Abstract
Introduction
Epigenetic mechanisms play a crucial role in regulating genome expression and are subject to dysregulation in leukemia, hence exerting a significant impact on the pathogenesis of this malignancy. Maternally expressed gene 3 (MEG3), a long non-coding RNA, has been identified as a tumor suppressor in many hematologic malignancies due to its frequent down-regulation. This study aimed to examine the expression and methylation status of MEG3 in patients diagnosed with acute myeloid leukemia by employing the High-Resolution Melting (HRM) method.
Materials and Methods
The study employed quantitative RT-PCR to assess the expression of MEG3 in peripheral blood mononuclear cells (PBMCs) derived from a cohort of 62 individuals diagnosed with AML and 32 individuals as healthy controls. The study used the methylation-sensitive high-resolution melting (MS-HRM) method to assess the methylation status of the MEG3 promoter region.
Results
The MEG3 expression was significantly downregulated (P <0.0001) in patients with AML compared to healthy controls. Furthermore, the methylation level of the MEG3 promoter was significantly different between patients and controls (P<0.001). The average methylation rate of the MEG3 gene promoter in patients was 70.3%. A statistically significant negative association (r = −0.32, p = 0.03) was observed between MEG3 methylation and its expression.
Discussion
The expression of the MEG3 gene exhibited a significant decrease, while the promoter methylation level was elevated in patients. These findings suggest that MEG3 may function as a tumor suppressor gene and may have potential as a prognostic biomarker in AML. These findings suggest that targeting aberrant MEG3 promoter methylation could represent a potential therapeutic strategy in AML, though further studies are warranted to confirm this hypothesis.
Keywords: Acute myeloid leukemia, AML, Long non-coding RNA, Epigenetic, DNA methylation, MEG3, MS-HRM
Plain Language Summary
The expression of the MEG3 gene is markedly down-regulated in patients with AML.
A significant disparity in the methylation state of the MEG3 promoter is observed between persons diagnosed with AML and those considered healthy.
In patients with AML, a significant negative association has been observed between the expression of the MEG3 gene and the methylation of its promoter region.
Introduction
The excessive growth and accumulation of clonal myeloid blasts in the bone marrow, peripheral blood, or other organs characterize acute myeloid leukemia.1,2 AML is widely recognized as the prevailing form of leukemia in adults, while it ranks as the second most prevalent kind of leukemia in children. Despite the significant progress made in contemporary chemotherapy, the overall prognosis for individuals diagnosed with AML continues to be unfavorable. This malignancy proves deadly in approximately 50% of young patients and a staggering 80% of people aged 60 and above. This grim outcome can be attributed to various factors, including the development of resistance to treatment, disease recurrence, and mortality associated with the treatment itself.3 The application of high-throughput sequencing methods has led to the identification of genetic and epigenetic abnormalities within the AML genome. The role of epigenetic alterations in the etiology of AML has been demonstrated. Furthermore, research has shown that epigenetic abnormalities play a crucial role in the development of leukemia and may present novel opportunities for therapeutic intervention.1,4 Epigenetic aberrations may manifest in several DNA methylation regulators, chromatin regulatory systems, histone modifications, and long non-coding RNAs (lncRNA).5–8 An abnormal DNA methylation pattern is a notable epigenetic modification observed in numerous cancer types, especially in AML.9 The phenomenon of promoter hypermethylation, which leads to the transcriptional repression of tumor suppressor genes, has been extensively documented in AML.10
The Dlk1-MEG3 gene locus encodes for MEG3, a lncRNA that functions as a tumor suppressor gene in different malignancies.11,12 In multiple tumor types, MEG3 is subject to epigenetic silencing. Aberrant methylation patterns at the MEG3 locus have been observed in individuals diagnosed with multiple myeloma and myelodysplastic syndrome (MDS). This aberrant methylation is linked to a reduction in the overall survival rate of affected patients.8 MEG3 effectively reduces the proliferation of malignant cells in AML through a process dependent on the tumor suppressor protein p53. This is achieved by suppressing the expression of Mdm2.13,14 MEG3 may also exert its anti-proliferative effects through a mechanism independent of p53, potentially by downregulating DNMT3a. Research findings have indicated that TET2 facilitates the activation of the MEG3 gene in conjunction with WT1. Hence, TET2 mutation, a prevalent occurrence in AML, can potentially suppress MEG3 gene expression. Furthermore, it has been observed that MEG3 exerts a repressive effect on Rb phosphorylation by directly activating p16INK4A.14,15 Therefore, by the observed role of MEG3 as a tumor suppressor, it functions as an inhibitor of the cell cycle. The involvement of MEG3 in the regulation of angiogenesis via vascular endothelial growth factor (VEGF) signaling has been observed, indicating that the inhibition of this growth factor leads to the inhibition of angiogenesis.11 In brief, MEG3 functions as a tumor suppressor by regulating p53 and Rb, inhibiting cellular proliferation. Additionally, MEG3 inhibits VEGF, leading to a decrease in angiogenesis.
