characterized as either cell surface components or extracellular elements (exoenzymes, exotoxins, and enterotoxins) (Table 3). Regarding cell surface components, USA300-0114 isolates contained all members of the capsule type 5 operon (cap5A to cap5P) and numerous adhesion genes, including clumping factor B (clfB) and clumping factor A (clfA) (Table 3). The sdr loci encode proteins with similarity to clfA and clfB that are involved in binding fibrinogen and bone (69). Both sdrC and sdrE were present, although sdrD was not. Likewise, the extracellular matrix-binding protein homologue, ebh (which is represented by several oligonucleotides on the microarray), and fnbA and fnbB (14, 32) (which encode fibronectin-binding protein) were present. All isolates tested also harbored the genes encoding eight LPXTG-containing proteins, protein A (spa), the elastin-binding protein (ebpS) (56), accumulation-associated protein (sasG) (60), and the intercellular adhesin (icaA to icaD) (16).

The USA300-0114 isolates also contained an array of extracellular virulence factors, including numerous exoenzymes, such as serine protease (splA to splF) (58), zinc metalloproteinase aureolysin (aur) (3), coagulase (coa) (57), and lipase (geh) (41) genes. The V8 protease (sspA) (59), cysteine protease (sspB and sspC) (59), and hyaluronidase (hysA) (25) genes were detected, in addition to four enterotoxin genes. These genes included ent (COL-SA0886), entB (COL-SA0172) (38), sei (COL-SA0887), and an enterotoxin family gene (COL-SA1657). USA300-0114 also harbored a number of exotoxin genes, including exotoxin 2 (COL-SA0472), exotoxin 3 (COL-SA0468), set7, set8, set9, set10, set11, set12, set13, and set14. In addition, isolates contained the genes required for α-, γ-, and at least a portion of β-hemolysin production. PVL (lukF-PV and lukS-PV), lukD and lukE leucocidin, and lukF and lukM genes were also present within USA300-0114, confirming the PCR data.

Comparison of USA300-0114 and USA500-0004 lineages.

Using GeneChips, we compared the composition of USA300-0114 to that of three other MRSA PFTs (USA100, USA400, and USA500). By microarray analysis, USA300-0114 is most closely related to USA500-0004. These two PFTs fall into the same ribogroup, and both are ST8 by MLST and agr group I, although the spa type of USA300-0114 differs by a single repeat (underlined) from that of USA500-0004 (YHGFMBQBLOversus YHGCMBQBLO, respectively) (46). Despite the relatedness of the two PFTs, USA300-0114 is most frequently associated with infections in the community and USA500-0004 is most frequently associated with infections in health care institutions (55, 65). Thus, a genome-wide comparison of the genetic compositions of USA300-0114 and USA500-0004 may identify genes that are unique to USA300-0114 or are associated with community- versus health care-associated infections.

As shown in Table 3, 131 of the 137 putative virulence or resistance determinants within USA300-0114 are also present within USA500-0004. However, six genes present within USA300-0114 were absent from USA500-0004. These genes include the msrSA locus (which is the COL annotation for the msrA erythromycin resistance gene), two hypothetical LPXTG motif-containing cell surface components, the PVL genes (lukF-PV and lukS-PV), and the COL set9 exotoxin. Recognizing that genes other than defined resistance or virulence factors may contribute to the lineage's ability to cause disease and disseminate in community settings, we expanded our analysis to identify all putative open reading frames (ORFs) that are present with USA300-0114 but absent from USA500-0004. Fifty-nine USA300-0114 genes were absent from USA500-0004 (see the supplemental material). These genes included 22 putative ORFs with either very limited or no amino acid similarity to characterized proteins, a plasmid (pSR1) replication protein, and a transposase (N315-SA0062). Interestingly, the majority of the genes that differentiate these two lineages are bacteriophage encoded. More specifically, two hypothetical phi ETA proteins, three bacteriophage phi PVL genes, and 22 phi N315 genes were present in USA300-0114 but missing from USA500-0004. It is possible that one (or more) of these phage-encoded proteins confers a selective advantage to USA300-0114 isolates in community settings.

Comparison of USA300-0114 and USA400 lineages.

