Pathological, immunohistochemical and molecular studies on rutin's protective effects against water hardness‐induced cytotoxicity in Nile tilapia, Oreochromis niloticus

Abstract

Elevated water hardness (HW) level could negatively impact the health of various kinds of fish, especially Nile tilapia. The current work aimed to explore the cytoprotective role of rutin (RUT), a natural antioxidant, against HW‐induced cell injury in Nile tilapia, and to find the possible mechanistic pathways underlying this protection. Sixty monosex fish were allocated into four different experimental groups (n = 15): control, RUT (1 g/kg), HW‐exposed group (300 ppm) and HW + RUT group. The daily exposure of fish to elevated HW for 90 days significantly altered the haematological profile, increased malondialdehyde (MDA) and nitric oxide (NO) levels and reduced the antioxidant enzyme activity. Additionally, it elevated the serum levels of both liver and kidney function biomarkers, alongside pronounced histopathological alterations in gills, the liver and kidneys. Mechanistically, the HW markedly increased the expression of either gene or protein levels of iNOS, casp‐3, CYP1A1, MT‐1 and Hsp70 in both the liver and kidneys, alongside strong proliferating cell nuclear antigen (PCNA) immunoexpression in the gills. In contrast, dietary RUT effectively ameliorated the toxicological alterations induced by elevated HW, contributing to the enhancement of immune and antioxidant defence mechanisms, which therefore reduced the aforementioned cell signalling pathways. In conclusion, the potent antioxidant, anti‐apoptotic and immunostimulant properties of RUT can contribute to reducing HW‐induced toxicity in Nile tilapia.

1. INTRODUCTION

Appropriate water quality parameters have a major impact on aquaculture. Improper conditions of this fish environment disrupt ecosystems, harm fish health and reduce overall productivity. The term water hardness denotes the concentration of divalent ions, particularly calcium (Ca²⁺) and magnesium (Mg²⁺), that are commonly found in ecosystems (Baldisserotto, 2011). Water hardness (HW) is influenced mainly by the regional soil composition and the concentration of divalent ions within those soils (Hammer, 2020). The source of HW was described by Boyd (2015), who explained that calcium and magnesium typically enter water through the dissolution of minerals such as limestone and calcium silicate. Surface water acquires hardness when it comes into contact with these minerals in exposed rocks or soils (Akram & Rehman, 2018). Rainwater CO₂ and soil respiration boost mineral dissolution as water percolates through soil (Binet et al., 2020). This process is amplified in limestone aquifers, resulting in hard water. Generally, water could be categorized as soft (< 60 mg/L), moderately hard (61–120 mg/L), hard (121–180 mg/L) and very hard (> 180 mg/L) based on its source and location (USGS, 2016). de Holanda Cavalcante et al. (2012) revealed that the optimal level of HW for Nile tilapia aquaculture ranges between 55 and 150 mg/L. HW causes severe stress to aquatic organisms, leading to impaired growth performance, disturbed ion balance, altered energy metabolism and possible tissue injury (Sinha et al., 2022). Swain et al. (2020) demonstrated that HW influences fish reproductive behaviour and physiology.

The continued exposure of aquatic organisms to the negative impacts of high HW necessitates finding an effective solution. It has been demonstrated that dietary supplements containing herbal immunostimulants and antioxidants can enhance the health of fish (Ahmed et al., 2022). RUT (quercetin‐3‐O‐rutinoside), a flavonoid found in various traditional Chinese plants such as buckwheat, tea and apple, is one of these supplements (Dong et al., 2021). This compound possesses multiple biological activities, including immunostimulant, antioxidant, anti‐apoptotic, anti‐autophagic and anti‐inflammatory effects (Bae et al., 2012; Ghorbani, 2017; Machawal & Kumar, 2014; Mascaraque et al., 2014). Dietary supplementation with RUT has been found to reduce the inflammatory response caused by Aeromonas hydrophila, prevent infection‐induced apoptosis, lower oxidative stress and enhance antioxidant defences of silver catfish (da Rosa et al., 2019). RUT provides protective effects against intracerebral haemorrhage (ICH) in zebra fish by reducing oxidative stress and suppressing inflammatory responses (Rana et al., 2022). Adding RUT to the diet of tilapia has shown notable benefits, including improved growth performance, enhanced antioxidant activity and decreased injury of many tissues (Deng et al., 2019). Another study showed that dietary supplementation with RUT has been shown to improve growth performance, boost antioxidant capacity and promote intestinal health in yellow catfish (Liu et al., 2023).

Despite increasing studies exploring the biological and pharmacological effects of rutin in many experimental animal models, there is no available literature about its potential to protect Nile tilapia from stress‐induced tissue damage. Therefore, the current study intended to determine the potential molecular pathways underlying the cytoprotective effect of RUT against stress‐mediated gills and hepatorenal damage driven by daily exposure of Nile tilapia to HW. It can be achieved by assessing growth performance, haematological parameters, organ function biomarkers, oxidative stress markers, histopathological examination, and measuring the expression levels of iNOS, casp‐3, PCNA, CYP1A1, MT‐1 and Hsp70 in both liver and kidney tissues.

2. MATERIALS AND METHODS

2.1. Preparation of RUT‐supplemented diet (1 g/kg feed)

RUT (purity >98%, Loba Chemie, India) was dissolved in 100 mL of warm water, sprayed onto 1 kg of feed pellets, mixed thoroughly and dried at 30°C–40°C in a ventilated oven.

2.2. Preparation of 300 ppm hard water

HW (300 ppm) was prepared according to the Environmental Protection Agency (EPA, 2019). Stock A (19.84 g MgCl₂) and 46.24 g CaCl₂ per litre of deionized water and Stock B (35.02 g NaHCO₃) per litre of deionized water were sterilized; 6 mL of Stock A and 8 mL of Stock B were added to 1 L of deionized water, stirred and pH adjusted to ≈ 7.0.