The MEG3 gene’s promoter region is characterized by a high density of CpG islands (CGI) and contains two distinct differentially methylated regions (DMRs) known as IG-DMR and MEG3-DMR. These DMRs serve as regulatory elements for the DLK1-MEG3 locus.16 Consequently, investigations have been conducted to examine the epigenetic alterations and methylation patterns within the promoter region of the MEG3 gene in diverse malignancies, including lymphoma, neuroblastoma, multiple myeloma, and MDS.17,18 Thus far, few studies have been conducted on MEG3 promoter methylation and its expression in AML. To achieve this objective, we assessed MEG3 promoter methylation and MEG3 mRNA expression using methylation-sensitive high-resolution melting (MS-HRM) and quantitative real-time PCR techniques in individuals newly diagnosed with AML.
Materials and Methods
Patients
This case-control study involved the participation of 62 patients diagnosed with AML, consisting of 37 male and 25 female individuals. The average age of the participants was 41.48 years. The diagnosis of patients with AML was conducted by a team of medical specialists, including hematologists and oncologists. This diagnostic process involved evaluating several factors, such as blood cell count, peripheral blood smear, clinical symptoms by the criteria established by the World Health Organization, and the utilization of flow cytometry testing. All participants were in the preliminary diagnostic phase and had not undergone chemotherapeutic treatment. The control group consisted of 32 healthy individuals, 19 males and 13 females, with an average age of 31.4 years. A volume of 5 mL of peripheral blood, which was treated with EDTA anticoagulant, was obtained from the study participants. Peripheral blood mononuclear cells (PBMC) were isolated by Pancoll (PAN-Biotech, Germany) density gradient centrifugation. Additionally, a questionnaire gathering clinical and laboratory information was filled out.
RNA Extraction and Real-Time PCR
Total RNA was isolated from PBMCs of all samples using the RiboEx kit (GeneAll, Korea), following the manufacturer’s instructions. RNA quantity and purity were assessed using the NanoDrop instrument (Eppendorf, Germany). A total of one µg of RNA samples underwent treatment with DNase I, which was free from RNase, obtained from Thermo Fisher. Subsequently, the RNA samples were subjected to reverse transcription using the Thermo Fisher Kit, following the instructions provided by the manufacturer. The quantitative real-time PCR (qRT-PCR) technique was employed to assess the expression level of MEG3. This analysis was conducted using the ABI StepOne Real-Time PCR instrument (Thermo Fisher, USA). The RT-qPCR experiment was conducted with SYBR Green as the fluorescent detection dye. The Abelson murine leukemia viral oncogene homolog (Abl-1) was employed as a reference gene to normalize the expression of MEG3. The primers sequence and their features were employed for the amplification in this study are summarized in Table 1.
Table 1.