We next compared the genetic composition of USA300-0114 to that of representative isolates of USA400, a less frequently observed community-associated MRSA PFT (spa type UJJJJFE, agr group III, ST1 by MLST). There were 27 virulence or antimicrobial resistance genes present within USA300-0114 that were missing from USA400 (Table 3). These included several cell surface components that are involved in fibronectin binding (fnbA, fnbB, and ebh) and three exotoxins (MW-2 exotoxin 21 and two exotoxin 3 genes [COL-SA0478 and COL-SA0468]). USA300-0114 also harbored 155 other genes that were absent from USA400 (see the supplemental material). Of these 155, 106 ORFs encoded hypothetical proteins. The remaining genes included five SaPIn2 pathogenicity island proteins, a single SaPIbov pathogenicity island protein, a bacteriophage phi PVL antirepressor, and six bacteriophage phi N315 proteins. Interestingly, with the exception of the SaPIn2 components, each of these genes is also missing from USA500 isolates. Thus, it is possible that these genes encode proteins that facilitate USA300-0114's ability to circulate and cause disease in community settings.

Comparison of USA300-0114 and USA100 lineages.

We also compared USA300-0114 to USA100 (spa type TJMBMDMGMK, agr group II, ST5 by MLST), the major health care-associated lineage in the United States (46). There were 228 genes that were present within USA300-0114 but absent from USA100, including 21 resistance or virulence determinants (Table 3) and 207 genes that have not been previously linked to pathogenesis (see the supplemental material). In comparison to USA300-0114, USA100 lacks several cell surface adhesion genes, including fnbA, fnbB, and ebh, all of which encode proteins that bind fibronectin. The USA100 isolate also appears to be missing several USA300-0114 extracellular virulence factor genes, such as PVL (lukF-PV and lukS-PV), ent, sei, and exotoxin 3 genes (COL-SA0468 and COL-SA0478).

USA300-0114-specific genes.

By comparing the microarray-derived genetic composition of each PFT (USA300-0114, USA100, USA400, and USA500-0004), we identified a number of USA300-0114-specific genes. More specifically, a total of 20 genes were conserved across all USA300-0114 isolates but were absent from the other MRSA PFTs tested. None of these genes were previously recognized S. aureus virulence determinants. These included 10 hypothetical genes, the bacteriophage phi PVL antirepressor gene (AB009866-cds33), five bacteriophage phi N315 genes (N315-SA1802 to N315-SA1806), the plasmid pSR1 rep gene (AAF99572), a plasmid-associated gene (mphBM), a recombinase (AF053772-cds1), and a SaPIbov pathogenicity island gene (AF217235-cds17) (see the supplemental material).

DISCUSSION

During our initial investigations of clusters of MRSA infections in U.S. prisons, we were surprised that MRSA isolates with indistinguishable PFGE patterns were recovered from prisoners in Mississippi, Texas, and Georgia (7, 10, 46). We were further surprised to see additional MRSA isolates with the same PFGE pattern isolated from a variety of athletes and sports teams (9, 40), military recruits (72), children from Tennessee (5) and Texas (13, 39, 66), and a large county hospital in Atlanta (34). Clearly, this MRSA strain is widely disseminated within the United States and appears to be a major cause of community-associated infections.

USA300-0114 is ST8 by MLST, which differs by one or two loci from previously described representatives of the archaic (ST250) and Iberian (ST247) clones (24, 63, 65). The USA300-0114 isolates also share a common spa type motif (MBQBLO) and most likely evolved from a common ancestor with a genotype of the early archaic strains of the 1960s (55). All four SCCmec types have been identified among MRSA of ST8 (23, 24, 36), although USA300-0114 is exclusively type IVa. Most USA300-0114 isolates are resistant only to β-lactams and macrolides, although plasmid-mediated resistance markers, such as tetracycline and clindamycin resistance, mediated by tet(K) and ermC, respectively, are starting to appear.

