Involvement of NarK1 and NarK2 Proteins in Transport of Nitrate and Nitrite in the Denitrifying Bacterium Pseudomonas aeruginosa PAO1

Vandana Sharma; Chris E Noriega; John J Rowe

doi:10.1128/AEM.72.1.695-701.2006

. 2006 Jan;72(1):695–701. doi: 10.1128/AEM.72.1.695-701.2006

Involvement of NarK1 and NarK2 Proteins in Transport of Nitrate and Nitrite in the Denitrifying Bacterium Pseudomonas aeruginosa PAO1

Vandana Sharma ¹, Chris E Noriega ¹, John J Rowe ^1,^*

PMCID: PMC1352271 PMID: 16391109

Abstract

Two transmembrane proteins were tentatively classified as NarK1 and NarK2 in the Pseudomonas genome project and hypothesized to play an important physiological role in nitrate/nitrite transport in Pseudomonas aeruginosa. The narK1 and narK2 genes are located in a cluster along with the structural genes for the nitrate reductase complex. Our studies indicate that the transcription of all these genes is initiated from a single promoter and that the gene complex narK1K2GHJI constitutes an operon. Utilizing an isogenic narK1 mutant, a narK2 mutant, and a narK1K2 double mutant, we explored their effect on growth under denitrifying conditions. While the ΔnarK1::Gm mutant was only slightly affected in its ability to grow under denitrification conditions, both the ΔnarK2::Gm and ΔnarK1K2::Gm mutants were found to be severely restricted in nitrate-dependent, anaerobic growth. All three strains demonstrated wild-type levels of nitrate reductase activity. Nitrate uptake by whole-cell suspensions demonstrated both the ΔnarK2::Gm and ΔnarK1K2::Gm mutants to have very low yet different nitrate uptake rates, while the ΔnarK1::Gm mutant exhibited wild-type levels of nitrate uptake. Finally, Escherichia coli narK rescued both the ΔnarK2::Gm and ΔnarK1K2::Gm mutants with respect to anaerobic respiratory growth. Our results indicate that only the NarK2 protein is required as a nitrate/nitrite transporter by Pseudomonas aeruginosa under denitrifying conditions.

Denitrification involves four separate nitrogen oxide reductases and ultimately reduces nitrate to dinitrogen (37). Respiratory nitrate reductase, which is the first enzyme in this denitrification pathway, has its active site on the cytoplasmic side of the membrane (23). The enzyme substrate, nitrate, is an ion and cannot be taken up by the simple process of passive diffusion (18). Both of these factors require the bacterium to synthesize a transport protein(s) to carry nitrate into the cytoplasm, where the reduction of nitrate to nitrite takes place. It has been demonstrated for Pseudomonas aeruginosa, Pseudomonas stutzeri, and Escherichia coli (7, 11, 24) that the product of nitrate respiration, i.e., nitrite, is immediately excreted to the external environment, presumably protecting the organism from potential toxic effects. These toxic effects are due to the ability of this anion to bind to the heme groups in electron carriers, thereby inhibiting the flow of electrons (25). Genetic and physiological data suggest that nitrate transport in some bacteria occurs through two different uptake systems. Thus, for the process of nitrate assimilation, ABC transporters as well as secondary transporters are postulated to be used. On the other hand, anaerobically, for the purpose of nitrate respiration, it is postulated that bacteria rely solely on secondary transporters (18).

Originally, John (14) demonstrated that membrane permeabilization of the cells significantly enhanced nitrate uptake, suggesting the need for a transport protein specific for nitrate. This was corroborated by several other studies which also demonstrated that external nitrate uptake in whole cells was restricted by a permeability barrier (10, 20). It was also observed that nitrate reduction and nitrate uptake were closely coupled, as narG-deficient mutants did not take up nitrate (24). Others demonstrated that nitrate uptake and reduction resulted in the immediate excretion of nitrite (7).

The first genetic locus identified as playing a role in nitrate uptake or nitrite excretion was narK of E. coli K-12 (4, 6, 20, 24, 33). Subsequently, other NarK-like proteins were identified by homology and by phenotype. NarK families of proteins belong to the major facilitator superfamily (MFS) of transmembrane transporters and are categorized as secondary transporters requiring the generation of a proton motive force (17). Homologues of NarK seem to be present in a multitude of organisms, where they may serve as either nitrate/proton symporters or as nitrate/nitrite antiporters.

E. coli is the paradigm for respiratory nitrate metabolism in bacteria. The current state of knowledge is based primarily on studies of this organism, which possesses two nitrate/nitrite transport proteins, NarK and NarU (2, 4, 13). These porters are separate from the narG operon, which contains the genetic information for the nitrate reductase enzyme complex. Since the first studies of E. coli, NarK homologues have been identified in a number of different organisms, such as Bacillus subtilis (5), Staphylococcus carnosus (8), Thermus thermophilus (22), Paracoccus pantotrophus (36), and Mycobacterium tuberculosis (32). Although these studies have enhanced the knowledge about nitrate/nitrite transport in bacteria, the actual mechanism(s) for nitrate transport remains controversial. The studies described here have identified the presence of a unique operon within an organism capable of denitrification. The system is novel among the Proteobacteria, as two genes, narK1 and narK2, cluster with the narGHJI genes in a single operon.

MATERIALS AND METHODS

Bacterial strains, plasmids, and growth conditions.

The bacterial strains and plasmids used in this study are listed in Table 1. The PAO1 narG mutant was previously isolated (21). All bacteria were grown at 37°C from single-colony isolates or overnight cultures in Luria-Bertani (LB) broth (Fisher Scientific). The medium was supplemented with nitrate at a final concentration of 1%. The cultures were also plated on LB medium, 1.5% agar (Difco, Detroit, Mich.). Plasmid integration during mutant construction was checked using Pseudomonas isolation agar (Difco, Detroit, Mich.)

TABLE 1.