Primers Used in Our Study
| Primer Name | Sequence | Length (bp) | |
|---|---|---|---|
| MEG-3 | F | 5′- CCTGCTGCCCATCTACACCTC −3′ | 116 bp |
| R | 5′- CCTCTTCATCCTTTGCCATCCTG-3′ | ||
| Abl-1 | F | 5′-TGGAGATAACACTCTAAGCATAACTAAAGGT-3′ | 128 bp |
| R | 5′- GATGTAGTTGCTTGGGACCCA −3′ | ||
| MEG-3 Methylation | F | 5′- AGGAGGATAGAGTTTATTTTAGAAG-3′ | 150 |
| R | 5′- TAACCTAAATTCACCCTACCTAA −3′ | ||
Abbreviations: F, Forward; R, Reverse.
The primers MEG3 forward (5′-CCTGCTGCCCATCTACACCTC-3′) and MEG3 reverse (5′-CCTCTTCATCCTTTGCCATCCTG-3′) were employed for the amplification of 116-bp products. This study conducted the RT-qPCR reaction using a total volume of 10 μL. The reaction mixture consisted of 5 μL of RealQ Plus 2X master mix green (Ampliqon), 0.3 μL of each forward and reverse primer (10 pmol), 0.5 μL of cDNA, and 4.2 μL of Nuclease-Free water. The experiment was conducted with two replicates for each reaction, and the thermal profile employed for amplifying target genes consisted of an initial denaturation step at 95°C for 15 minutes, followed by 40 cycles of denaturation at 95°C for 25 seconds, annealing at 61.5°C for 30 seconds, and extension at 72°C for 30 seconds. The determination of PCR reaction efficiency was conducted by employing successive dilutions of cDNA that had been amplified through RT-qPCR for both the target and reference genes. The relative expression level of MEG3 was determined using the 2-ΔΔCT technique.
DNA Extraction and Sodium Bisulfite Treatment
Genomic DNA was isolated from 94 peripheral blood mononuclear cell (PBMC) samples from patients and healthy controls. The extraction process utilized the Blood/Tissue DNA Extraction Mini Kit (DynaBio, Iran). The assessment of both the quantity and quality of the extracted DNA was conducted using a NonoDrop spectrophotometer (Eppendorf, Germany).
For bisulfite modification of genomic DNA, 2 µg of extracted DNA was treated with NaOH (3 Mol), NaHSo3 (2 Mol), and hydroquinone (HQ, 0.1 Mol). Bisulfite modification results in the conversion of unmethylated cytosines to uracil, whereas 5-methylcytosine residues remain unaltered. The converted DNA samples were maintained at a temperature of −80 °C until they were utilized for MS-HRM analysis.
Evaluation of MEG3 Promoter Methylation by MS-HRM
The methylation status of the MEG3 promoter was assessed using the methylation-sensitive high-resolution melting (MS-HRM) technique. The MEG3 promoter and CpG islands inside the promoter region were identified using the UCSC Genome Browser and Eukaryotic Promoter Database (EPD). The Oligo Analyzer Tool (IDT) evaluated the developed primers’ properties.
The MS-HRM experiment was conducted using the ABI StepOne Real-Time PCR equipment (Thermo Fisher, USA). The PCR amplification procedure was performed using a total volume of 10 μL. This volume included 1.85 μL of diluted modified template DNA, 5 μL of 2x EpiTect HRM PCR Master Mix (Qiagen, USA), and 0.75 μL of each primer (10 pmol). The primer pair sequences are listed in Tables 2.
Table 2.
Participant’s Demographic and Laboratory Data
| Group of Case | Mean Age (Year) | Sex* (%) | Mean WBC (106/L) | Mean Blast Cell% | Type of AML† (%) |
|---|---|---|---|---|---|
| Leukemic | 41.48±17.84 | F: 25(40.33) | 18.32±15.2 | 93.76 | M3:30(48.3) |
| M: 37(59.76) | Non M3:32(51.7) | ||||
| Non- leukemic | 31.40±3.32 | F: 13(40.63) | 8.24±2.6 | –– | –– |
| M: 19(59.37) |
Notes: *F: Female, M: Male
Abbreviations: †AML: Acute Myeloid Leukemia.