Microarray analysis confirms that, in general, USA300 isolates are highly related to USA500 isolates. However, USA500 isolates are typically multiply resistant and are more likely to cause health care-associated infections than infections in community settings. When we compared the profiles of genes present within USA300 but missing from USA500, the community-associated lineage USA400, and the major health care-associated lineage USA100, several differences became apparent. First, USA300 harbors sequences from (i) a number of bacteriophages, including phi PVL and phi N315, (ii) the SaPIn2 pathogenicity island, (iii) the SaPIbov pathogenicity island, and (iv) the genes encoding a number of fibronectin-binding proteins that are missing either totally or in part from the isolates of the other PFTs surveyed. These factors may bekey contributors to USA300's ability to cause infection in diverse patient populations. For instance, despite the high degree of relatedness between USA300 and USA500, the latter strain lacks members of the bacteriophage phi PVL and phi N315 gene sets. These factors are also absent from the major hospital PFT, USA100, suggesting that they may be essential for pathogenesis in the community setting. Indeed, phi PVL (lukF-PV and lukS-PV) genes are thought to distinguish community from health care isolates (2, 20, 43, 50). Moreover, a comparison of the two community-associated MRSA PFTs, USA300 and USA400, indicates that all of the USA400 isolates examined are missing the fibronectin-binding proteins, fnbA, fnbB, and ebh, as well as SaPIn2 and several but not all phi N315 genes, suggesting that these components may contribute to the virulence of the USA300-0114 isolates. These results also indicate that although both community-associated MRSA lineages harbor the PVL toxin genes (which health care-associated lineages typically do not), other factors distinguish these lineages from health care-associated isolates. Based on these comparisons, 20 genes or hypothetical genes unique to USA300-0114 isolates have been identified. Other PFTs contain some but not all of these 20 genes. It is likely that USA300 isolates contain additional virulence loci that are not represented on the Saur2a chip and that are yet to be elucidated.

The microarray-based procedure used here monitored the presence or absence of both well-studied virulence determinants (Table 3) and genes and ORFs that have not previously been shown to influence pathogenesis directly (see the supplemental material). It is likely that there are unrecognized virulence and other factors (51) in addition to latter collection of determinants. The genes that were identified in our analysis, including many bacteriophage-encoded proteins, may represent a series of new virulence factors which collectively facilitate the organism's ability to both circulate and cause infection within diverse environmental conditions and in diverse populations. Although 20 USA300-0114-specific and hypothetical genes have been identified in this study, it is difficult to know whether these genes are actively transcribed, translated, and functional or are in fact silent. These factors may be expressed only in specific environmental settings, such as those that are encountered during the course of infection. Further characterization of these genes and their protein products is expected to facilitate our understanding of the pathogenic potential of USA300-0114 and may lead to strategies that attenuate the strain.

In conclusion, USA300-0114 is a highly stable strain of S. aureus that is primarily responsible for community-associated infections in the United States. This strain continues to evolve its antimicrobial resistance profile through plasmid acquisition. Its natural reservoir remains an open question.

Supplementary Material

[Supplemental material]

Acknowledgments

We thank Jana Swenson, Patti Raney, Jasmine Chaitram, and David Lonsway for assistance with antimicrobial susceptibility testing and Sigrid McAllister for identification of the isolates.

Use of trade names is for identification purposes only and does not constitute endorsement by the Public Health Service or the U.S. Department of Health and Human Services.

Footnotes

†

Supplemental material for this article may be found at http://jcm.asm.org/.