2.3. Fish culturing and treatments

The care and use of the fish in this study complied with the istitutional animal care and use commitee (IACUC), guidelines and policies set out by Cairo University (IACUC protocole number: Vet Cu 131020241015). Sixty monosex Nile tilapia (Oreochromis niloticus; 69.2 ± 20 g/fish) were obtained from a local aquaculture facility located in Kafr El‐Shaikh Governorate, Egypt, and maintained in 90‐L glass tanks under continuous aeration. To ensure their general health, fish were acclimated for 2 weeks before receiving certain treatments. Fish were fed a commercial diet composed of the following nutritional ingredients: 30% crude protein, 6.29% crude fibres, 6% lipid, 65% fish meal, 3990 kcal, 60% gluten, 60% choline chloride, wheat bran, yellow corn, 46% soybean meal, mono calcium phosphate, distillers dried grains with soluble, vitamins and mineral premix (Skretting Com., El Sharqia, Egypt). The fish were manually fed the commercial diet twice daily at a feeding rate equivalent to 2% of their body weight.

After an acclimation period, the fish were randomly allocated to four experimental groups in three replicates (five fish/replicate/group). The groups received the following materials daily for 90 days: group I (control) was maintained in fisheries water with an optimal hardness level below 120 ppm. Group II (RUT) was exposed to the same water conditions as the control group but received a RUT‐supplemented diet (1 g/kg). Group III (HW) was exposed to 300 ppm HW, and group IV (HW + RUT) was given a rutin‐supplemented diet (1 g/kg of feed) and exposed to 300 ppm HW. Water hardness and alkalinity were regularly monitored and corrected as necessary. The dose of RUT used in this study was chosen from a previous study conducted on grass carp, due to their similar physiological characteristics (Evans et al., 2013). All fish were checked every day for any unusual clinical symptoms or death.

2.4. Water quality measurements

Water pH, electrical conductivity (EC) and total dissolved solids (TDS) were monitored every week using a digital Mini‐pH Meter (HI 9835, USA). Additionally, dissolved oxygen (DO) was maintained at above 7.0 mg/L, pH 6.5–7.2 and total ammonia <0.05 mg/L (Boyd, 2017). The titration method was used for measuring HW, chloride and alkalinity (Eaton et al., 2005).

2.5. Growth performance

Each fish was individually weighed to determine the initial (IBW) and final body weights (FBW). Subsequently, the weight gain (WG), feed conversion ratio (FCR) and specific growth rate (SGR) were calculated to assess growth performance, as described by Abdel Rahman et al. (2021):

$$\mathrm{SGR}\left(\%\right)=\left\{\mathrm{LN}\left(\mathrm{FBW}\right)-\mathrm{LN}\left(\mathrm{IBW}\right)/\text{time}\right\}\times 100,\text{where}\mathrm{LN}=\text{natural}\log$$

$$\mathrm{WG}\left(\mathrm{g}/\text{fish}\right)=\mathrm{FBW}-\mathrm{IBW}$$

$$\mathrm{FCR}=\mathrm{dry}\text{feed}\mathrm{fed}\left(\mathrm{g}\right)/\mathrm{WG}\left(\mathrm{g}\right)$$

2.6. Sampling

Whole blood samples were drawn from the caudal vein and separated into two sections: one was collected on EDTA for haematological analysis, whereas the other was left to stand without anticoagulant and centrifuged for 10 min at 5000 rpm to extract serum samples for various biochemical parameters. Fish were anaesthetized by 20 mg/L clove oil, and organs were collected. Samples from gills, the liver and kidneys were preserved in 10% formalin solution for microscopic examination. Other samples were persevered in 80°C for gene analysis.

2.7. Haematology

Red blood corpuscles (RBCs) and white blood corpuscles (WBCs) were diluted with Natt and Herrick solution and manually counted using a Neubauer haemocytometer. The haemoglobin (Hb) concentration was determined quantitatively using spectrophotometry with Drabkin's reagent at 540 nm. Furthermore, haematocrit (HCT) levels were measured using microhaematocrit centrifugation. The mean corpuscular volume (MCV) and mean corpuscular haemoglobin (MCH) were later computed using known mathematical procedures (Witeska et al., 2022).

2.8. Biochemical analysis

The liver function markers, including aspartate aminotransferase (AST), alanine transaminase (ALT), alkaline phosphatase (ALP), total protein (TP) and albumin (Alb), and kidney biomarkers, such as urea and creatinine, were measured in the collected serum samples in accordance with the manufacturer's instructions using commercial kits acquired from the Biodiagnostic Company in Egypt. Serum globulin levels were estimated using the difference between total proteins and albumin.

2.9. Oxidative stress assay

Malondialdehyde (MDA), total antioxidant capacity (TAC) and nitric oxide (NO) levels were determined spectrophotometrically in the collected serum samples at wavelengths 532, 505 and 540 nm, respectively, according to the methods of Ohkawa et al. (1979), Koracevic et al. (2001) and Goshi et al. (2019).

2.10. Pathological examination

Tissue samples preserved in 10% buffered neutral formalin were dehydrated through a graded series of ethanol concentrations (50%–100%), cleared with xylene (two changes) and embedded in paraffin wax; 4.5‐μm‐thick sections were stained with haematoxylin and eosin (H&E) and examined under an Olympus BX43 light microscope to identify any tissue abnormalities. Photographs were taken using an Olympus DP27 camera linked to CellSens Dimension software (Bancroft & Gamble, 2013).