The EpiTect PCR Control DNA Set (Qiagen, Germany), consisting of commercial methylated and unmethylated DNA, was employed to optimize the experiment further and determine the extent of MEG3 promoter methylation in the samples. Each experimental run was prepared and utilized a series of standard curves consisting of varying ratios of fully methylated and unmethylated DNA controls (0%, 25%, 50%, 75%, and 100%). The control utilized in this study consisted of bisulfite-converted DNA obtained from individuals who were in a healthy state. To selectively amplify modified DNA, unmodified genomic DNA was employed as the substrate for primer amplification.
Statistical Analysis
The experiments conducted in this study were reproduced three times. The statistical analysis in this study was conducted using GraphPad Prism V6.07 software and a t-test. The data were presented as the mean ± the standard deviation (SD ± Mean). In all studies, confidence bounds were set at a 95% level. Statistical significance was determined by comparing the results to the control group, with *P<0.05, **P<0.01, and ***P<0.001 denoting different significance levels.
Results
Demographic Features of Patients
A total of 62 patients diagnosed with acute myeloid leukemia and who did not receive any treatment were included in the study. The patient characteristics have been summarized and are presented in Table 2.
The mRNA Expression of MEG3 was Reduced in Patients Compared to Healthy Controls
The quantification of MEG3 mRNA expression level was assessed using qRT-PCR in a cohort of 62 patients diagnosed with AML and in a control, group consisting of 32 individuals deemed healthy. The expression of MEG3 mRNA was shown to be significantly decreased in patients as compared to individuals without the disease (fold change of expression [FC] = 0.362, P <0.0001) (Figure 1). As demonstrated in Figure 2 MEG3 gene expression in patients with AML non-M3 is significantly lower than in patients with AML-M3.
Figure 1.
MEG3 mRNA expression in patients with AML and healthy controls. (A) The expression of MEG3 mRNA was evaluated in peripheral blood mononuclear cells (PBMNC) using quantitative real-time polymerase chain reaction (qRT-PCR). The expression of MEG3 was significantly reduced in patients with AML compared to individuals without the disease (fold change= 0.362, P < 0.0001). (B) The level of MEG3 expression in individuals diagnosed with AML Non-M3 was significantly diminished compared to those diagnosed with AML M3 (P < 0.01). ** P < 0.01, **** P < 0.0001.
Figure 2.
MEG3 promoter methylation status in AML patients and healthy controls. (A) Comparison of MEG3 promoter methylation levels between AML patients (n=62) and healthy controls (n=32). Methylation levels were significantly higher in AML patients compared to controls (P < 0.0001). (B) Subgroup analysis based on AML classification. Methylation levels were significantly higher in AML non-M3 patients (n=32) compared to AML-M3 patients (n=30) (P < 0.01). Both AML subgroups showed significantly higher methylation compared to healthy controls (P < 0.0001). **P < 0.01, ***P < 0.001, **** P < 0.0001.
The Level of Promoter Methylation of MEG3 was Higher in Patients Compared to Healthy Controls
The methylation status of the MEG3 promoter was examined using the MS-HRM assay to explore the influence of epigenetic mechanisms on the regulation of MEG3 gene expression. In light of the CpG island’s existence inside the MEG3 promoter region, an investigation was conducted to determine if the reduced expression of MEG3 mRNA transcripts in AML may be attributed to abnormal methylation of the MEG3 promoter. Estimating methylation levels in the samples was performed by comparing their normalized melting profiles with the melting profiles of standards with known ratios of the methylated to the unmethylated template.