REFERENCES

  • 1.Aires de Sousa, M., H. de Lencastre, I. Santos Sanches, K. Kikuchi, K. Totsuka, and A. Tomasz. 2000. Similarity of antibiotic resistance patterns and molecular typing properties of methicillin-resistant Staphylococcus aureus isolates widely spread in hospitals in New York City and in a hospital in Tokyo, Japan. Microb. Drug Resist. 6:253-258. [DOI] [PubMed] [Google Scholar]
  • 2.Baba, T., F. Takeuchi, M. Kuroda, H. Yuzawa, K. Aoki, A. Oguchi, Y. Nagai, N. Iwama, K. Asnao, T. Naimi, H. Kuroda, L. Cui, K. Yamamoto, and K. Hiramasu. 2002. Genome and virulence determinants of high virulence community-acquired MRSA. Lancet 359:1819-1827. [DOI] [PubMed] [Google Scholar]
  • 3.Banbula, A., J. Potempa, J. Travis, C. Fernandez-Catalan, K. Mann, R. Huber, W. Bode, and F. Medrano. 1998. Amino-acid sequence and three-dimensional structure of the Staphylococcus aureus metalloproteinase at 1.72 A resolution. Structure 6:1185-1193. [DOI] [PubMed] [Google Scholar]
  • 4.Bannerman, T. L. 2003. Staphylococcus, Micrococcus, and other catalase-positive cocci that grow aerobically, p. 384-404. In P. R. Murray, E. J. Baron, J. H. Jorgensen, M. A. Pfaller, and R. H. Yolken (ed.), Manual of clinical microbiology, 8th ed. ASM Press, Washington, D.C.
  • 5.Buckingham, S. C., L. K. McDougal, L. D. Cathey, K. Comeaux, A. S. Craig, S. K. Fridkin, and F. C. Tenover. 2004. Emergence of community-associated methicillin-resistant Staphylococcus aureus at a Memphis, Tennessee children's hospital. Pediatr. Infect. Dis. J. 23:619-624. [DOI] [PubMed] [Google Scholar]
  • 6.Centers for Disease Control and Prevention. 1999. Four pediatric deaths from community-acquired methicillin-resistant Staphylococcus aureus—Minnesota and North Dakota, 1997-1999. Morb. Mortal. Wkly. Rep. 48:707-710. [PubMed] [Google Scholar]
  • 7.Centers for Disease Control and Prevention. 2001. Methicillin-resistant Staphylococcus aureus skin or soft tissue infections in a state prison—Mississippi, 2000. Morb. Mortal. Wkly. Rep. 50:919-922. [PubMed] [Google Scholar]
  • 8.Centers for Disease Control and Prevention. 2003. Public health dispatch: outbreaks of community-associated methicillin-resistant Staphylococcus aureus skin infections—Los Angeles County, California, 2002-2003. Morb. Mortal. Wkly. Rep. 52:88-89. [PubMed] [Google Scholar]
  • 9.Centers for Disease Control and Prevention. 2003. Methicillin-resistant Staphylococcus aureus infections among competitive sports participants—Colorado, Indiana, Pennsylvania, and Los Angeles County, 2000-2003. Morbid. Mortal. Wkly. Rep. 52:793-795. [PubMed] [Google Scholar]
  • 10.Centers for Disease Control and Prevention. 2003. Methicillin-resistant Staphylococcus aureus infections in correctional facilities—Georgia, California, and Texas, 2001-2003. Morbid. Mortal. Wkly. Rep. 52:992-996. [PubMed] [Google Scholar]
  • 11.Chambers, H. 2001. The changing epidemiology of Staphylococcus aureus? Emerg. Infect. Dis. 7:178-182. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Charlebois, E. D., D. R. Bangsberg, N. J. Moss, M. R. Moore, A. R. Moss, H. F. Chambers, and F. Perdreau-Remington. 2002. Population-based community prevalence of methicillin-resistant Staphylococcus aureus in the urban poor of San Francisco. Clin. Infect. Dis. 34:425-433. [DOI] [PubMed] [Google Scholar]
  • 13.Chavez-Bueno, S., B. Bozdogan, K. Katz, K. L. Bowlware, N. Cushion, D. Cavuoti, N. Ahmad, G. H. McCracken, Jr., and P. C. Appelbaum. 2005. Inducible clindamycin resistance and molecular epidemiologic trends of pediatric community-acquired methicillin-resistant Staphylococcus aureus in Dallas, Texas. Antimicrob. Agents Chemother. 49:2283-2288. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Clarke, S. R., L. G. Harris, R. G. Richards, and S. J. Foster. 2002. Analysis of Ebh, a 1.1-megadalton cell wall-associated fibronectin-binding protein of Staphylococcus aureus. Infect. Immun. 70:6680-6687. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Clinical and Laboratory Standards Institute. 2005. Performance standards for antimicrobial susceptibility testing. Fifteenth informational supplement M100-S15. Clinical and Laboratory Standards Institute, Wayne, Pa.