A quantitative histological scoring approach based on Bernet et al. (1999) was applied to quantify organ‐level pathology using a two‐dimensional grading system. This system considers both the development and severity of pathogenic alterations. Each lesion is assigned a score from 0 to 6 based on its intensity: 0 (unaffected), 1–2 (mild), 3–4 (moderate) and 5–6 (severe or diffuse). Additionally, three parameters are used to classify the lesions based on their pathological significance: (1) low – injuries that can be easily repaired if the cause is removed; (2) moderate – lesions that are generally reversible once the stressor is eliminated; and (3) severe – lesions that are largely irreversible, often resulting in partial or total loss of organ function. The overall histological damage in each organ is quantified by calculating the sum of the products of these two components and is then used for statistical analysis (Hassanen et al., 2025).

2.11. Immunohistochemistry staining

Proliferating cell nuclear antigen (PCNA; Biospes, catalogue no.: BMA1034), a marker of cell proliferation, was detected in gill tissues. Caspase‐3 (Biospes, catalogue no.: YPA2861), an indicator of apoptosis, and inducible nitric oxide synthase (iNOS; Abcam, catalogue no. ab15323), an inflammatory marker, were assessed in the gills, the liver and kidneys. Tissue sections fixed in formalin and deparaffinized were incubated with peroxidase block and then with the corresponding primary antibodies at a 1:100 dilution. Antigen–antibody complexes were visualized using the immunohistochemistry detection kits (Power Stain 1.0 Poly HRP DAB Kit; Spectrum). Staining was developed by applying the chromogen substrate 3, 3′‐diaminobenzidine (DAB) for 10 min. Finally, all stained sections were examined under an Olympus BX43 light microscope, and images were captured using an Olympus DP27 camera connected to CellSens Dimension software.

ImageJ software was used to measure the percentage of positive area across various experimental groups.

2.12. Real‐time polymerase chain reaction evaluation of certain genes in different tissues

2.12.1. Extraction of total RNA and synthesis of complementary DNA

Total RNA was extracted using a QIAamp RNA Mini Kit (Qiagen, Hilden, Germany), following the manufacturer's protocol. The concentration and purity of the isolated T‐RNA were checked using Nanodrop and the 260/280 ratio. The first‐strand complementary DNA (cDNA) synthesis was performed using M‐MuLV reverse transcriptase (Fermentas, EU) and 50 ng T‐RNA, adhering to standard procedures for reverse transcription to generate high‐quality cDNA.

2.12.2. Quantitative RT PCR analysis

The quantitative polymerase chain reaction (PCR) reactions were carried out using the iQ SYBR Green PERMIX (BIO‐RAD, 170–880, USA) and conducted on the BIO‐RAD iCycler thermal cycler, coupled with the MyiQ real‐time PCR detection system, as described by Ibrahem and Ibrahim (2014). Primer sequences targeting specific genes were designed based on published sequences available in the GenBank database for O. niloticus (Hanna et al., 2025) (Table 1). The PCR procedure began with a preincubation phase at 95°C for 10 min, followed by 40 amplification cycles comprising denaturation at 95°C for 20 s, annealing at 60°C for 20 s and extension at 72°C for 30 s (Ko et al., 2009). Each sample was analysed in duplicate reactions, and negative controls without template DNA were included to verify the specificity of amplification (Gamal & Ibrahim, 2024). The expression of the glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) gene served as an internal control to normalize gene expression levels. The relative quantification of gene expression was calculated using the 2^−ΔΔCT.

TABLE 1.

The primer sequences of the target genes.

Gene	Forward primer	Reverse primer	Accession number	Amplicon (bp)
CYP1A1	TAAACTGCAGAGCGAGAGCA	CTTTCGACCCCAGATAACCA	XM_019365993.2	190
MT‐1	CCGAAGAGACAAGAGCAACG	CTGGTGTCGCATGTCTTTCC	XM_003447045.5	228
Hsp‐70	AAAGGTGTAGCGATCGGCAT	CCACATAACTGGGGGTGGTC	XM_003442456.5	121
GAPDH	GCTGTACATGCACTCCAAGG	ACTCAAACACACTGCTGCTG	NM_001279552.1	182

Abbreviations: CYP1A1, cytochrome p450‐1A1; GAPDH, glyceraldehyde 3‐phosphate dehydrogenase housekeeping gene; HSP‐70, heat shock protein‐70; MT‐1, metallothionine‐1.

2.13. Statistical analysis

Statistical analyses and graphical representations were performed using SPSS software (version 20) and GraphPad Prism (version 8.4.3). The mean values and standard errors of the mean (SEM) were computed, and statistical comparisons between groups were performed using a one‐way analysis of variance (ANOVA), with Tukey's post hoc test used to assess differences between groups. Results were deemed significant when p < 0.05.

3. RESULTS

3.1. Water quality measurements

The following physicochemical parameters of the water were evaluated daily: DO >5 mg/L, temperature (27°C–29°C) and ammonia levels <0.05 mg/L. As shown in Table 2, pH levels remained stable across all groups, with no significant differences observed. However, all groups exposed to increased hardness exhibited a significant elevation in EC, TDS, hardness, alkalinity and chloride concentrations compared to the control group.

TABLE 2.

Impact of water hardness/RUT on water quality parameters.

Measured parameter	Control	RUT	HW	HW + RUT
pH	6.69 ± 0.10 a	6.67 ± 0.13 a	6.85 ± 0.08 a	6.84 ± 0.11 a
EC (μS/cm)	449 ± 8.94a	443 ± 7.70a	1215 ± 22.19b	1226 ± 16.84b
TDS	226.17 ± 4.73a	221.83 ± 3.90a	618.00 ± 14.48b	613.33 ± 8.28b
Hardness (mg/L)	146 ± 3.67a	137 ± 3.94a	340 ± 5.41b	338 ± 5.13b
Alkalinity (mg/L)	130 ± 4.95a	126 ± 5.66a	306 ± 7.01b	305 ± 1.74b
Chloride (mg/L)	39 ± 1.06a	34 ± 1.22a	204 ± 6.44b	207 ± 5.95b

Note: Data are presented as means ± standard errors of the mean (SEM) (n = 3). Values in the same row with lowercase letters indicate significant differences between the groups at the 0.05 probability level.

Abbreviations: EC, initial electrical conductivity; HW, water hardness; RUT, rutin; TDS, total dissolved solids.

3.2. Growth performance

Table 3 shows a significant increase in FCR accompanied by a decrease in FBW, SGR and WG in the HW group compared to the control. Conversely, no significant differences were observed in any of the assessed growth performance parameters between the control and HW + RUT groups.

TABLE 3.

Growth performance parameters in different treatment groups.

Measured parameter	Control	RUT	HW	HW + RUT
IBW (g)	62.16 ± 0.95	67.73 ± 0.68	66.20 ± 0.73	69.20 ± 0.19
FBW (g)	142.67 ± 0.98a	146.66 ± 1.06a	103.60 ± 1.47b	137.75 ± 0.17a,b
WG (g)	80.51 ± 0.46a	78.93 ± 0.20a	37.47 ± 1.33b	68.46 ± 0.19a,b
SGR (%)	0.92 ± 0.06a	0.90 ± 0.07a	0.49 ± 0.12b	0.76 ± 0.07a,b
FCR	0.83 ± 0.05a	0.82 ± 0.08a	5.52 ± 2.05b	1.04 ± 0.10a,b

Note: Values are expressed as mean ± standard errors of the mean (SEM) (n = 15). Values in the same row with lowercase letters indicate significant differences between groups at the 0.05 probability level.

Abbreviations: FBW, final body weight; FCR, feed conversion ratio; IBW, initial body weight; RUT, rutin; SGR, specific growth rate; WG, weight gain.

3.3. Haematological parameters

Data shown in Table 4 reveal that RBCs, Hb, packed cell volume (PCV), MCV, mean corpuscular haemoglobin concentration (MCHC) and WBCs were significantly lower in the HW‐exposed group compared to the control group. Conversely, RUT supplementation significantly increased these parameters compared to the HW group. Additionally, WBCs and MCV were notably higher in the HW‐challenged groups than in the control group. However, RUT supplementation reversed this increase when compared to the HW‐exposed group only.

TABLE 4.

Effect of water hardness/RUT on the haematological profile.

Measured parameter	Control	RUT	HW	HW + RUT
RBCs (106/mm3)	4.68 ± 0.05a	4.82 ± 0.16a	3.00 ± 0.03b	4.01 ± 0.07c
HB (g/dL)	4.71 ± 0.10a	4.50 ± 0.14a	2.86 ± 0.10b	3.94 ± 0.03c
PCV %	35.20 ± 0.86a	34.40 ± 0.81a	26.80 ± 0.86b	34.40 ± 0.50a
MCV (fL)	75.22 ± 1.79a	74.35 ± 2.37a	90.28 ± 3.22b	78.68 ± 1.40a
MCHC (mg/dL)	13.40 ± 0.34a	13.21 ± 0.34a	10.66 ± 0.27b	12.47 ± 0.159a
WBCs (103/mm3)	18.00 ± 1.58a	22.80 ± 1.24a	47.40 ± 1.69b	32.60 ± 1.25c

Note: Values are expressed as mean ± standard errors of the mean (SEM) (n = 15). Within the same row, distinct lowercase letters denote statistically significant differences between groups (p ≤ 0.05).

Abbreviations: HB, haemoglobin concentration; HCT, haematocrit; HW, water hardness; MCHC, mean corpuscular haemoglobin concentration; MCV, mean corpuscular volume; PCV, packed cell volume; RBCs, red blood corpuscles; RUT, rutin; WBCs, white blood corpuscles.

3.4. Biochemical analysis

Table 5 indicates a significant increase in serum liver enzymes (AST, ALT and ALP) accompanied by elevated kidney function markers (urea and creatinine) in the HW group compared to the control. Additionally, serum TP, globulin and Alb levels were significantly decreased in the HW‐treated fish. In contrast, RUT supplementation markedly reduced liver enzyme and kidney biomarker levels, whereas TP and Alb were significantly higher in the HW + RUT group relative to the control.

TABLE 5.

Effect of water hardness/RUT on liver and kidney biomarker levels.

Measured parameter	Control	RUT	HW	HW + RUT
ALT (U/L)	23.40 ± 1.74a	22.80 ± 0.86a	43.00 ± 1.30b	34.60 ± 1.08c
AST (U/L)	47.80 ± 2.13a	48.00 ± 2.461a	64.80 ± 1.39b	54.60 ± 1.20a
ALP (U/L)	29.57 ± 1.18a	30.14 ± 1.05a	43.60 ± 1.75b	33.60 ± 1.50a
TP (g/dL)	3.09 ± 0.04a	3.08 ± 0.09a	2.11 ± 0.07b	2.95 ± 0.05a
Alb (g/dL)	1.57 ± 0.11a	1.35 ± 0.06a	0.97 ± 0.023b	1.46 ± 0.07a
Globulin (g/dL)	1.52 ± 0.10a	1.73 ± 0.13a	1.13 ± 0.09b	1.48 ± 0.05a
Urea (mg/dL)	38.54 ± 1.77a	36.80 ± 1.82a	46.75 ± 0.70b	37.24 ± 1.73a
Creatinine (mg/dL)	0.48 ± 0.05a	0.47 ± 0.08a	0.89 ± 0.04b	0.63 ± 0.04a

Note: Values are expressed as mean ± standard errors of the mean (SEM) (n = 15). Values in the same row with different lowercase letters indicate significant differences between groups at the 0.05 probability level.

Abbreviations: Alb, albumin; ALP, alkaline phosphatase; ALT, alanine aminotransferase; AST, aspartate aminotransferase; HW, water hardness; RUT, rutin; TP, total protein.

3.5. Antioxidant assays

Table 6 shows that the HW group exhibited significantly higher serum levels of MDA and NO, along with a significant decrease in TAC, compared to the control. Treatment with RUT notably reduced MDA and NO levels and significantly enhanced serum TAC compared to the HW group.

TABLE 6.

Effect of water hardness/RUT on the oxidative stress markers.

Measured parameter	Control	RUT	HW	HW + RUT
TAC (mmol/L)	1.89 ± 0.03a	1.93 ± 0.04a	0.99 ± 0.03b	1.73 ± 0.07a
MDA (mmol/mL)	12.29 ± 0.41a	11.09 ± 0.54a	15.39 ± 0.41b	11.49 ± 0.26a
NO (mmol/L)	95.33 ± 0.99a	94.38 ± 1.49a	102.78 ± 2.19b	93.27 ± 1.77a

Note: Values are expressed as mean ± standard errors of the mean (SEM) (n = 15). Values in the same row with different lowercase letters indicate significant differences between groups at the 0.05 probability level.

Abbreviations: HW, water hardness; MDA, malondialdehyde; NO, nitric oxide; RUT, rutin; TAC, total antioxidant capacity.

3.6. Pathological examination

3.6.1. Clinical signs and mortalities

Neither noticeable abnormalities nor death were observed in the control, RUT and HW + RUT groups. In contrast, fish in the HW group exhibited several clinical signs, including pronounced darkening of the body, abnormal swimming behaviour, exophthalmia, imbalance, haemorrhagic streaks and nodular formations on the pectoral fins. Additionally, this group experienced a mortality rate of approximately 23% (Figure 1).

FIGURE 1.

The effect of different treatments on the gross appearance of fish. (a) Control group, (b) rutin (RUT) group, (c–e) water hardness (HW) group, (f) HW + RUT group. Note: black arrow indicates haemorrhagic streaks, red arrow indicates darkness and yellow arrow indicates a mottled liver.

3.6.2. Histopathological finding

In the control and RUT groups, gill histology was normal, showing well‐preserved primary and secondary lamellae. Conversely, HW exposure induced marked histopathological changes, such as vascular congestion and deformation of the epithelial lining of the lamellae. Furthermore, epithelial hyperplasia, lamellar fusion, necrosis in the secondary lamellae and inflammatory cells were also noticed. Fish treated with HW + RUT displayed nearly normal gill architecture, showing only mild curling of the lamellae and slight vascular congestion (Figure 2).

FIGURE 2.

Representative haematoxylin and eosin (H&E)‐stained section of the gill tissue from Oreochromis niloticus, photographed at 10× magnification (100 μm scale bar). (a) Control group, (b) rutin (RUT) group, (c) water hardness (HW) group, (d) HW + RUT group. Red arrow indicates congestion; blue arrow indicates lamellar necrosis; black arrow indicates curling of gill lamellae; and green arrow indicates lamellar hyperplasia.

Liver sections from the control and RUT‐treated fish maintained normal architecture, featuring intact hepatopancreatic cells and distinct sinusoidal spaces. HW‐treated fish, however, exhibited pronounced degeneration and necrosis in the hepatopancreas, along with evident vascular congestion, accumulation of brown pigments and marked eosinophilic cell infiltration within the hepatic parenchyma and around the hepatopancreatic tissue, accompanied by disorganization of hepatocyte structure. Meanwhile, fish treated with HW + RUT demonstrated nearly normal hepatopancreatic architecture (Figure 3).

FIGURE 3.

Representative haematoxylin and eosin (H&E)‐stained section of the liver tissue from Oreochromis niloticus, photographed at 20× magnification (50 μm scale bar). (a) Control group, (b) rutin (RUT) group, (c–e) water hardness (HW) group, (f) HW + RUT group. Green arrow indicates infiltration of eosinophil cells; yellow arrow indicates vacuolar degeneration of hepatocytes; blue arrow indicates necrosis of pancreatic cells; and black arrow indicates necrosis of hepatocytes.

Kidney tissues of the control and RUT groups exhibited normal histological features, including well‐preserved glomeruli and intact tubular structures. Otherwise, the kidney of the HW group showed infiltration by mononuclear cells, vacuolar degenerative changes, tubular epithelial necrosis and active melanomacrophage centers. Furthermore, there was evident glomerular damage, including structural alterations, glomerular tuft atrophy and an expanded Bowman's space coupled with thickening of Bowman's capsule. In contrast, fish in the HW + RUT group exhibited kidney tissue with an almost normal histological appearance (Figure 4).

FIGURE 4.

Representative haematoxylin and eosin (H&E)‐stained section of the kidney tissue from Oreochromis niloticus, photographed at 20× magnification (50 μm scale bar). (a) Control group, (b) rutin (RUT) group, (c, d) water hardness (HW) group, (e) HW + RUT group. Green arrow indicates vacuolar degeneration of renal tubular epithelium; black arrow indicates necrosis of renal tubular epithelium; yellow arrow indicates atrophy of glomerular tuft; red star indicates widening of Bowmen's capsule; and red arrow indicates melanomacrophage centre activation.

Figure 5 summarizes the lesion scores observed in various examined organs. Relative to the control group, the group exposed to HW showed a marked increase in lesion scores across most assessed parameters in all organs. Conversely, the HW + RUT‐treated group showed the lowest lesion scores, which resembled the control group.

FIGURE 5.

Effect of water hardness (HW) and/or rutin (RUT) on the histopathological lesion score index of gills (a), liver (b) and kidneys (c). Values are expressed as mean ± standard errors of the mean (SEM) (n = 35 images per group). Non‐significant differences are indicated by ns, and highly significant differences are indicated by ***p ≤ 0.001.

3.7. Immunohistochemistry staining

Gill, liver and kidney sections from the HW group exhibited markedly stronger immunopositivity for PCNA, iNOS and caspase‐3 than those of the control and RUT groups. In contrast, the HW + RUT group showed only mild immunostaining for the aforementioned parameters. The mean percentage of positively stained area for all markers was highest in the HW group, whereas it was significantly reduced in the HW + RUT group (Figures 6, 7, 8).

FIGURE 6.

Histological photomicrographs reveal the patterns of proliferating cell nuclear antigen (PCNA), inducible nitric oxide synthase (iNOS) and caspase‐3 protein expression in gill tissues of the different experimental groups, photographed at 20× magnification with a 50 μm scale bar. In the control group (a–c), negative expression of PCNA, iNOS and caspase‐3 was observed. In the water hardness (HW)‐treated group (d–f), there was strong immunopositivity for all three markers. Meanwhile, the HW + RUT cotreated group (g–i) exhibited negative‐to‐mild expression of PCNA, iNOS and caspase‐3. (j–l) The bar chart represents the percentage area of immunostaining of the three markers in various experimental groups. Values are expressed as mean ± standard errors of the mean (SEM) (n = 15 per group). (ns) denotes non‐significant differences, whereas (**) and (****) indicate significance at p ≤ 0.01 and p ≤ 0.0001, respectively.

FIGURE 7.

Histological photomicrographs reveal the patterns of inducible nitric oxide synthase (iNOS) and caspase‐3 protein expression in liver tissues of the different experimental groups, photographed at 20× magnification (50 μm scale bar). In the control group (a, b), negative expression of iNOS and caspase‐3 was observed. In the water hardness (HW)‐treated group (c, d), there was strong immunopositivity for the aforementioned markers. Meanwhile, the HW + rutin (RUT) cotreated group (e, f) exhibited negative‐to‐mild expression of iNOS and caspase‐3. (g, h) The bar chart represents the percentage area of immunostaining of both markers in various experimental groups. Values are expressed as mean ± standard errors of the mean (SEM) (n = 15 per group). (ns) denotes non‐significant differences, whereas (*) and (***) indicate significance at p ≤ 0.05 and p ≤ 0.0001, respectively.

FIGURE 8.

Histological photomicrographs reveal the patterns of inducible nitric oxide synthase (iNOS) and caspase‐3 protein expression in kidney tissues of the different experimental groups, photographed at 20× magnification (50 μm scale bar). In the control group (a, b), negative expression of iNOS and caspase‐3 was observed. In the water hardness (HW)‐treated group (c, d), there was strong immunopositivity for the aforementioned markers. Meanwhile, the HW + rutin (RUT) cotreated group (e, f) exhibited negative‐to‐mild expression of iNOS and caspase‐3. (g, h) The bar chart represents the percentage area of immunostaining of both markers in various experimental groups. Results are presented as mean ± standard errors of the mean (SEM) (n = 15 per group). (ns) denotes non‐significance, whereas (*) and (**) indicate significance at p ≤ 0.05 and p ≤ 0.01, respectively, and (***) indicates highly significant differences at p ≤ 0.0001.

3.8. RT‐PCR evaluation of certain genes' mRNA levels in different tissues

Figure 9 shows the upregulation of the CYP1A1, Hsp‐70 and MT‐1 genes in the liver, kidney and gill samples of tilapia fish in the HW group. The RUT significantly ameliorated the hardness effect by decreasing the expression of the examined genes. The most affected organs were the gills, the liver and kidneys, respectively.

FIGURE 9.

Representation of CYP1A1, MT‐1 and Hsp‐70 transcript levels in the gills, shown as a bar chart (a, d, g), the liver (b, e, h) and kidneys (d, f, i). Results are shown as mean ± standard errors of the mean (SEM) (n = 15 fish/group). Groups labelled with distinct lowercase letters are significantly different at p < 0.05.

4. DISCUSSION

Water quality is a critical component of any aquaculture system, significantly influencing fish health. Poor water quality can lead to stress in fish, which in turn increases their susceptibility to diseases (Swain et al., 2020). Among the various factors affecting water quality, hardness is considered a key determinant (Makori et al., 2017). The present study found that EC, TDS, alkalinity, hardness and chloride concentrations increased in all hardness‐treated groups, regardless of whether they received RUT treatment. EC reflects a solution's capacity to carry an electric current, which varies based on the concentration of dissolved ions, expressed as TDS (Rusydi, 2018). Moreover, the rise in water alkalinity mainly results from adding sodium bicarbonate (NaHCO₃), which acts as an efficient agent for boosting alkalinity (Furtado et al., 2011). Additionally, daily exposure of Nile tilapia to elevated HW significantly affected growth performance and physiological activity. The HW group exhibited higher FCR and lower FBW, SGR and WG compared to the control group. These findings are consistent with the results of Sinha et al. (2022), who reported that elevated HW negatively impacts growth performance parameters in fish. Our results also revealed abnormal clinical and behavioural signs in fish, such as clustering near the air source, reduced feed intake, darkened body colouration and vesicles on the pectoral fins. We suggested that the vesicles were caused by irritation that could result from the NaHCO₃ exposure. The present results corroborate the findings of Akinjogunla et al. (2023), who documented that NaHCO₃ has the potential to cause irritation in fish. The noticeable aggregation of fish near the air source indicates respiratory distress, likely associated with stress‐induced gill injury. This finding corroborates the results of Farag and Harper (2014), who showed that exposure to NaHCO₃ leads to severe gill necrosis in fish.

Concerning haematological parameters, the HW group showed alteration in the haematological profile, which is in agreement with those of Limbaugh et al. (2021), who reported similar haematological alterations under hardness‐related stress. Additionally, our results may be consistent with Akinrotimi et al. (2014), who observed that exposure to NaHCO₃ led to reduced RBC, Hb, PCV, MCH and MCHC levels, and elevated WBC and MCV. The haematological parameters in fish could reflect physiological responses to various environmental and stress factors (Fazio, 2019). Our findings showed that the exposure of fish to elevated HW significantly impaired liver and kidney function biomarker levels. Many recent studies indicate that the exposure of fish to mineral‐related hardness, such as CaCl₂, MgCl₂ and NaHCO₃, can cause liver damage, leading to the release of hepatic enzymes (Ahmad et al., 2023; Chandra & Sukumaran, 2020; Lei et al., 2024).

The liver is a large and metabolically active organ that plays a central role in nutrient metabolism. Damage to hepatocytes often results in the release of intracellular enzymes (Giannini et al., 2005). Stress and kidney damage can affect the levels of both urea and creatinine in the blood due to their impact on kidney function (Solomon, 2014). The biochemical analysis is confirmed by the histopathological examination, which demonstrated degeneration and necrosis of both hepatopancreatic cells and renal tubular epithelium of the HW group. Consistent with the findings of Wen et al. (2023) and Limbaugh et al. (2021), our data indicate that NaHCO₃ and CaCl₂ exposure can lead to hepatotoxicity in fish.

Another study reported the detrimental effects of NaHCO₃ on renal tissue (Ding et al., 2023). The impairment in both hepatorenal function and structures may be attributed to HW‐mediated oxidative stress, manifested by elevated levels of MDA and NO, alongside a reduction in TAC. An imbalance between ROS generation and the antioxidant defence mechanisms of the body can result in oxidative stress, which may damage cells and molecules (Birnie‐Gauvin et al., 2017). These findings agree with those of Vargas‐Ramella et al. (2025), Chandra and Sukumaran (2020) and Liu et al. (2025), who demonstrated that CaCl₂, MgCl₂ and NaHCO₃ exposure enhances lipid peroxidation while inhibiting antioxidant enzyme activity.

Hardness‐induced gill hyperplasia was confirmed by immunohistochemical analysis, which showed strong expression of the PCNA marker, indicating active cellular proliferation. PCNA is a key protein involved in DNA replication and repair (González‐Magaña & Blanco, 2020). Our results are consistent with those of Hassanen et al. (2025), who reported that elevated HW induces gill lamellar hyperplasia. Physicochemical alterations in water can lead to gill hyperplasia, which is strongly associated with increased PCNA expression, indicating active cellular proliferation (Sales et al., 2017). Moreover, the HW‐induced stress‐mediated cell death was validated by increasing the immunopositivity of both iNOS and caspase‐3 in the examined organs. iNOS is an essential immune enzyme responsible for generating NO, a key inflammatory mediator, from the amino acid l‐arginine. The expression and activity of iNOS must be tightly regulated to maintain proper NO levels during inflammatory conditions (Li et al., 2024). Caspase‐3 is thought to be the most significant of the executioner caspases responsible for the biochemical and morphological alterations observed in the apoptotic cells (Rojas et al., 2012). Caspase‐3 exists in an inactive proenzyme form and can be activated either through autoprocessing, by other members of the caspase family, or by apoptosis‐related proteases (Gao et al., 2013). Cellular apoptosis can be induced by oxidative stress through direct or indirect DNA damage (Wang et al., 2013). This supports our results, suggesting that the apoptotic response is likely mediated through oxidative stress pathways.

From the molecular insight, the HW‐exposed group showed the upregulation of CYP1A1, MT‐1 and Hsp70 genes in the examined organs. CYP genes encode a group of closely related enzymes involved in the metabolism of different endogenous substances and foreign chemicals (Hal & El‐Barbary, 2021). These enzymes are primarily active in the liver, but they are also found in other tissues involved in the immune responses and infection processes (Stavropoulou et al., 2018). Our finding was in agreement with Wong et al. (2001), who reported increased CYP1A1 expression in response to prolonged environmental pollution. MT was recognized early as a valuable indicator of an organism's exposure to toxic levels of metal ions (M'kandawire et al., 2017). Since their discovery, MT has been proposed for use in biomonitoring programmes designed to evaluate metal contamination in aquatic environments (Tom et al., 2004). This protein is present in nearly all eukaryotic organisms, as well as in some bacterial species (Blindauer & Leszczyszyn, 2010). MT constitutes a superfamily of small, cysteine‐rich, soluble proteins with a high affinity for thiophilic metal ions, which bind via characteristic metal‐thiolate clusters (Sutherland & Stillman, 2011), consistent with our findings. The Hsps, particularly those in the 70‐kDa family (Hsp70), are consistently expressed under normal, non‐stressful conditions and act as molecular chaperones by preventing improper protein aggregation (Tine et al., 2010). Beyond this role, Hsps contribute broadly to cellular and organismal protection during stress (Basu et al., 2002). Multiple investigations have indicated that exposure to a wide range of stressors, including environmental pollutants, can trigger the upregulation of Hsp70 expression, which plays a crucial role in safeguarding cells from damage (Padmini & Rani, 2008; Taleb et al., 2008), which aligns with our findings.

The results of the current study revealed that the CYP1A1, MT‐1, Hsp70, casp‐3 and iNOS cooperatively contributed to induced oxidative stress damage to organs, mainly gills, liver and kidneys. Elevated HW could activate CYP1A1 and iNOS, generating excessive ROS and NO that amplify oxidative/nitrosative stress and contribute to extensive organ damage (Tunca et al., 2009). Furthermore, the upregulation of both MT‐1 and Hsp70 is a key marker for oxidative and heat stress. Although these genes have a cytoprotective role by scavenging ROS, oxidative stress may still be present if ROS production overwhelms antioxidants (Ozougwu, 2016). Under stress conditions, CYP/iNOS‐mediated ROS overproduction could disrupt the mitochondrial membrane integrity, releasing cytochrome c that activates caspase cascade, such as casp‐3, contributing to programmed cell death (Özdemir et al., 2018).

Conversely, the cotreatment of HW‐exposed fish with RUT significantly improved growth performance, increased immune status, preserved both haematological profile and hepatorenal biomarkers, as well as maintained the histological architecture of the gills, liver and kidneys. The current observations support the results of previous investigations that highlighted the positive effects of RUT on fish health and growth performance (Deng et al., 2019; Xu et al., 2021). Additionally, a study conducted in rats demonstrated that the oral administration of RUT significantly improved the haematological variables, elevating RBC count, Hb, PCV, MCH and mean MCHC, and reducing WBC count and MCV (Chandra et al., 2018). We speculated that the cytoprotective effect of RUT was attributed to the potent antioxidant activity of RUT. This recovery was accompanied by a significant decrease in MDA levels and NO and an increase in TAC, indicating reduced oxidative stress. These findings align with those of Londero et al. (2021), who reported that a RUT‐supplemented diet reduced lipid peroxidation and enhanced antioxidant enzymes. Similarly, our results are consistent with Nazeri et al. (2017), who demonstrated the hepatoprotective effects of RUT, and with Korkmaz and Kolankaya (2010), who reported its nephroprotective effects via inhibition of ROS. These biochemical improvements were further supported by histopathological examination, which revealed nearly normal structures of the gills, the liver and kidneys of the HW + RUT group.

In our study, a mild expression of PCNA was observed, which agrees with the findings of Li et al. (2014), who documented that RUT inhibits PCNA expression in pulmonary artery smooth muscle cells of calf lungs. Furthermore, the anti‐inflammatory and anti‐apoptotic effects of RUT were supported by the immunohistochemical detection of iNOS and caspase‐3. These outcomes agree with the studies conducted by Mounika (2023) and Londero et al. (2021), which demonstrated that RUT supplementation suppresses the expression of iNOS and cleaved caspase‐3 protein, respectively. Additionally, the gene expression results showed the downregulation of CYP1A1, MT‐1 and Hsp70 genes in the HW + RUT group. These findings are consistent with Arinç et al. (2015), who reported that RUT normalized the transcriptase levels of the CYP1A1 gene in the liver of the stressed fish. Moreover, our results agreed with Abomosallam et al. (2025), who reported that RUT downregulates Hsp70 gene expression in birds. Additionally, a previous study showed that the RUT treatment exhibits metal‐chelating properties, which supports our results that showed the downregulation of MT‐1 (Abarikwu et al., 2017).

5. CONCLUSION

This study concluded that the chronic exposure to HW led to oxidative stress and consequent injury in the primary organs of Nile tilapia, such as gills, the liver and kidneys. As a result, significant structural changes occurred alongside elevated liver and kidney biomarkers and higher oxidative stress parameters. Mechanistically, elevated HW induced stress‐mediated apoptosis via increasing the expression of iNOS, caspase‐3, CYP1A1, MT‐1 and Hsp70 in both the liver and kidneys, along with strong PCNA expression in the gill tissues. The protective effect of RUT is primarily attributed to its antioxidant properties and its role in enhancing fish immunity. RUT also exerted potent anti‐inflammatory and anti‐apoptotic effects, which contributed to the cytoprotective potential against HW‐induced stress in fish. We recommend using RUT as a dietary supplement in fish farms, particularly those close to groundwater outlets. However, additional laboratory and/or field studies are essential to better understand the mechanisms of each salt toxicity. Moreover, future research should focus on the chronic evaluation impacts of HW on breeding efficiency and immunological responses in Nile tilapia.

AUTHOR CONTRIBUTIONS

Mahmoud A. Mahmoud: developed the research concept, conceived and designed the study and performed fish sampling for gross and histopathological examination. Eman I. Hassanen: developed the research concept, conceived and designed the study and performed fish sampling for gross and histopathological examination. Wafaa A. Mohamed: developed the research concept, conceived and designed the study, performed fish sampling for gross and histopathological examination, examined the water quality measurements, growth performance, behavioural tests, performed haematology, organ function tests, oxidative stress assay and all biochemical analysis and evaluation of certain genes in different tissues. Hanan S. Khalefa: conceived and designed the study, examined the water quality measurements, growth performance and behavioural tests. Neven H. Hassan: performed haematology, organ function tests, oxidative stress assay and all biochemical analysis. Marwa A. Ibrahim: evaluated certain genes in different tissues. All authors wrote, drafted, revised and approved the final version of the manuscript.

FUNDING INFORMATION

This research did not receive any specific grant from funding agencies in the public, commercial or not‐for‐profit sectors.

CONFLICT OF INTEREST STATEMENT

The authors declare no competing interests.

DATA AVAILABILITY STATEMENT

All relevant data are available within the manuscript.