Strains and plasmids used in this work

Strain or plasmid	Relevant genotype or description	Source or reference
Strains
E. coli
DH5α	recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 ΔlacU169 (φ80lacZΔM15)	Gibco
SM10	Km^r, Mobilizer strain	31
P. aeruginosa
PAO1	Wild type	Al Darzins
ΔnarK1::Gm strain	Gm^r, ΔnarK1::Gm	This study
ΔnarK2::Gm strain	Gm^r, ΔnarK2::Gm	This study
ΔnarK1K2::Gm strain	Gm^r, ΔnarK1K2::Gm	This study
narG::lacZGm strain	Gm^r, φ(PA3875-lacZGm)	21
ΔnarK2::Gm/pnarK1 strain	Gm^r Cb^r, ΔnarK1::Gm with PA3877 in pUCP18	This study
ΔnarK2::Gm/pnarK2 strain	Gm^r Cb^r, ΔnarK2::Gm with PA3876 in pUCP18	This study
ΔnarK1K2::Gm/pnarK1K2 strain	Gm^r Cb^r, ΔnarK1K2::Gm with PA3877 and PA3876 in pUCP18	This study
ΔnarK2::Gm/pnarK strain	Gm^r Cb^r, ΔnarK2::Gm with E. coli narK in pUCP18	This study
ΔnarK1K2::Gm/pnarK strain	Gm^r Cb^r, ΔnarK1K2::Gm with E. coli narK in pUCP18	This study
PAO1/pnarK1K2 strain	Cb^r, wild-type PAO1 with PA3877 and PA3876 in pUCP18	This study
Plasmids
pGem::narK1	Ap^r, 1.296-kb fragment containing PA3877 in the pGEM-T Easy vector (Promega)	This study
pGem::narK2	Ap^r, 1.407-kb fragment containing PA3876 in the pGEM-T Easy vector (Promega)	This study
pGem::narK1K2	Ap^r, 2.703-kb fragment containing PA3876 and PA3877 in the pGEM-T Easy vector (Promega)	This study
pCR::narK E. coli	Ap^r, 1.392-kb fragment containing E. coli narK in the pCR2.1 vector (Invitrogen)	This study
pEX18Ap	Ap^roriT mob sacB gene replacement vector with multiple-cloning site from pUC18	12
pEX18Ap::narK1	Ap^r, ligation of a 1.296-kb EcoRI fragment of PA3877 of pGem::narK1 into an EcoRI digest of pEX18Ap	This study
pEX18Ap::narK2	Ap^r, ligation of a 1.407-kb EcoRI fragment of PA3876 of pGem::narK2 into an EcoRI digest of pEX18Ap	This study
pEX18Ap::narK1K2	Ap^r, ligation of a 2.703-kb EcoRI fragment containing PA3876 and PA3877 of pGem::narK1K2 into an EcoRI digest of pEX18Ap	This study
pUCGM	Ap^r Gm^raacCl	29
pEX18Ap:ΔnarK1::Gm	Ap^r Gm^r, ligation of a 1-kb SmaI fragment of pUCGM containing aacC1 into a blunt-ended NcoI-SalI deletion of pEX18Ap::narK1	This study
pEX18Ap:ΔnarK2::Gm	Ap^r Gm^r, ligation of a 1-kb SmaI fragment of pUCGM containing aacC1 into a blunt-ended XhoI-ApaI deletion of pEX18Ap::narK2	This study
pEX18Ap:ΔnarK1K2::Gm	Ap^r Gm^r, ligation of a 1-kb SmaI fragment of pUCGM containing aacC1 into a blunt-ended NotI-ApaI deletion of pEX18Ap::narK1K2
pUCP18	Ap^r, broad-host-range cloning vector	28
pnarK1	Ap^r, ligation of a 1.296-kb EcoRI fragment of pGem::narK1 into the EcoRI site of pUCP18, complementation studies	This study
pnarK2	Ap^r, ligation of a 1.407-kb EcoRI fragment of pGem::narK2 into the EcoRI site of pUCP18, complementation studies	This study
pnarK1K2	Ap^r, ligation of a 2.703-kb EcoRI fragment of pGem::narK1K2 into the EcoRI site of pUCP18, complementation studies	This study
pnarK	Ap^r, ligation of a 1.392-kb EcoRI fragment of pCR::narK into the EcoRI site of pUCP18, complementation studies	This study

Open in a new tab

Aerobic overnight cultures were incubated with shaking at 250 rpm unless otherwise noted. For anaerobic-growth cultures, conditions included magnetic stirring in 125-ml Erlenmeyer flasks with rubber stoppers equipped with ports for sample withdrawal and one-way gas release valves. To ensure complete anaerobiosis of the system, the medium was supplemented with 2% (wt/vol) Oxyrase (Oxyrase, Inc., Mansfield, Ohio) and flushed with argon. For the nitrate reductase assay and the whole-cell uptake study, the cultures were grown aerobically to an optical density at 660 nm (OD₆₆₀) of 0.5 to 0.6, after which time they were shifted to complete anaerobic conditions.

Antibiotics were used for E. coli at the following concentrations (μg/ml): ampicillin, 100; and gentamicin, 15. For P. aeruginosa, gentamicin and carbenicillin were used at 300 and 500 μg/ml, respectively.

Bioinformatics analyses.

Gene, protein, and primer sequences for P. aeruginosa PAO1 and E. coli K-12 were obtained using the Pseudomonas genome database site (http://www.pseudomonas.com/) and E. coli K-12 genome database site (http://www.ecocyc.com/), respectively. Prediction of the molecular weights of the proteins, based on amino acid data, was made with individual proteomics tools available at the ExPASy mirror site (http://au.expasy.org/) of the Swiss Institute of Bioinformatics. A promoter search was carried out using the promoter prediction software site (http://www.fruitfly.org/). Sequence similarity comparisons between PAO1 NarK2 and E. coli K-12 NarK were carried out using the Multalin software (http://www.renabi.fr/multalin/multalin.html). Hydropathy profiles were generated as described previously (15) with a window size of 23 (http://www.bio.davidson.edu/courses/compbio/flc/home.html).

Manipulation of recombinant DNA and genetic techniques.

All plasmid and chromosomal nucleic acid manipulations were by standard techniques (26). Plasmid DNA was transformed into E. coli DH5α-MCR (Gibco-BRL), SM10 (31), or P. aeruginosa PAO1. Restriction endonucleases, the Klenow fragment, and T4 DNA ligase were used as specified by the supplier (New England Biolabs). Plasmid DNA was isolated using the QIA prep spin kit (QIAGEN). DNA fragments were isolated from agarose gels using the Gene Clean kit (QBiogene). PCRs were performed using Taq DNA polymerase, PCR buffer, and deoxynucleoside triphosphates (Sigma Chemical Co.) in a Peltier thermal cycler. All the oligonucleotide primers used in this study are listed in Table 2 (Sigma-Genosys).

TABLE 2.

Oligonucleotide primers used in this study

Primer	Location	Strand^a	Sequence (5′ → 3′)
NarK1	narK1	+	CCTGTCACTACCTCCAAAG
NarK1	narK1	−	AGAAGCTGATATTGGACATG
NarK2	narK2	+	GTGCCTGTTCTTCCTCTC
NarK2	narK2	−	TTGGCGCTGTAGATGTAC
NarK1K2	narK1	+	CCTGTCACTACCTCCAAAG
NarK1K2	narK2	−	TTGGCGCTGTAGATGTAC
E. coli NarK	narK	+	CTGCTGCTCGAGTCAACTC
E. coli NarK	narK	−	TATAATTCGGTTTACAGGAAGG

Open in a new tab

Forward and reverse primers are indicated by + and −, respectively.

Construction of isogenic mutants.

The open reading frames (ORFs) putatively responsible for the formation of NarK1 and NarK2 were identified by homology as PA3877 and PA3876, respectively, through the Pseudomonas Genome Project (34). The genes were amplified from PAO1 using primers based on sequence data from the Pseudomonas Genome Database (Table 2). All the strain constructions and manipulations are described in detail in Table 1. PCR fragments were initially cloned into the pGEM-T Easy (Promega) or pCR2.1 (Invitrogen) vector. The genes were inserted into pEX18Ap (12). Isogenic narK1, narK2, and narK1 narK2 mutants were created by deletion of most of the ORFs, followed by insertion of aacC1, a gentamicin resistance marker from pUCGM (29). Single-copy chromosomal gene disruptions were created using a gene replacement technique previously described (27). Mutants were confirmed by PCR using primers specified in Table 2 (data not shown). All mutants were complemented by the use of pUCP18 plasmid vector (28) with the gene(s) of interest (Table 1).

Preparation of cell extracts to analyze nitrate reductase activity.

To analyze cell extracts for enzyme activity, cultures were centrifuged and the cells washed five times with an equal volume of 0.1 M potassium phosphate buffer (pH 7.2). The cell suspensions were then sonicated five times at 4°C, with 15-second bursts and a rest interval of 1 min, in an ice bath using the Branson 150 sonicator, followed by centrifugation at 10,000 × g for 10 min to remove cell debris.

Determination of nitrate reductase activity.

For the assay, 100 μl of cell extract was added to a 1.5-ml Eppendorf tube containing 700 μl 0.1 M potassium phosphate buffer (pH 7.2) followed by 50 μl of 1 M KNO₃. To start the reaction, 50 μl of freshly made 0.08% sodium hydrosulfite (dithionite) was added to 100 μl of methyl viologen, gently mixed, and added to cell extracts. The reaction proceeded for 2 min, after which time all contents were vigorously vortexed and the nitrite concentration was determined by the Griess reaction (16). Enzyme activity is defined as that amount of nitrate reductase required to produce 1 nmol nitrite min⁻¹ mg⁻¹ protein. All the assays were performed in triplicate and repeated at least twice with independent cultures.

Uptake of nitrate monitored by a nitrate ion-selective electrode.

Whole cells were analyzed for rates of nitrate uptake using the Orion 9707 Ionplus nitrate electrode (Thermo Electron Co.) by a method previously described (11). Glucose (1 M) was used as an energy source, and the cells were spiked with 200 to 600 μM KNO₃ in an argon-generated anaerobic environment. All the assays were performed in triplicate and repeated at least twice with independent cultures.

Determination of the concentrations of extracellular nitrite.

Extracellular nitrite was determined in whole-cell suspensions using the Griess reaction as previously described (4). All assays were performed in triplicate and repeated at least twice with independent cultures.

Determination of protein concentrations in whole-cell suspensions and cell extracts.

The Bradford reagent (Sigma-Aldrich, St. Louis, Mo.) was utilized to determine the protein concentrations for both sonicated and whole-cell suspensions (3).

RESULTS

NarK1 and NarK2 as candidates for nitrate import or nitrite export.

In the organism P. aeruginosa PAO1, the narK1 and narK2 genes are found in a cluster of genes which includes structural genes for the nitrate reductase enzyme complex (narGHJI) (Fig. 1), and these together appeared to comprise the narK1K2GHJI operon (http://www.pseudomonas.com). By extrapolation, the narK1 gene encodes a protein of 431 amino acids with a molecular weight of 47.3, while the narK2 gene encodes a protein of 468 amino acids with a molecular weight of 50.6 (http://au.expasy.org).

FIG. 1. — Map of the *narK1K2GHJI* operon of *Pseudomonas aeruginosa.* The map shows the *narK1* and *narK2* genes to be upstream of the structural genes of nitrate reductase (*narGHJI*). Relevant restriction sites used to create deletions are shown. The endogenous promoter for the operon is shown as P_nar. The direction of transcription of both the operon and the gentamicin cassette (Gm) is shown with the help of arrows. The orientation of the Gm cassette in the gene disruptions was always positive with respect to the gene, as shown in the figure. The figure is not drawn to scale. The Δ*narK1*::Gm mutant was created by blunt-ending the Gm cassette into the NcoI-SalI deletion site. The Δ*narK2*::Gm mutant was created by blunt-ending the Gm cassette into the XhoI-ApaI deletion site. The Δ*narK1K2*::Gm mutant was created by blunt-ending the Gm cassette into the NotI-ApaI deletion site.

A comparison of peptide sequences between the NarK1 and NarK2 proteins yielded a similarity of 28% (http://www.renabi.fr/multialin.html). In contrast, a similarity of 74% was observed between NarK2 and NarK of Escherichia coli K-12. The NarK1 was found to be 59% similar to the NarK1 protein of Thermus thermophilus. Further, a hydrophobicity profile (http://www.bio.davidson.edu/courses/compbio/flc/home.html) indicates that both proteins contain 11 to 12 transmembrane helices. Such a helix profile is in complete agreement with the proposed roles for transporters.

The narK1K2GHJI operon.

A promoter predictor program (http://www.fruitfly.org) indicated the presence of only one promoter for the narK1, narK2, and narGHJI genes, further suggesting that these genes might form one operon. This was verified by growing the ΔnarK1K2::Gm mutant aerobically in LB broth supplemented with nitrate and gentamicin. In P. aeruginosa PAO1, respiratory nitrate reductase is normally induced only anaerobically in the presence of nitrate (19, 30). Because the ΔnarK1K2::Gm mutant contains a gentamicin cassette insertion (Fig. 1) and consequently contains the gentamicin promoter, the respiratory nitrate reductase genes could be induced even aerobically in LB broth-nitrate through this promoter. Thus, under aerobic conditions, the ΔnarK1K2::Gm mutant yielded normal amounts (330 ± 5 nmol nitrite min⁻¹ mg⁻¹ protein) of respiratory nitrate reductase activity, while no nitrate reductase activity was detected in the wild-type strain, further supporting the idea that all of these genes are contained in a single operon.

Effect of narK1 and narK2 mutations on anaerobic respiratory growth.

All mutants and the respective complemented strains were grown anaerobically in LB broth supplemented with nitrate (Fig. 2). The ΔnarK1::Gm mutant grew almost as rapidly as the wild type, yielding generation times of 2.6 ± 0.08 and 2 ± 0.4 h, respectively (Fig. 2A). In contrast, the ΔnarK2::Gm mutant (Fig. 2B) was found to be severely impaired in nitrate-dependent anaerobic growth and yielded a generation time of 8.5 ± 0.6 h. Finally, the ΔnarK1K2::Gm double mutant demonstrated almost no growth (Fig. 2C). A complementation of the ΔnarK2::Gm mutant with pnarK2 completely rescued the mutant. However, the ΔnarK1K2::Gm mutant was not fully complemented with pnarK1K2, demonstrating only a slightly higher growth rate than the mutant (Fig. 2C). This was attributed to the overproduction of two membrane proteins due to the use of a high-copy-number plasmid (8). We have confirmed this inhibitory effect by transforming wild-type P. aeruginosa with pnarK1K2. This strain grew slower than the wild type, yielding a generation time of 3.2 ± 0.6 h. As expected, the ΔnarK1K2::Gm/pnarK1 complemented strain was also unable to grow (data not shown), implying a requirement for a functional NarK2 protein for respiratory nitrate reduction by P. aeruginosa.

Nitrate reductase activities in the narK1, narK2, and narK1K2 mutants.

The nitrate reductase activity was analyzed in cell extracts of all the strains using a nonphysiological electron donor, i.e., methyl viologen. For this purpose, strains were grown to an OD₆₆₀ of 0.5 to 0.6 aerobically in LB broth supplemented with nitrate and gentamicin and then switched to anaerobic conditions for 3 h. The cell extracts were subsequently analyzed for methyl viologen-linked nitrate reductase activity (Table 3). Similar nitrate reductase activities were observed in all the strains, as was expected. This confirmed that the deletion-insertion mutagenesis of the genes did not affect the expression of the nitrate reductase genes and that the phenotypes observed were due to a defect in nitrate and/or nitrite transport.

TABLE 3.

Reduced methyl viologen-linked nitrate reductase activities of the P. aeruginosa wild type and mutants grown anaerobically

Strain^a	Nitrate reductase activity (nmol nitrite min⁻¹ mg⁻¹ protein)^b
PAO1	334 ± 9
ΔnarK1::Gm strain	310 ± 10
ΔnarK1::Gm/pnarK1 strain	330 ± 12
ΔnarK2::Gm strain	278 ± 12
ΔnarK2::Gm/pnarK2 strain	328 ± 13
ΔnarK1K2::Gm strain	229 ± 8
ΔnarK1K2::Gm/pnarK1K2 strain	283 ± 4

Open in a new tab

All strains were grown aerobically in LB medium supplemented with 1% nitrate to an OD₆₆₀ of 0.5 to 0.6 and then shifted to anaerobiosis for 3 h.

Enzyme activities were determined in cell extracts using reduced methyl viologen as the electron donor. Means and standard errors were calculated from three independent cell suspensions.

Nitrate uptake.

To investigate the role of P. aeruginosa narK1 and narK2 gene products in nitrate transport, anaerobically grown whole-cell suspensions were monitored for external nitrate using a nitrate electrode (Table 4). The ΔnarK1::Gm mutant exhibited uptake rates similar to that of the wild type, consistent with the anaerobic growth rates observed. On the other hand, both the ΔnarK2::Gm and the ΔnarK1K2::Gm mutants were found to be severely impaired in their nitrate uptake ability, exhibiting uptake rates of 8.4 ± 0.3 nmol nitrate min⁻¹ mg⁻¹ protein and <1.5 nmol nitrate min⁻¹ mg⁻¹ protein, respectively. Complementation with pnarK2 and pnarK1K2 was found to rescue this phenotype. Furthermore, similar to the observation made for an E. coli nitrate reductase mutant, no nitrate uptake was observed in a P. aeruginosa PAO1 narG mutant (Table 4).

TABLE 4.

Effects of mutations in narK1, narK2, narK1K2, and narG strains on rates of nitrate uptake

Strain^a	Rate of nitrate uptake (nmol nitrate min⁻¹ mg⁻¹ protein)^b
PAO1	175 ± 37
ΔnarK1::Gm strain	192 ± 7
ΔnarK2::Gm strain	8 ± 0.3
ΔnarK2::Gm/pnarK2 strain	<1.5
ΔnarK1K2::Gm strain	254 ± 31
ΔnarK1K2::Gm/pnarK1K2 strain	186 ± 47
narG::lacZGm strain	0^c

Open in a new tab

All strains were grown aerobically in LB medium supplemented with 1% nitrate to an OD₆₆₀ of 0.5 to 0.6 and then shifted to anaerobiosis for 3 h. Washed whole cells were suspended in 20 mM Tris-HCl buffer (pH 7.4) and monitored under argon-generated anaerobic conditions.

Glucose (1 M) was used as the energy source, and the nitrate concentration was 200 to 600 mM. Means and standard errors were calculated from three independent cell suspensions.

Not detected.

Nitrite accumulation by the narK1, narK2, and narK1K2 mutants.

Next, we wanted to see if there were any differences in nitrite extrusion between the wild type and the mutant strains. Samples were withdrawn during anaerobic nitrate-dependent growth, cells were removed, and the amount of nitrite was analyzed (data not shown). Given that the ΔnarK2::Gm and ΔnarK1K2::Gm mutants are unable to grow under these conditions and since cytoplasmic nitrite is a result of nitrate reduction, both of the mutants were expected to demonstrate limited nitrite excretion, which indeed was the case (data not shown). In contrast, although the ΔnarK1::Gm mutant excreted visibly reduced amounts of nitrite compared to that excreted by the wild type, normalization of the data in terms of protein amounts abolished this difference, giving values of 60.5 ± 0.68 and 60.5 ± 0.7 μmol extracellular nitrite mg⁻¹ protein for the wild type and ΔnarK1::Gm mutant, respectively.

The isogenic narK2 mutant was complemented by the narK gene of Escherichia coli K-12.

Previous studies of nitrate/nitrite transport have been most extensively carried out on the NarK protein of Escherichia coli (4, 6, 13, 20, 24, 33). Thus, to establish the role of the narK2 gene in PAO1, we cloned the narK gene of E. coli into a pUCP18 plasmid vector. The resulting strain was used to complement both the ΔnarK2::Gm strain and the ΔnarK1K2::Gm strain (Fig. 3). The results demonstrate that the narK gene of E. coli is capable of restoring anaerobic growth in PAO1 deficient in narK2 and narK1K2. The growth rates of these complemented strains were not completely restored to wild-type levels, but that can be attributed to (i) high copy numbers of the membrane proteins being produced (8) and (ii) a nonidentical protein used for complementation.