  • 16.Cramton, S. E., C. Gerke, N. F. Schnell, W. W. Nichols, and F. Gotz. 1999. The intercellular adhesion (ica) locus is present in Staphylococcus aureus and is required for biofilm formation. Infect. Immun. 67:5427-5433. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Crupper, S. S., V. Worrell, G. C. Stewart, and J. J. Iandolo. 1999. Cloning and expression of cadD, a new cadmium resistance gene of Staphylococcus aureus. J. Bacteriol. 181:4071-4075. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Deplano, A., W. Witte, W. J. van Leeuwen, Y. Brun, and M. J. Struelens. 2000. Clonal dissemination of epidemic methicillin-resistant Staphylococcus aureus in Belgium and neighboring countries. Clin. Microbiol. Infect. 6:239-245. [DOI] [PubMed] [Google Scholar]
  • 19.Deresinski, S. 2005. Methicillin-resistant Staphylococcus aureus: an evolutionary, epidemiologic, and therapeutic odyssey. Clin. Infect. Dis. 40:526-573. [DOI] [PubMed] [Google Scholar]
  • 20.Dufour, P., Y. Gillet, M. Bes, G. Lina, F. Vandenesch, D. Floret, J. Etienne, and H. Richet. 2002. Community-acquired methicillin-resistant Staphylococcus aureus infections in France: emergence of a single clone that produces Panton-Valentine leukocidin. Clin. Infect. Dis. 35:819-824. [DOI] [PubMed] [Google Scholar]
  • 21.Dunman, P. M., W. Mounts, F. McAleese, F. Immermann, D. Macapagal, E. Marsilio, L. McDougal, F. C. Tenover, P. A. Bradford, P. J. Petersen, S. J. Projan, and E. Murphy. 2004. Uses of Staphylococcus aureus GeneChips in genotyping and genetic composition analysis. J. Clin. Microbiol. 42:4275-4283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.El Ghachi, M., A. Bouhss, D. Blanot, and D. Mengin-Lecreulx. 2004. The bacA gene of Escherichia coli encodes an undecaprenyl pyrophosphate phosphatase activity. J. Biol. Chem. 279:30106-30113. [DOI] [PubMed] [Google Scholar]
  • 23.Enright, M. C., N. P. Day, C. E. Davies, S. J. Peacock, and B. G. Spratt. 2000. Multilocus sequence typing for characterization of methicillin-resistant and methicillin-susceptible clones of Staphylococcus aureus. J. Clin. Microbiol. 38:1008-1015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Enright, M. C., D. Robinson, G. Randle, E. J. Feil, H. Grundmann, and B. G. Spratt. 2002. The evolutionary history of methicillin-resistant Staphylococcus aureus (MRSA). Proc. Natl. Acad. Sci. USA 99:7689-7692. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Farrell, A. M., D. Taylor, and K. T. Holland. 1995. Cloning, nucleotide sequence determination and expression of the Staphylococcus aureus hyaluronate lyase gene. FEMS Microbiol. Lett. 130:81-85. [DOI] [PubMed] [Google Scholar]
  • 26.Fey, P. D., B. Said-Salim, M. E. Rupp, S. H. Hinrichs, D. J. Boxrud, C. C. Davis, B. N. Kreiswirth, and P. M. Schlievert. 2003. Comparative molecular analysis of community- or hospital-acquired methicillin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 47:196-203. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Fridkin, S. K., J. C. Hageman, M. Morrison, L. T. Sanza, K. Como-Sabetti, J. A. Jernigan, K. Harriman, L. H. Harrison, R. Lynfield, M. M. Farley, et al. 2005. Methicillin-resistant Staphylococcus aureus disease in three communities. N. Engl. J. Med. 352:1436-1444. [DOI] [PubMed] [Google Scholar]
  • 28.Gillet, Y., B. Issartel, P. Vanhems, J.-C. Fournet, G. Lina, M. Bes, F. Vandenesch, Y. Piémont, N. Brousse, D. Floret, and J. Etienne. 2002. Association between Staphylococcus aureus strains carrying gene for Panton-Valentine leukocidin and highly lethal necrotising pneumonia in young immunocompetent patients. Lancet 359:753-759. [DOI] [PubMed] [Google Scholar]
  • 29.Goering, R. V., D. Morrison, K. F. C. Kooper, Z. Al-Doori, G. F. S. Edwards, and C. G. Gemmell. 2003. Improved tracking of epidemic methicillin-resistant Staphylococcus aureus in Scotland using a combination of pulsed field gel electrophoresis and mec-associated dru sequences, p. 1581. Abstr. 13th Eur. Congr. Clin. Microbiol. Infect. Dis.
  • 30.Goering, R. V., D. Morrison, K. F. C. Cooper, Z. Al-Doori, G. F. S. Edwards, and C. G. Gemmell. 2004. Usefulness of mec-associated dru sequences inmonitoring the spread of highly clonal epidemic methicillin-resistant Staphylococcus aureus isolates in Scotland, p. 582. 14th Eur. Congr. Clin. Microbiol. Infect. Dis. [DOI] [PubMed]