The average methylation rate of the MEG-3 gene promoter in all patients diagnosed with AML was 70.3%, a significantly higher value than the methylation rate observed in healthy controls. Based on the level of methylation in control subjects, the cutoff value of 10% was considered to evaluate the level of methylation in patients. As shown in Figure 2A there is a significant disparity in methylation levels between the group of patients and the control group. Interestingly, when patients were categorized into two groups based on disease classification (AML-M3 and AML non-M3), a significant difference in the methylation status of the MEG3 promoter was detected across patients (Figure 2B).
Correlation Between the Expression Level of MEG3 and Its Promoter Methylation
Figure 3 revealed a significant inverse correlation (r = −0.31) between MEG3 gene expression and promoter methylation.
Figure 3.
The relationship between MEG3 gene expression and promoter methylation. An inverse correlation (r = −0.32) was observed, which was statistically significant between MEG3 gene expression and promoter methylation (P = 0.03). The red line represents the linear trend line fitted to the data points, illustrating the overall negative association between methylation levels and gene expression. Each black dot corresponds to an individual sample.
Discussion
The involvement of epigenetic events is significant in cancer formation and progression. The occurrence of mutations or deletions in tumor suppressor genes leads to the loss or inactivation of regulatory elements. Nevertheless, it is worth noting that loss of function can also be attributed to epigenetic modifications, including DNA methylation.19,20 Alterations in DNA methylation, particularly the excessive methylation of genes that repress tumor growth, have been proposed as a diagnostic and prognostic indicator in individuals afflicted with hematologic malignancies. By examining epigenetic patterns in acute myeloid leukemia, it is possible to uncover novel disease subgroups or prognostic biomarkers.21,22
A group of genes implicated in the epigenetic phenomenon consists of long non-coding RNAs (lncRNAs), which govern the modulation of gene expression in several ways. MEG-3, an example of lncRNAs, exhibits downregulated expression in several cancerous and tumorous conditions.23 In addition to its involvement in physiological activities, MEG-3 has been implicated in the pathogenesis of carcinogenesis.24,25 The regulatory role of MEG3 has been reported in the expression of the p53 gene and its ability to trigger p53 transcription through distinct mechanisms. This is thought to result in reduced MDM2 levels occurs, subsequently preventing ubiquitin-mediated degradation of p53. These finding are supported by through the observed decrease in MDM2 expression after the induced augmentation of MEG3 expression. MEG3 has been shown to interact with the DNA-binding domain of p53 and the target genes regulated by p53.13
The observation of reduced MEG-3 expression has been documented in multiple types of tumor tissues. Zhang et al observed a notable decrease in MEG-3 expression in pituitary adenoma compared to normal tissue.24 The downregulation of MEG-3 has also been documented in other cancer cell lines, including those derived from breast, cervical, colon, liver, lung, and prostate tissues.25 Furthermore, it has been observed that the reduced expression of MEG3 is linked to aberrant hypermethylation of the MEG3 promoter in many types of malignancies and carcinomas.26 This present investigation aimed to evaluate the expression of the MEG3 gene and the methylation status of its promoter in individuals diagnosed with AML. The examination of MEG3 mRNA level revealed a significant reduction in MEG3 expression among individuals diagnosed with AML compared to the controls. This observation aligns with other research findings. Prior research has demonstrated that dysregulated expression of MEG3, resulting from DNA hypermethylation, has been observed in lymphoma, neuroblastoma, multiple myeloma, and myelodysplastic syndromes (MDS).17 Consequently, we hypothesized that the observed down-regulation of MEG3 in our subjects may be associated with abnormal methylation patterns of CpG sites within the MEG3 promoter region. Therefore, in the subsequent phase, we assessed MEG3 promoter methylation using the methylation-sensitive high-resolution melting (MS-HRM) technique. The findings of the study demonstrated a statistically significant disparity in the methylation of the MEG3 gene promoter region between individuals diagnosed with AML and a group of healthy individuals serving as controls. Specifically, patients with AML exhibited a noticeably elevated degree of methylation in comparison to the control group. The average methylation rate of the MEG-3 gene promoter in all patients diagnosed with AML was 70.3%, a significantly higher value than the methylation rate observed in healthy controls. Interestingly, when patients were categorized into two groups based on disease classification (AML-M3 and AML non-M3), a significant difference in the methylation status of the MEG3 promoter was detected across patients. Similarly, there was a significant decrease in MEG3 gene expression among all patients compared to healthy participants and patients with AML non-M3 compared to patients with AML-M3. Based on the results obtained from our research, Dong et al conducted a study wherein they employed the MSP technique to investigate the involvement of MEG3 and its methylation status in both esophageal cancer cells and clinical samples of ESCC. Based on the findings, a notable reduction in the expression of MEG3 was detected in both esophageal cancer cells and ESCC tissues. Moreover, the expression level of MEG3 in cancer cells exhibited a substantial increase after treatment with 5-Aza-dC, a DNA methyltransferase inhibitor.26 In a study conducted by Ding et al, they examined the expression and methylation status of MEG3 long non-coding RNA (lncRNA) in gastric cancer tissues using the methylation-specific PCR (MSP) method. It was observed that the re-expression of MEG3 or the inhibition of its methylation resulted in the inhibition of tumor growth, as demonstrated in both in vivo and in vitro settings.27 Li et al also employed real-time PCR and methylation-specific PCR (MSP) techniques to examine the gene expression and methylation patterns of MEG-3 in breast cancer tissues, as well as in cell lines including MDA-MB-231, Bcap-37, MCF-7, and SK-BR-3. The study demonstrated a significant reduction in the expression level of MEG3 in breast cancer tissues compared to the neighboring normal tissues. Furthermore, there was a notable elevation in MEG3 methylation levels observed in breast cancer cells compared to the adjacent normal tissues.28
In conclusion, the findings of our study indicate a downregulation of MEG3 gene expression and promoter hypermethylation methylation in patients diagnosed with AML. These findings suggest that MEG3 has the potential to function as a tumor suppressor gene and serve as a prognostic factor in AML. Furthermore, it is possible that the transcriptional silencing of MEG3 may play a role in the development and progression of AML. Given the reversible nature of epigenetic marks, the aberrant methylation and expression of MEG3 could represent a potential target for future therapeutic interventions.
Limitations
We acknowledge several limitations in this study. First, the sample size was relatively small, and methylation analysis was performed on a subset of patients due to limited DNA availability. Second, comprehensive cytogenetic and molecular data for ELN risk stratification were not available, and we were unable to assess the relationship between MEG3 promoter methylation and genetic risk categories. Third, because this was a cross-sectional study conducted at the time of initial diagnosis, we did not have access to treatment or survival outcome data. Therefore, our findings are preliminary and hypothesis-generating, and future prospective studies with larger cohorts, comprehensive genetic profiling, and long-term follow-up are needed to validate the clinical utility of MEG3 promoter methylation as a prognostic biomarker in AML.
Funding Statement
This study gained no funding from any financial agencies in the public, commercial, or not-for-profit sectors.
Abbreviations
ROS, Reactive oxygen species; MnSOD, Manganese Superoxide Dismutase; SNV, Single Nucleotide variant; HRM, High Resolution Melting.
Data Sharing Statement
Please contact corresponding author for data requests.
Ethics Approval and Consent to Participate
This experimental study accessed ethics approval from Research Ethics Committee of AJA University of Medical Sciences (Tehran, Iran) (no. IR.AJAUMS.REC.1398.191). The study protocol was done under circumstances of ethical guidelines of 1975 Helsinki Declaration written informed consent was obtained from the patients.
Author Contributions
All authors made a significant contribution to the work reported, whether that is in the conception, study design, execution, acquisition of data, analysis and interpretation, or in all these areas; took part in drafting, revising or critically reviewing the article; gave final approval of the version to be published; have agreed on the journal to which the article has been submitted; and agree to be accountable for all aspects of the work.
Disclosure
All of the authors and co-authors declare that there is no conflict of interest regarding to the concept and publication of this article in molecular biology reports journal. There are not any non-financial and other competing interest’s disclosures.
References
- 1.Metzeler KH, Herold T, Rothenberg-Thurley M, et al. Spectrum and prognostic relevance of driver gene mutations in acute myeloid leukemia. Blood J Am Soc Hematol. 2016;128(5):686–9. [DOI] [PubMed] [Google Scholar]
- 2.Döhner H, Weisdorf DJ, Bloomfield CD. Acute myeloid leukemia. N Engl J Med. 2015;373(12):1136–1152. doi: 10.1056/NEJMra1406184 [DOI] [PubMed] [Google Scholar]
- 3.Papaemmanuil E, Gerstung M, Bullinger L, et al. Genomic classification and prognosis in acute myeloid leukemia. N Engl J Med. 2016;374(23):2209–2221. doi: 10.1056/NEJMoa1516192 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Network CGAR. Genomic and epigenomic landscapes of adult de novo acute myeloid leukemia. N Engl J Med. 2013;368(22):2059–2074. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Wouters BJ, Delwel R. Epigenetics and approaches to targeted epigenetic therapy in acute myeloid leukemia. Blood. J Am Soc Hematol. 2016;127(1):42–52. [DOI] [PubMed] [Google Scholar]
- 6.Liu X, Gong Y. Isocitrate dehydrogenase inhibitors in acute myeloid leukemia. Biomarker Res. 2019;7(1):1–8. doi: 10.1186/s40364-019-0173-z [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Döhner H, Estey E, Grimwade D, et al. Diagnosis and management of AML in adults: 2017 ELN recommendations from an international expert panel. Blood. J Am Soc Hematol. 2017;129(4):424–447. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Benetatos L, Hatzimichael E, Dasoula A, et al. CpG methylation analysis of the MEG3 and SNRPN imprinted genes in acute myeloid leukemia and myelodysplastic syndromes. Leukemia Res. 2010;34(2):148–153. doi: 10.1016/j.leukres.2009.06.019 [DOI] [PubMed] [Google Scholar]
- 9.Spencer DH, Russler-Germain DA, Ketkar S, et al. CpG island hypermethylation mediated by DNMT3A is a consequence of AML progression. Cell. 2017;168(5):801–16.e13. doi: 10.1016/j.cell.2017.01.021 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Zhang Y, Jiang Q, Kong X, et al. Methylation status of the promoter region of the human frizzled 9 gene in acute myeloid leukemia. Mol Med Rep. 2016;14(2):1339–1344. doi: 10.3892/mmr.2016.5387 [DOI] [PubMed] [Google Scholar]
- 11.Zhou Y, Zhang X, Klibanski A. MEG3 noncoding RNA: a tumor suppressor. J mol endocrinol. 2012;48(3):R45–R53. doi: 10.1530/JME-12-0008 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Benetatos L, Vartholomatos G, Hatzimichael E. MEG3 imprinted gene contribution in tumorigenesis. Int J Cancer. 2011;129(4):773–779. doi: 10.1002/ijc.26052 [DOI] [PubMed] [Google Scholar]
- 13.Zhou Y, Zhong Y, Wang Y, et al. Activation of p53 by MEG3 non-coding RNA. J Biol Chem. 2007;282(34):24731–24742. doi: 10.1074/jbc.M702029200 [DOI] [PubMed] [Google Scholar]
- 14.Lyu Y, Lou J, Yang Y, et al. Dysfunction of the WT1-MEG3 signaling promotes AML leukemogenesis via p53-dependent and-independent pathways. Leukemia. 2017;31(12):2543–2551. doi: 10.1038/leu.2017.116 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Zhang X, Zhou Y, Klibanski A. Isolation and characterization of novel pituitary tumor related genes: a cDNA representational difference approach. Mol Cell Endocrinol. 2010;326(1–2):40–47. doi: 10.1016/j.mce.2010.02.040 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.da Rocha ST, Edwards CA, Ito M, Ogata T, Ferguson-Smith AC, Rocha STD. Genomic imprinting at the mammalian Dlk1-Dio3 domain. Trends Genet. 2008;24(6):306–316. doi: 10.1016/j.tig.2008.03.011 [DOI] [PubMed] [Google Scholar]
- 17.Benetatos L, Dasoula A, Hatzimichael E, Georgiou I, Syrrou M, Bourantas KL. Promoter hypermethylation of the MEG3 (DLK1/MEG3) imprinted gene in multiple myeloma. Clil lymph myelom. 2008;8(3):171–175. doi: 10.3816/CLM.2008.n.021 [DOI] [PubMed] [Google Scholar]
- 18.Khoury H, Suarez-Saiz F, Wu S, Minden MD. An upstream insulator regulates DLK1 imprinting in AML. Blood. 2010;115(11):2260–2263. doi: 10.1182/blood-2009-03-212746 [DOI] [PubMed] [Google Scholar]
- 19.Jones PA, Baylin SB. The fundamental role of epigenetic events in cancer. Nat Rev Genet. 2002;3(6):415–428. doi: 10.1038/nrg816 [DOI] [PubMed] [Google Scholar]
- 20.Herman JG, Baylin SB. Gene silencing in cancer in association with promoter hypermethylation. N Engl J Med. 2003;349(21):2042–2054. doi: 10.1056/NEJMra023075 [DOI] [PubMed] [Google Scholar]
- 21.Yao H, Duan M, Lin L, et al. TET2 and MEG3 promoter methylation is associated with acute myeloid leukemia in a Hainan population. Oncotarget. 2017;8(11):18337. doi: 10.18632/oncotarget.15440 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Babaei H, Mohammadi M, Salehi R. DNA methylation analysis of secreted frizzled-related protein 2 gene for the early detection of colorectal cancer in fecal DNA. Niger Med J. 2016;57(4):242. doi: 10.4103/0300-1652.188357 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Braconi C, Kogure T, Valeri N, et al. microRNA-29 can regulate expression of the long non-coding RNA gene MEG3 in hepatocellular cancer. Oncogene. 2011;30(47):4750–4756. doi: 10.1038/onc.2011.193 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Zhang X, Zhou Y, Mehta KR, et al. A pituitary-derived MEG3 isoform functions as a growth suppressor in tumor cells. J Clin Endocrinol Metab. 2003;88(11):5119–5126. doi: 10.1210/jc.2003-030222 [DOI] [PubMed] [Google Scholar]
- 25.Zhang J, Yao T, Wang Y, Yu J, Liu Y, Lin Z. Long noncoding RNA MEG3 is downregulated in cervical cancer and affects cell proliferation and apoptosis by regulating miR-21. Cancer Biol Ther. 2016;17(1):104–113. doi: 10.1080/15384047.2015.1108496 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Dong Z, Zhang A, Liu S, et al. Aberrant methylation-mediated silencing of lncRNA MEG3 functions as a ceRNA in esophageal cancer. Mol Cancer Res. 2017;15(7):800–810. doi: 10.1158/1541-7786.MCR-16-0385 [DOI] [PubMed] [Google Scholar]
- 27.Ding L, Tian Y, Wang L, Bi M, Teng D, Hong S. Hypermethylated long noncoding RNA MEG3 promotes the progression of gastric cancer. Aging. 2019;11(19):8139. doi: 10.18632/aging.102309 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Li H, Wang P, Liu J, et al. Hypermethylation of lncRNA MEG3 impairs chemosensitivity of breast cancer cells. J clin Lab Analysis. 2020;34(9):e23369. doi: 10.1002/jcla.23369 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Please contact corresponding author for data requests.