FIG. 3. — Complementation of the *ΔnarK2*::Gm mutant and the *ΔnarK1K2*::Gm mutant with pnarK. The *narK* gene cloned into the pUCP18 plasmid vector was obtained from *E. coli* K-12. All strains were grown overnight in LB medium and were then transferred to LB medium supplemented with 1% nitrate and an appropriate concentration of gentamicin and carbenicillin and switched to anaerobic conditions. The anaerobic growth of PAO1 (⋄), Δ*narK2*::Gm strain complemented with pnarK (▪), and *ΔnarK1K2*::Gm strain complemented with pnarK (▴) is shown.

DISCUSSION

The goal of the present study was to elucidate the involvement of the narK1 and narK2 genes in P. aeruginosa denitrification. In this regard, isogenic narK1, narK2, and narK1K2 mutants were created and verified. These studies confirmed that the narK1 and narK2 genes are in an operon with the narGHJI genes. The literature suggests that this is unusual since the narG operon of E. coli is distinctly separate from narK and narU (2, 33) as is narK1 and narK2 of Thermus thermophilus (22) and narK of P. stutzeri (9). Only Paracoccus pantotrophus (36) has a nitrate/nitrite transporter in the same operon as the genes for the nitrate reductase complex.

Studies of anaerobic, nitrate-dependent growth showed the ΔnarK1::Gm mutant to be only slightly affected in growth, while both the ΔnarK2::Gm and ΔnarK1K2::Gm mutants were severely compromised compared to the wild type (Fig. 2). This suggests that these proteins serve different roles in nitrate-dependent, anaerobic growth. To make sure that these growth phenotypes were not due to an inactive nitrate reductase, all mutants were checked and confirmed for the presence of nitrate reductase activity (Table 3). These results are in contrast to the results of a study of narK1 and narK2 of Thermus thermophilus (22). In that study, a single mutation of narK1 or narK2 did not severely restrict anaerobic growth. Only when both of these genes were mutated was the organism severely restricted in anaerobic growth at the expense of nitrate. Furthermore, in T. thermophilus, complementation of the double mutant with either narK1 or narK2 restored the ability of the organism to grow anaerobically.

Nitrate uptake studies utilizing a nitrate-specific electrode yielded some interesting insights into the NarK1 and NarK2 protein function (Table 4). The ΔnarK1::Gm mutant demonstrated nitrate uptake rates similar to that of the wild type. In contrast, both the ΔnarK2::Gm and the ΔnarK1K2::Gm mutants had very low, yet different, rates of nitrate uptake. This difference in nitrate uptake rate between the ΔnarK2::Gm mutant and the double mutant was more than fivefold, indicating that both of the proteins may be involved with nitrate uptake. In addition, we observed no uptake of nitrate in a PAO1 narG mutant, thus connecting intracellular nitrite generation with nitrate uptake. This is consistent with the observation made for an E. coli narG mutant (24) and that of Ramirez et al. with T. thermophilus (22).

It is well established that during the denitrifying growth of P. aeruginosa in batch culture, there is a sequential reduction of nitrogen oxides (35). Similar results have been observed for other denitrifiers (1). The first product of denitrification, nitrite, is very toxic to the cells and thus excreted immediately upon reduction. This extracellular accumulation of nitrite continues to occur until the nitrate supply is exhausted. Moreover, previous studies have shown that nitrite reductase is located in the periplasm but does not participate in nitrite reduction until nitrate disappears from the external medium (30). Thus, we wanted to see if any of our mutants differentially accumulated nitrite in comparison to the wild type. The results indicate that both the ΔnarK2::Gm and ΔnarK1K2::Gm mutants demonstrated limited nitrite excretion but that the ΔnarK1::Gm mutant excreted amounts of nitrite equivalent to that of the wild type. It is to be expected that a restriction in nitrate uptake would also limit nitrite production, and thus the results obtained for the ΔnarK2::Gm and ΔnarK1K2::Gm mutants may be explained in this manner. The narK1 mutation did not seem to affect external nitrite accumulation when the wild type and mutant were normalized in protein content.

In a separate experiment, we used the narK gene of E. coli to complement our narK2 mutant. This experiment was conducted because previous studies of nitrate/nitrite transport had been most extensively carried out with E. coli (2, 6, 20, 33), and recent studies concluded that the protein may operate as a nitrate/nitrite antiporter (4, 13). These conclusions were in contrast to the results reported for vesicle and proteoliposomes using ¹³N nitrate (24), which did not support the antiporter mechanism. In the current study, the NarK protein of E. coli complemented both the ΔnarK2::Gm mutant and the ΔnarK1K2::Gm mutant of P. aeruginosa with respect to anaerobic, nitrate-dependent growth. This suggests that, functionally, the NarK2 protein of P. aeruginosa is similar to the NarK protein of E. coli. However, the issue of antiport versus uniport remains to be conclusively experimentally proven.

To summarize, in contrast to studies of other denitrifiers, such as T. thermophilus and P. pantotrophus (22, 36), the NarK1 protein is not as important for the anaerobic nitrate-dependent growth and survival of P. aeruginosa. However, both the anaerobic growth studies and nitrate uptake studies indicate some involvement of the NarK1 protein in Pseudomonas denitrification. For now, its role still remains enigmatic. One possibility is that the NarK1 protein is capable of taking up very small amounts of nitrate. Given that in a ΔnarK1::Gm mutant the narK2 functions at normal levels, a slight deficiency created by the lack of NarK1 is “masked” by the presence of NarK2. Therefore, no differences in nitrate uptake are observed between the wild type and the ΔnarK1::Gm mutant. However, these differences become apparent on comparison of the ΔnarK2::Gm and the ΔnarK1K2::Gm strains. The fivefold difference observed between the two strains may be indicative of small amounts of nitrate uptake mediated by the NarK1 protein. Thus, the NarK1 protein may function in P. aeruginosa secondarily to NarK2. In the absence of NarK2, NarK1 would not be able to promote wild-type levels of nitrate-dependent, anaerobic growth but may provide just enough energy for the organism to sustain itself while it seeks other energy sources. Future studies would be needed to confirm the exact role of this protein.

Finally, in literature, the NarK-like proteins have been divided into two distinct subgroups: type I and type II (18). Both E. coli NarK and P. aeruginosa NarK2 have been classified as members of the type II group (18). On the other hand, P. aeruginosa NarK1 has been classified as a member of the type I group (18). Our results agree with the classification scheme for NarK2. However, it is difficult at the present time to corroborate the classification of NarK1, since its function is still unknown.

Acknowledgments

We are especially grateful to Herbert P. Schweizer for providing the pUCGM, pUCP18, and pEX18Ap vectors.

This work was supported in part by the University of Dayton Summer Fellowship Program and the Department of Biology.

REFERENCES

1.Betlach, M. R., and J. M. Tiedji. 1981. Kinetic explanation for accumulation of nitrite, nitric oxide, and nitrous oxide during bacterial denitrification. Appl. Environ. Microbiol. 42:1074-1084. [DOI] [PMC free article] [PubMed] [Google Scholar]
2.Bonnefoy, V., J. Ratouchniak, F. Blasco, and M. Chippaux. 1997. Organization of the nar genes at the chlZ locus. FEMS Microbiol. Lett. 147:147-149. [DOI] [PubMed] [Google Scholar]
3.Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 28:248-254. [DOI] [PubMed] [Google Scholar]
4.Clegg, S., F. Yu, L. Griffiths, and J. A. Cole. 2002. The roles of the polytopic membrane proteins NarK, NarU and NirC in Escherichia coli K12: two nitrate and three nitrite transporters. Mol. Microbiol. 44:143-155. [DOI] [PubMed] [Google Scholar]
5.Cruz Ramos, H., L. Boursier, I. Moszer, F. Kunst, A. Danchin, and P. Glaser. 1995. Anaerobic transcription activation in Bacillus subtilis: identification of distinct FNR-dependent and -independent regulatory mechanisms. EMBO J. 14:5984-5994. [DOI] [PMC free article] [PubMed] [Google Scholar]
6.DeMoss, J. A., and P. Y. Hsu. 1991. NarK enhances nitrate uptake and nitrite excretion in Escherichia coli. J. Bacteriol. 173:3303-3310. [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Dias, F. M., R. M. Ventullo, and J. J. Rowe. 1990. Regulation and energization of nitrate transport in a halophilic Pseudomonas stutzeri. Biochem. Biophys. Res. Commun. 166:424-430. [DOI] [PubMed] [Google Scholar]
8.Fast, B., P. Lindgren, and F. Gotz. 1996. Cloning, sequencing, and characterization of a gene (narT) encoding a transport protein involved in dissimilatory nitrate reduction in Staphylococcus carnosus. Arch. Microbiol. 166:361-367. [DOI] [PubMed] [Google Scholar]
9.Hartig, E., U. Schiek, K. U. Vollack, and W. G. Zumft. 1999. Nitrate and nitrite control of respiratory nitrate reduction in denitrifying Pseudomonas stutzeri by a two-component regulatory system homologous to NarXL of Escherichia coli. J. Bacteriol. 181:3658-3665. [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Hernandez, D., and J. J. Rowe. 1988. Oxygen inhibition of nitrate uptake is a general regulatory mechanism in nitrate respiration. J. Biol. Chem. 263:7937-7939. [PubMed] [Google Scholar]
11.Hernandez, D., and J. J. Rowe. 1987. Oxygen regulation of nitrate uptake in denitrifying Pseudomonas aeruginosa. Appl. Environ. Microbiol. 53:745-750. [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Hoang, T. T., R. R. Karkhoff-Schweizer, A. J. Kutchma, and H. P. Schweizer. 1998. A broad-host-range Flp-FRT recombination system for site-specific excision of chromosomally-located DNA sequences: application for isolation of unmarked Pseudomonas aeruginosa mutants. Gene 212:77-86. [DOI] [PubMed] [Google Scholar]
13.Jia, W., and J. A. Cole. 2005. Nitrate and nitrite transport in Escherichia coli. Biochem. Soc. Trans. 33:159-161. [DOI] [PubMed] [Google Scholar]
14.John, P. 1977. Aerobic and anaerobic bacterial respiration monitored by electrodes. J. Gen. Microbiol. 98:231-238. [DOI] [PubMed] [Google Scholar]
15.Kyte, J., and R. Doolittle. 1982. A simple method for displaying the hydropathic character of a protein. J. Mol. Biol. 157:105-142. [DOI] [PubMed] [Google Scholar]
16.MacGregor, C. H., and A. R. Christopher. 1978. Asymmetric distribution of nitrate reductase subunits in the cytoplasmic membrane of Escherichia coli. Arch. Biochem. Biophys. 185:204-213. [DOI] [PubMed] [Google Scholar]
17.Marger, M. D., and M. H. J. Saier. 1993. A major superfamily of transmembrane facilitators that catalyse uniport, symport and antiport. Trends Biochem. Sci. 18:13-20. [DOI] [PubMed] [Google Scholar]
18.Moir, J. W. B., and N. J. Wood. 2001. Nitrate and nitrite transport in bacteria. Cell Mol. Life Sci. 58:215-224. [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Moreno-Vivian, C., P. Cabello, M. Martinez-Luque, R. Blasco, and F. Castillo. 1999. Prokaryotic nitrate reduction: molecular properties and functional distinction among bacterial nitrate reductases. J. Bacteriol. 181:6573-6584. [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Noji, S., T. Nohno, T. Saito, and S. Taniguchi. 1989. The narK gene product participates in nitrate transport induced in Escherichia coli nitrate-respiring cells. FEBS Lett. 252:139-143. [DOI] [PubMed] [Google Scholar]
21.Noriega, C., D. J. Hassett, and J. J. Rowe. 2005. The mobA gene is required for assimilatory and respiratory nitrate reduction but not xanthine dehydrogenase activity in Pseudomonas aeruginosa. Curr. Microbiol. Epub ahead of print. DOI: 10.1007/s00284-005-0125-8. [DOI] [PubMed]
22.Ramirez, S., R. Moreno, O. Zafra, P. Castan, C. Valles, and J. Berenguer. 2000. Two nitrate/nitrite transporters are encoded within the mobilizable plasmid for nitrate respiration of Thermus thermophilus HB8. J. Bacteriol. 182:2179-2183. [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Richardson, D. J., B. C. Berks, D. A. Russell, S. Spiro, and C. J. Taylor. 2001. Functional, biochemical and genetic diversity of prokaryotic nitrate reductases. Cell Mol. Life Sci. 58:165-178. [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Rowe, J. J., T. Ubbink-Kok, D. Molenaar, W. N. Konings, and A. J. M. Driessen. 1994. NarK is a nitrite-extrusion system involved in anaerobic nitrate respiration by Escherichia coli. Mol. Microbiol. 12:579-586. [DOI] [PubMed] [Google Scholar]
25.Rowe, J. J., J. M. Yarbrough, J. B. Rake, and R. G. Eagon. 1979. Nitrite inhibition of aerobic bacteria. Curr. Microbiol. 2:51-54. [Google Scholar]
26.Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed., vol. 1 to 3. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
27.Schweizer, H. P. 1992. Allelic exchange in Pseudomonas aeruginosa using novel ColE1-type vectors and a family of cassettes containing a portable oriT and the counter-selectable Bacillus subtilis sacB marker. Mol. Microbiol. 6:1195-1204. [DOI] [PubMed] [Google Scholar]
28.Schweizer, H. P. 1991. Escherichia-Pseudomonas shuttle vectors derived from pUC18/19. Gene 97:109-121. [DOI] [PubMed] [Google Scholar]
29.Schweizer, H. P. 1993. Small broad-host-range gentamicin resistance gene cassettes for site-specific insertion and deletion mutagenesis. BioTechniques 15:831-834. [PubMed] [Google Scholar]
30.Sias, S. R., and J. L. Ingraham. 1979. Isolation and analysis of mutants of Pseudomonas aeruginosa unable to assimilate nitrate. Arch. Microbiol. 122:263-270. [DOI] [PubMed] [Google Scholar]
31.Simon, R., U. Priefer, and A. Pühler. 1983. A broad-host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram negative bacteria. Bio/Technology 1:784-791. [Google Scholar]
32.Sohaskey, C. D., and L. G. Wayne. 2003. Role of narK2X and narGHJI in hypoxic upregulation of nitrate reduction by Mycobacterium tuberculosis. J. Bacteriol. 185:7247-7256. [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Stewart, V., and C. H. MacGregor. 1982. Nitrate reductase in Escherichia coli K12: involvement of the chlC, chlE, and chlG loci. J. Bacteriol. 151:788-799. [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Stover, C. K., X. Q. Pham, A. L. Erwin, S. D. Mizoguchi, P. Warrener, M. J. Hickey, F. S. Brinkman, W. O. Hufnagle, D. J. Kowalik, M. Lagrou, R. L. Garber, L. Goltry, E. Tolentino, S. Westbrock-Wadman, Y. Yuan, L. L. Brody, S. N. Coulter, K. R. Folger, A. Kas, K. Larbig, R. Lim, K. Smith, D. Spencer, G. K. Wong, Z. Wu, I. T. Paulsen, J. Reizer, M. H. Saier, R. E. Hancock, S. Lory, and M. V. Olson. 2000. Complete genome sequence of Pseudomonas aeruginosa PA01, an opportunistic pathogen. Nature 406:959-964. [DOI] [PubMed] [Google Scholar]
35.Williams, D. R., J. J. Rowe, P. Romero, and R. G. Eagon. 1978. Denitrifying Pseudomonas aeruginosa: some parameters of growth and active transport. Appl. Environ. Microbiol. 36:257-263. [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Wood, N. J., T. Alizadeh, D. J. Richardson, S. J. Ferguson, and J. W. Moir. 2002. Two domains of a dual-function NarK protein are required for nitrate uptake, the first step of denitrification in Paracoccus pantotrophus. Mol. Microbiol. 44:157-170. [DOI] [PubMed] [Google Scholar]
37.Zumft, W. G. 1997. Cell biology and molecular basis of denitrification. Microbiol. Mol. Biol. Rev. 61:533-616. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r1] 1.Betlach, M. R., and J. M. Tiedji. 1981. Kinetic explanation for accumulation of nitrite, nitric oxide, and nitrous oxide during bacterial denitrification. Appl. Environ. Microbiol. 42:1074-1084. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r2] 2.Bonnefoy, V., J. Ratouchniak, F. Blasco, and M. Chippaux. 1997. Organization of the nar genes at the chlZ locus. FEMS Microbiol. Lett. 147:147-149. [DOI] [PubMed] [Google Scholar]

[r3] 3.Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 28:248-254. [DOI] [PubMed] [Google Scholar]

[r4] 4.Clegg, S., F. Yu, L. Griffiths, and J. A. Cole. 2002. The roles of the polytopic membrane proteins NarK, NarU and NirC in Escherichia coli K12: two nitrate and three nitrite transporters. Mol. Microbiol. 44:143-155. [DOI] [PubMed] [Google Scholar]

[r5] 5.Cruz Ramos, H., L. Boursier, I. Moszer, F. Kunst, A. Danchin, and P. Glaser. 1995. Anaerobic transcription activation in Bacillus subtilis: identification of distinct FNR-dependent and -independent regulatory mechanisms. EMBO J. 14:5984-5994. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r6] 6.DeMoss, J. A., and P. Y. Hsu. 1991. NarK enhances nitrate uptake and nitrite excretion in Escherichia coli. J. Bacteriol. 173:3303-3310. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r7] 7.Dias, F. M., R. M. Ventullo, and J. J. Rowe. 1990. Regulation and energization of nitrate transport in a halophilic Pseudomonas stutzeri. Biochem. Biophys. Res. Commun. 166:424-430. [DOI] [PubMed] [Google Scholar]

[r8] 8.Fast, B., P. Lindgren, and F. Gotz. 1996. Cloning, sequencing, and characterization of a gene (narT) encoding a transport protein involved in dissimilatory nitrate reduction in Staphylococcus carnosus. Arch. Microbiol. 166:361-367. [DOI] [PubMed] [Google Scholar]

[r9] 9.Hartig, E., U. Schiek, K. U. Vollack, and W. G. Zumft. 1999. Nitrate and nitrite control of respiratory nitrate reduction in denitrifying Pseudomonas stutzeri by a two-component regulatory system homologous to NarXL of Escherichia coli. J. Bacteriol. 181:3658-3665. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r10] 10.Hernandez, D., and J. J. Rowe. 1988. Oxygen inhibition of nitrate uptake is a general regulatory mechanism in nitrate respiration. J. Biol. Chem. 263:7937-7939. [PubMed] [Google Scholar]

[r11] 11.Hernandez, D., and J. J. Rowe. 1987. Oxygen regulation of nitrate uptake in denitrifying Pseudomonas aeruginosa. Appl. Environ. Microbiol. 53:745-750. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r12] 12.Hoang, T. T., R. R. Karkhoff-Schweizer, A. J. Kutchma, and H. P. Schweizer. 1998. A broad-host-range Flp-FRT recombination system for site-specific excision of chromosomally-located DNA sequences: application for isolation of unmarked Pseudomonas aeruginosa mutants. Gene 212:77-86. [DOI] [PubMed] [Google Scholar]

[r13] 13.Jia, W., and J. A. Cole. 2005. Nitrate and nitrite transport in Escherichia coli. Biochem. Soc. Trans. 33:159-161. [DOI] [PubMed] [Google Scholar]

[r14] 14.John, P. 1977. Aerobic and anaerobic bacterial respiration monitored by electrodes. J. Gen. Microbiol. 98:231-238. [DOI] [PubMed] [Google Scholar]

[r15] 15.Kyte, J., and R. Doolittle. 1982. A simple method for displaying the hydropathic character of a protein. J. Mol. Biol. 157:105-142. [DOI] [PubMed] [Google Scholar]

[r16] 16.MacGregor, C. H., and A. R. Christopher. 1978. Asymmetric distribution of nitrate reductase subunits in the cytoplasmic membrane of Escherichia coli. Arch. Biochem. Biophys. 185:204-213. [DOI] [PubMed] [Google Scholar]

[r17] 17.Marger, M. D., and M. H. J. Saier. 1993. A major superfamily of transmembrane facilitators that catalyse uniport, symport and antiport. Trends Biochem. Sci. 18:13-20. [DOI] [PubMed] [Google Scholar]

[r18] 18.Moir, J. W. B., and N. J. Wood. 2001. Nitrate and nitrite transport in bacteria. Cell Mol. Life Sci. 58:215-224. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r19] 19.Moreno-Vivian, C., P. Cabello, M. Martinez-Luque, R. Blasco, and F. Castillo. 1999. Prokaryotic nitrate reduction: molecular properties and functional distinction among bacterial nitrate reductases. J. Bacteriol. 181:6573-6584. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r20] 20.Noji, S., T. Nohno, T. Saito, and S. Taniguchi. 1989. The narK gene product participates in nitrate transport induced in Escherichia coli nitrate-respiring cells. FEBS Lett. 252:139-143. [DOI] [PubMed] [Google Scholar]

[r21] 21.Noriega, C., D. J. Hassett, and J. J. Rowe. 2005. The mobA gene is required for assimilatory and respiratory nitrate reduction but not xanthine dehydrogenase activity in Pseudomonas aeruginosa. Curr. Microbiol. Epub ahead of print. DOI: 10.1007/s00284-005-0125-8. [DOI] [PubMed]

[r22] 22.Ramirez, S., R. Moreno, O. Zafra, P. Castan, C. Valles, and J. Berenguer. 2000. Two nitrate/nitrite transporters are encoded within the mobilizable plasmid for nitrate respiration of Thermus thermophilus HB8. J. Bacteriol. 182:2179-2183. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r23] 23.Richardson, D. J., B. C. Berks, D. A. Russell, S. Spiro, and C. J. Taylor. 2001. Functional, biochemical and genetic diversity of prokaryotic nitrate reductases. Cell Mol. Life Sci. 58:165-178. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r24] 24.Rowe, J. J., T. Ubbink-Kok, D. Molenaar, W. N. Konings, and A. J. M. Driessen. 1994. NarK is a nitrite-extrusion system involved in anaerobic nitrate respiration by Escherichia coli. Mol. Microbiol. 12:579-586. [DOI] [PubMed] [Google Scholar]

[r25] 25.Rowe, J. J., J. M. Yarbrough, J. B. Rake, and R. G. Eagon. 1979. Nitrite inhibition of aerobic bacteria. Curr. Microbiol. 2:51-54. [Google Scholar]

[r26] 26.Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed., vol. 1 to 3. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.

[r27] 27.Schweizer, H. P. 1992. Allelic exchange in Pseudomonas aeruginosa using novel ColE1-type vectors and a family of cassettes containing a portable oriT and the counter-selectable Bacillus subtilis sacB marker. Mol. Microbiol. 6:1195-1204. [DOI] [PubMed] [Google Scholar]

[r28] 28.Schweizer, H. P. 1991. Escherichia-Pseudomonas shuttle vectors derived from pUC18/19. Gene 97:109-121. [DOI] [PubMed] [Google Scholar]

[r29] 29.Schweizer, H. P. 1993. Small broad-host-range gentamicin resistance gene cassettes for site-specific insertion and deletion mutagenesis. BioTechniques 15:831-834. [PubMed] [Google Scholar]

[r30] 30.Sias, S. R., and J. L. Ingraham. 1979. Isolation and analysis of mutants of Pseudomonas aeruginosa unable to assimilate nitrate. Arch. Microbiol. 122:263-270. [DOI] [PubMed] [Google Scholar]

[r31] 31.Simon, R., U. Priefer, and A. Pühler. 1983. A broad-host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram negative bacteria. Bio/Technology 1:784-791. [Google Scholar]

[r32] 32.Sohaskey, C. D., and L. G. Wayne. 2003. Role of narK2X and narGHJI in hypoxic upregulation of nitrate reduction by Mycobacterium tuberculosis. J. Bacteriol. 185:7247-7256. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r33] 33.Stewart, V., and C. H. MacGregor. 1982. Nitrate reductase in Escherichia coli K12: involvement of the chlC, chlE, and chlG loci. J. Bacteriol. 151:788-799. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r34] 34.Stover, C. K., X. Q. Pham, A. L. Erwin, S. D. Mizoguchi, P. Warrener, M. J. Hickey, F. S. Brinkman, W. O. Hufnagle, D. J. Kowalik, M. Lagrou, R. L. Garber, L. Goltry, E. Tolentino, S. Westbrock-Wadman, Y. Yuan, L. L. Brody, S. N. Coulter, K. R. Folger, A. Kas, K. Larbig, R. Lim, K. Smith, D. Spencer, G. K. Wong, Z. Wu, I. T. Paulsen, J. Reizer, M. H. Saier, R. E. Hancock, S. Lory, and M. V. Olson. 2000. Complete genome sequence of Pseudomonas aeruginosa PA01, an opportunistic pathogen. Nature 406:959-964. [DOI] [PubMed] [Google Scholar]

[r35] 35.Williams, D. R., J. J. Rowe, P. Romero, and R. G. Eagon. 1978. Denitrifying Pseudomonas aeruginosa: some parameters of growth and active transport. Appl. Environ. Microbiol. 36:257-263. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r36] 36.Wood, N. J., T. Alizadeh, D. J. Richardson, S. J. Ferguson, and J. W. Moir. 2002. Two domains of a dual-function NarK protein are required for nitrate uptake, the first step of denitrification in Paracoccus pantotrophus. Mol. Microbiol. 44:157-170. [DOI] [PubMed] [Google Scholar]

[r37] 37.Zumft, W. G. 1997. Cell biology and molecular basis of denitrification. Microbiol. Mol. Biol. Rev. 61:533-616. [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Involvement of NarK1 and NarK2 Proteins in Transport of Nitrate and Nitrite in the Denitrifying Bacterium Pseudomonas aeruginosa PAO1

Vandana Sharma

Chris E Noriega

John J Rowe

Abstract

MATERIALS AND METHODS