  • 31.Groom, A. V., D. H. Wolsey, T. S. Naimi, K. Smith, S. Johnson, D. Boxrud, K. A. Moore, and J. E. Cheek. 2001. Community-acquired methicillin-resistant Staphylococcus aureus in a rural American Indian community. JAMA 286:1201-1205. [DOI] [PubMed] [Google Scholar]
  • 32.Grundmeier, M., M. Hussain, P. Becker, C. Heilmann, G. Peters, and B. Sinha. 2004. Truncation of fibronectin-binding proteins in Staphylococcus aureus strain Newman leads to deficient adherence and host cell invasion due to loss of the cell wall anchor function. Infect. Immun. 72:7155-7163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Herold, B. C., L. C. Immergluck, M. C. Maranan, D. S. Lauderdale, R. E. Gaskin, S. Boyle-Vavra, C. D. Leitch, and R. S. Daum. 1998. Community-acquired methicillin-resistant Staphylococcus aureus in children with no identified predisposing risk. JAMA 279:593-598. [DOI] [PubMed] [Google Scholar]
  • 34.Hidron, A. I., E. V. Kourbatova, J. S. Halvosa, B. J. Terrell, L. K. McDougal, F. C. Tenover, H. M. Blumberg, and M. D. King. 2005. Risk factors for colonization with methicillin-resistant Staphylococcus aureus (MRSA) in patients admitted to an urban hospital: emergence of community-associated MRSA nasal carriage. Clin. Infect. Dis. 41:159-166. [DOI] [PubMed] [Google Scholar]
  • 35.Issartel, B., A. Tristan, S. Lechevallier, F. Bruyere, G. Lina, B. Garin, F. Lacassin, M. Bes, F. Vandenesch, and J. Etienne. 2005. Frequent carriage of Panton-Valentine leucocidin genes by Staphylococcus aureus isolates from surgically drained abscesses. J. Clin. Microbiol. 43:3203-3207. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Ito, T., Y. Katayama, K. Asada, N. Mori, K. Tsutsuminnnnoto, C. Tiensasitorn, and K. Hiramatsu. 2001. Structural comparison of three types of staphylococcal cassette chromosome mec integrated in the chromosome in methicillin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 45:1323-1336. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Ji, G., and S. Silver. 1992. Reduction of arsenate to arsenite by the ArsC protein of the arsenic resistance operon of Staphylococcus aureus plasmid pI258. Proc. Natl. Acad. Sci. USA 89:9474-9478. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Jones, C. L., and S. A. Khan. 1986. Nucleotide sequence of the enterotoxin B gene from Staphylococcus aureus. J. Bacteriol. 166:29-33. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Kaplan, S. L., K. G. Hulten, B. E. Gonzalez, W. A. Hammerman, L. Lamberte, J. Versalovic, and E. O. Mason. 2005. Three-year surveillance of community-acquired Staphylococcus aureus infections in children. Clin. Infect. Dis. 40:1785-1791. [DOI] [PubMed] [Google Scholar]
  • 40.Kazakova, S. V., J. C. Hageman, M. K. Matava, A. Srinivasan, L. Phelan, B. Garfinkel, T. Boo, S. McAllister, J. Anderson, B. Jensen, D. Dodson, D. Lonsway, L. McDougal, M. Arduino, V. J. Fraser, G. Killgore, F. C. Tenover, S. Cody, and D. B. Jernigan. 2005. A clone of methicillin-resistant Staphylococcus aureus among professional football players. N. Engl. J. Med. 352:468-475. [DOI] [PubMed] [Google Scholar]
  • 41.Lee, C. Y., and J. J. Iandolo. 1986. Lysogenic conversion of staphylococcal lipase is caused by insertion of the bacteriophage L54a genome into the lipase structural gene. J. Bacteriol. 166:385-391. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Lee, N. E., M. M. Taylor, E. Bancroft, P. J. Ruane, M. Morgan, L. McCoy, and P. A. Simon. 2005. Risk factors for community-associated methicillin-resistant Staphylococcus aureus skin infections among HIV-positive men who have sex with men. Clin. Infect. Dis. 40:1529-1534. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Lina, G., Y. Piemont, F. Godail-Gamot, M. Bes, M.-O. Peter, V. Gauduchon, F. Vandenesch, and J. Etienne. 1999. Involvement of Panton-Valentine leukocidin-producing Staphylococcus aureus in primary skin infections and pneumonia. Clin. Infect. Dis. 29:1128-1132. [DOI] [PubMed] [Google Scholar]
  • 44.Lindenmayer, J. M., S. Schoenfeld, R. O'Grady, and J. K. Carney. 1998. Methicillin-resistant Staphylococcus aureus in a high school wrestling team and the surrounding community. Arch. Intern. Med. 158:895-899. [DOI] [PubMed] [Google Scholar]
  • 45.Lowy, F. D. 1998. Staphylococcus aureus infections. N. Engl. J. Med. 339:520-532. [DOI] [PubMed] [Google Scholar]
  • 45a.McDougal, L. K., J. B. Patel, and F. C. Tenover. 2005. Diversity of plasmid profiles among isolates of a highly stable pulsed-field gel electrophoresis type of community-associated methicillin-resistant Staphylococcus aureus, p. 44. Abstr. 105th Gen. Meet. Am. Soc. Microbiol. 2005. American Society for Microbiology, Washington, D.C.
  • 46.McDougal, L. K., C. D. Steward, G. E. Killgore, J. M. Chaitram, S. K. McAllister, and F. C. Tenover. 2003. Pulsed-field gel electrophoresis typing of oxacillin-resistant Staphylococcus aureus isolates from the United States: establishing a national database. J. Clin. Microbiol. 41:5113-5120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Moore, P. C. L., and J. A. Lindsay. 2001. Genetic variation among hospital isolates of methicillin-sensitive Staphylococcus aureus: evidence for horizontal transfer of virulence genes. J. Clin. Microbiol. 39:2760-2767. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Nahvi, M. D., J. E. Fitzgibbon, J. F. John, and D. T. Dubin. 2001. Sequence analysis of dru regions from methicillin-resistant Staphylococcus aureus and coagulase-negative staphylococcal isolates. Microb. Drug Resist. 7:1-12. [DOI] [PubMed] [Google Scholar]
  • 49.Naimi, T. S., K. H. LeDell, D. J. Boxrud, A. V. Groom, C. D. Steward, S. K. Johnson, J. M. Besser, C. O'Boyle, R. N. Danila, J. E. Cheek, M. T. Osterholm, K. A. Moore, and K. E. Smith. 2001. Epidemiology and clonality of community-acquired methicillin-resistant Staphylococcus aureus in Minnesota, 1996-1998. Clin. Infect. Dis. 33:990-996. [DOI] [PubMed] [Google Scholar]
  • 50.Naimi, T. S., K. H. LeDell, K. Como-Sabetti, S. M. Borchardt, D. J. Boxrud, J. Etienne, S. K. Johnson, F. Vandenesch, S. Fridkin, C. O'Boyle, R. N. Danila, and R. Lynfield. 2003. Comparison of community- and health care-associated methicillin-resistant Staphylococcus aureus infection. JAMA 290:2976-2984. [DOI] [PubMed] [Google Scholar]
  • 51.Narui, K., N. Noguchi, K. Wakasugi, and M. Sasatsu. 2002. Cloning and characterization of a novel chromosomal drug efflux gene in Staphylococcus aureus. Biol. Pharm. Bull. 25:1533-1536. [DOI] [PubMed] [Google Scholar]
  • 52.National Committee for Clinical Laboratory Standards. 2003. Methods for dilution antimicrobial susceptibility test for bacteria that grow aerobically, 6th ed., vol. 23, no. 2. Approved standard M7-A6. NCCLS, Wayne, Pa.
  • 53.O'Brien, F. G., J. W. Pearman, M. Gracey, T. V. Riley, and W. B. Grubb. 1999. Community strain of methicillin-resistant Staphylococcus aureus involved in a hospital outbreak. J. Clin. Microbiol. 37:2858-2862. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Okuma, K., K. Iwakawa, J. D. Turnidge, W. B. Grubb, J. M. Bell, F. G. O'Brien, G. W. Coombs, J. W. Pearman, F. C. Tenover, M. Kapi, C. Tiensasitorn, T. Ito, and K. Hiramatsu. 2002. Dissemination of new methicillin-resistant Staphylococcus aureus clones in the community. J. Clin. Microbiol. 40:4280-4294. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Oliveira, D. C., A. Tomasz, and H. de Lencastre. 2001. The evolution of pandemic clones of methicillin-resistant Staphylococcus aureus: identification of two ancestral genetic backgrounds and associated mec elements. Microb. Drug Resist. 7:349-361. [DOI] [PubMed] [Google Scholar]
  • 56.Park, P. W., T. J. Broekelmann, B. R. Mecham, and R. P. Mecham. 1999. Characterization of the elastin binding domain in the cell-surface 25-kDa elastin-binding protein of Staphylococcus aureus (EbpS). J. Biol. Chem. 274:2845-2850. [DOI] [PubMed] [Google Scholar]
  • 57.Phonimdaeng, P., M. O'Reilly, P. Nowlan, A. J. Bramley, and T. J. Foster. 1990. The coagulase of Staphylococcus aureus 8325-4. Sequence analysis and virulence of site-specific coagulase-deficient mutants. Mol. Microbiol. 4:393-404. [DOI] [PubMed] [Google Scholar]
  • 58.Reed, S. B., C. A. Wesson, L. E. Liou, W. R. Trumble, P. M. Schlievert, G. A. Bohach, and K. W. Bayles. 2001. Molecular characterization of a novel Staphylococcus aureus serine protease operon. Infect. Immun. 69:1521-1527. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Rice, K., R. Peralta, D. Bast, J. de Azavedo, and M. J. McGavin. 2001. Description of staphylococcus serine protease (ssp) operon in Staphylococcus aureus and nonpolar inactivation of sspA-encoded serine protease. Infect. Immun. 69:159-169. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Roche, F. M., M. Meehan, and T. J. Foster. 2003. The Staphylococcus aureus surface protein SasG and its homologues promote bacterial adherence to human desquamated nasal epithelial cells. Microbiology 149:2759-2767. [DOI] [PubMed] [Google Scholar]
  • 61.Roman, R. S., J. Smith, M. Walker, S. Byrne, K. Ramotar, B. Dycjk, A. Kabani, and L. E. Nicolle. 1997. Rapid geographic spread of a methicillin-resistant Staphylococcus aureus strain. Clin. Infect. Dis. 25:698-705. [DOI] [PubMed] [Google Scholar]
  • 62.Saiman, L., M. O'Keefe, P. L. Graham, F. Wu, B. Said-Salim, B. Kreiswirth, A. LaSala, P. M. Schlievert, and P. Della-Latta. 2003. Hospital transmission of community-acquired methicillin-resistant Staphylococcus aureus among postpartum women. Clin. Infect. Dis. 37:1313-1319. [DOI] [PubMed] [Google Scholar]
  • 63.Sa-Leao, R., I. Santos Sanches, D. Dias, I. Peres, R. M. Barros, and H. de Lencastre. 1999. Detection of an archaic clone of Staphylococcus aureus with low-level resistance to methicillin in a pediatric hospital in Portugal and in international samples: relics of a formerly widely disseminated strain? J. Clin. Microbiol. 37:1913-1920. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Salgado, C. D., B. M. Farr, and D. P. Calfee. 2003. Community-acquired methicillin-resistant Staphylococcus aureus: a meta-analysis of prevalence and risk factors. Clin. Infect. Dis. 36:131-139. [DOI] [PubMed] [Google Scholar]
  • 65.Santos Sanches, I., M. Ramirez, H. Troni, M. Abecassis, M. Padua, A. Tomasz, and H. de Lencastre. 1995. Evidence for the geographic spread of a methicillin-resistant Staphylococcus aureus clone between Portugal and Spain. J. Clin. Microbiol. 33:1243-1246. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Sattler, C., E. O. Mason, and S. L. Kaplan. 2002. Prospective comparison of risk factors and demographic and clinical characteristics of community-acquired, methicillin-resistant versus methicillin-susceptible Staphylococcus aureus infection in children. Pediatr. Infect. Dis. J. 21:910-916. [DOI] [PubMed] [Google Scholar]
  • 67.Shopsin, B., M. Gomez, S. O. Montgomery, D. H. Smith, M. Waddington, D. E. Dodge, D. A. Bost, M. Riehman, S. Naidich, and B. N. Kreiswirth. 1999. Evaluation of protein A gene polymorphic region DNA sequencing for typing of Staphylococcus aureus strains. J. Clin. Microbiol. 37:3556-3563. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Sutcliffe, J., T. Grebe, A. Tait-Kamradt, and L. Wondrack. 1996. Detection of erythromycin-resistant determinants by PCR. Antimicrob. Agents Chemother. 40:2562-2566. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Tung, H., B. Guss, U. Hellman, L. Persson, K. Rubin, and C. Ryden. 2000. A bone sialoprotein-binding protein from Staphylococcus aureus: a member of the staphylococcal Sdr family. Biochem. J. 345:611-619. [PMC free article] [PubMed] [Google Scholar]
  • 70.Yu, J. L., L. Grinius, and D. C. Hooper. 2002. NorA functions as a multidrug efflux protein in both cytoplasmic membrane vesicles and reconstituted proteoliposomes. J. Bacteriol. 184:1370-1377. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Zilhao, R., and P. Courvalin. 1990. Nucleotide sequence of the fosB gene conferring fosfomycin resistance in Staphylococcus epidermidis. FEMS Microbiol. Lett. 56:267-272. [DOI] [PubMed] [Google Scholar]
  • 72.Zinderman, C. E., B. Conner, M. A. Malakooti, J. E. LaMar, A. Armstrong, and B. K. Bohnker. 2004. Community-acquired methicillin-resistant Staphylococcus aureus among military recruits. Emerg. Infect. Dis. 10:941-944. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

[Supplemental material]

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES