Summary
Urothelial barrier compromise defines inflammatory cystitis, though molecular regulators remain elusive. We identify claudin-12—a bladder-enriched tight junction protein—as an essential barrier component against uropathogenic E. coli (UPEC) invasion. At 72 h post-infection in the murine model of UPEC-induced cystitis, infection triggered dysregulation of canonical tight junction components (claudin-12, ZO-1, occludin), with claudin-12 exhibiting maximal depletion. Immunofluorescence confirmed profound tight junction disassembly in infected bladders. Consistent with this structural defect, claudin-12-knockout mice developed exacerbated acute cystitis, manifesting elevated bacterial colonization, neutrophil/monocyte infiltration, pro-inflammatory gene upregulation, and epithelial denudation. Mechanistically, claudin-12 loss increased calcium permeability in urothelial cells during UPEC infection, driving intracellular calcium accumulation and subsequent activation of apoptosis-related pathways. Notably, pharmacological inhibition of calcium accumulation by TMB-8 reversed both UPEC-induced apoptosis and claudin-12 depletion. Thus, claudin-12 emerges as a pivotal orchestrator of urothelial defense, wherein its regulation of calcium flux restrains UPEC-driven inflammation—revealing therapeutic potential for barrier-repair strategies.
Keyword: claudin-12, UPEC, calcium-dependent, immunomodulation, tight junction
Graphical abstract
Highlights
-
•
Claudin-12 is a tight junction protein acting as a defender against UPEC
-
•
Genetic ablation of claudin-12 exacerbates UPEC-induced pathology
-
•
UPEC-induced calcium overload drives urothelial apoptosis and claudin-12 depletion
-
•
TMB-8 blocks calcium overload to alleviate claudin-12 expression and UPEC-induced injury
Microbiology; Cell biology
Introduction
The mammalian urothelium orchestrates a formidable, multi-layered defense system, integrating an impermeable glycosaminoglycan matrix with dynamically regulated tight junction (TJ) complexes to maintain solute homeostasis and prevent pathogen ingress.1,2,3 However, this barrier is frequently compromised. In over 80% of cystitis cases, uropathogenic E. coli (UPEC) breaches these defenses to colonize umbrella cells and establish persistent, antibiotic-resistant intracellular reservoirs.4 While current therapeutic strategies primarily target downstream inflammatory mediators such as IL-6 and TNF-α, the upstream molecular guardians of urothelial barrier integrity—particularly the TJ components—remain incompletely defined.5 This critical knowledge gap limits the development of barrier-targeted interventions.
Beyond their classical role as passive paracellular seals, emerging evidence reveals that claudin isoforms actively orchestrate tissue-specific mucosal immunity.6 For instance, Claudin-4 neutralizes Helicobacter pylori virulence factors via electrostatic repulsion, while Claudin-18.2 and Claudin-2 regulate inflammatory cascades in the alveoli and renal tubules, respectively.7,8 In the bladder, Claudin-12 is exceptionally abundant in umbrella cells but has historically been characterized merely as a passive calcium channel.9,10,11 However, recent transcriptomic analyses reveal its significant co-expression with key immunoregulatory loci (e.g., NFKB1, IL6R), suggesting undiscovered immunological functions. These associations position Claudin-12 as a putative interlock between calcium signaling and mucosal immunity in the urothelium.
During infection, UPEC actively dismantles this TJ network to invade the epithelium and evade host immunity, driving severe complications including pyelonephritis and urosepsis.12,13,14 The bacterium employs a multi-pronged molecular assault: , FimH-dependent endocytosis hijacks Rab27b/OCRL1 complexes to degrade occludin; α-hemolysin pores induce calpain-mediated calcium overload to deplete claudin-4/-8; and lipopolysaccharide (LPS)-TLR4 signaling suppresses ZO-1 transcription.12 Notably, clinical and experimental data indicate that UPEC-induced depletion of Claudin-12 is uniquely severe, far exceeding the loss of other TJ components. Despite its prominent expression in the bladder, the specific functional contribution of Claudin-12 to innate mucosal defense during cystitis remains entirely unexplored.9
Here, we hypothesize that Claudin-12 functions as a critical coordinator of innate immune defense within the urothelial barrier network. Using murine models and in vitro systems, we demonstrate that Claudin-12 deficiency severely exacerbates UPEC colonization, tissue damage, and pathogenic immune cell infiltration during infection. Our findings establish Claudin-12 as a pivotal TJ protein regulating bladder barrier-immune crosstalk, unveiling a potential structural target for immunotherapeutic intervention in urinary tract infections (UTIs).
Results
Pronounced tissue-specific expression of CLAUDIN-12 in bladder epithelial cells
The bladder epithelium forms a specialized cellular barrier essential for urinary tract integrity, a function underpinned by TJ proteins including claudins, occludin, and zonula occludens-1 (ZO-1). To characterize bladder-specific TJ signatures, we evaluated mouse primary bladder epithelial cells and smooth muscle cells. RT-PCR analysis revealed elevated mRNA expression of Cldn2, Cldn4, Cldn8, Cldn12, Ocln, and Zo1 in bladder epithelial cells (Figure 1A). Primer sequences were listed in Table 1. Strikingly, at the protein level, claudin-12, occludin, and ZO-1 expression in E-cadherin+ primary bladder epithelial cells significantly exceeded levels in α-SMA+ smooth muscle cells, highlighting pronounced bladder epithelial specificity, particularly for claudin-12 (Figure 1B). This specificity was confirmed by immunohistochemical analysis demonstrating co-expression of E-cadherin with claudin-12, occludin, and ZO-1 in bladder epithelial cells (Figure 1C).
Figure 1.
Tight junction protein expression in bladder epithelium
(A) mRNA expression of tight junction genes in primary mouse bladder epithelial cells (BECs) versus smooth muscle cells (SMCs). Data are shown as mean ± SD (n = 6 biological replicates).
(B) Immunoblots demonstrate Claudin-12, Occludin, and ZO-1 protein expression in BECs and SMCs. GAPDH served as a loading control.
(C) Representative immunohistochemistry images showing E-cadherin, Claudin-12, Occludin, and ZO-1 localization in murine bladder sections. Scale bars indicated in images. The bar graph summarizes the IHC scores of these four markers in ECs and SMCs (n = 5). Statistical significance determined by Mann-Whitney U test (∗∗p < 0.01 and ∗∗∗p < 0.001, ns = not significant). Data are presented as mean ± standard error of the mean (SEM).
Table 1.
Primer sequences used for qPCR
| Gene | Forward primer | Reverse primer |
|---|---|---|
| Cldn1 | GGACTGTGGATGTCCTGCGTTT | GCCAATTACCATCAAGGCTCGG |
| Cldn2 | AGGACTTCCTGCTGACATCCAG | AATCCTGGCAGAACACGGTGCA |
| Cldn4 | CGAGCCCTTATGGTCATCAGCA | ATGCTTGCCACGATGAACACGG |
| Cldn8 | GTGGAGAGTGTCTGCCTTCATC | TAAGAGCCAGCAGGGAGTCGTA |
| Cldn12 | GGACTCTGCTTCCTAACTGGAG | TCAGGCAGTCACTGCTTCCATC |
| Ocln | TGGCAAGCGATCATACCCAGAG | CTGCCTGAAGTCATCCACACTC |
| Zo1 | GTTGGTACGGTGCCCTGAAAGA | GCTGACAGGTAGGACAGACGAT |
| Tnfa | GGTGCCTATGTCTCAGCCTCTT | GCCATAGAACTGATGAGAGGGAG |
| Il6 | TACCACTTCACAAGTCGGAGGC | CTGCAAGTGCATCATCGTTGTTC |
| Il-1b | CCTCTCCAGCCAAGCTTCC | CTCATCAGGACAGCCCAGGT |
| Ccl2 | GCTACAAGAGGATCACCAGCAG | GTCTGGACCCATTCCTTCTTGG |
| Ccl5 | CCTGCTGCTTTGCCTACCTCTC | ACACACTTGGCGGTTCCTTCGA |
| Cxcl3 | TGAGACCATCCAGAGCTTGACG | CCTTGGGGGTTGAGGCAAACTT |
| Cxcl5 | CCGCTGGCATTTCTGTTGCTGT | CAGGGATCACCTCCAAATTAGCG |
| Cxcl10 | ATCATCCCTGCGAGCCTATCCT | GACCTTTTTTGGCTAAACGCTTTC |
| Gapdh | TCTCTGCTCCTCCCTGTTCC | TACGGCCAAATCCGTTCACA |
UPEC infection compromises tight junction integrity via CLAUDIN-12 downregulation
The bladder urothelium serves as the primary defense against UTIs, though bacterial virulence factors can trigger urothelial apoptosis and barrier dysfunction. To determine whether UPEC infection disrupts TJ integrity, we established an acute cystitis mouse model via intravesical UPEC instillation. At 72 h post-infection, histopathological analysis confirmed robust inflammation, characterized by full-thickness immune cell infiltration, epithelial necrosis, and urothelial sloughing (Figures 2A and 2B). We next assessed TJ molecule expression. UPEC infection significantly downregulated Claudin-12 and ZO-1 expression at both mRNA and protein levels (Figures 2C and 2D). Consistent with this, quantitative immunohistochemistry revealed a significant reduction in Claudin-12 (CLDN12) and ZO-1 (TJP1) protein within the infected bladder urothelium (Figure 2E).
Figure 2.
UPEC downregulates tight junction protein expression in bladder urothelium
(A) Schematic representation of UPEC-induced cystitis mouse model establishment.
(B) Representative H&E-stained bladder sections from PBS-treated control and UPEC-infected mice. Arrows indicate pathological features including inflammatory cell infiltration, epithelial denudation, and submucosal edema. Scale bars, 100 μm.
(C) mRNA expression levels of Cldn12, Ocln, and Zo1 in bladder tissues 72 h post-infection. Data are presented as mean ± SEM (n = 6 mice/group).
(D) Immunoblots show protein expression of Claudin-12 (CLDN12), Occludin (OCLN), and ZO-1 (TJP1) in bladder lysates with GAPDH loading control.
(E) Immunohistochemistry of Claudin-12 and ZO-1 in bladder urothelium after UPEC infection. Representative images are shown, and the bar graph summarizes the IHC scores exclusively within the existing urothelial cell layers (n = 6 mice per group). Scale bars, 50 μm. Statistical significance determined by Mann-Whitney U test (∗p < 0.05; ∗∗p < 0.01, and ∗∗∗p < 0.001, ns = not significant). Data are presented as mean ± standard error of the mean (SEM).
CLAUDIN-12 deficiency exacerbates UPEC pathogenesis by compromising barrier integrity
Given claudin-12 downregulation during UPEC infection, we investigated its functional role in barrier defense. Using wild-type (WT) and Cldn12−/− mice in an acute UPEC cystitis model, we found that genetic loss of claudin-12 exacerbated disease severity. Histopathological quantification revealed significantly elevated inflammation in Cldn12−/− bladders, manifesting as: increased full-thickness inflammatory cell infiltration, and severe epithelial denudation and submucosal edema, and a higher overall cystitis score. (Figures 3A–3C). Notably, baseline tissue architecture remained intact, with no observable tissue damage or inflammation in either WT or Cldn12−/− mice in the absence of infection. Consistent with barrier compromise, Cldn12−/− bladders exhibited greater UPEC colonization in epithelial lysates (Figure 3D). Furthermore, Cldn12−/− bladder epithelial cells showed marked upregulation of pro-inflammatory cytokine (Tnfa, Il6, Il1b) and chemokine (Ccl2, Ccl5, Cxcl3, Cxcl5) gene expression (Figure 3E). Collectively, these results demonstrate that claudin-12 critically restricts UPEC invasion and mitigates tissue damage during cystitis by preserving barrier integrity.
Figure 3.
Claudin-12 deficiency exacerbates UPEC-induced cystitis severity
(A) Experimental schematic of UPEC cystitis model in wild-type (WT) versus Cldn12−/− mice.
(B) Representative H&E-stained bladder sections from UPEC-infected WT and Cldn12−/− mice. Scale bars: 100 μm.
(C) Quantitative histopathological scoring of bladder inflammation.
(D) Bacterial burden quantification in bladder tissues expressed as log10 CFU per organ. Data represent mean ± SEM (n = 3 mice/group across two independent experiments; ∗p < 0.05 by Student’s t test).
(E) Relative mRNA expression of pro-inflammatory cytokines and chemokines in bladder epithelium post-infection. Data are shown as mean ± SD (n = 6 biological replicates; ∗p < 0.05, ∗∗p < 0.01, and ∗∗∗p < 0.001; ns = not significant by Mann-Whitney U test). Data are presented as mean ± standard error of the mean (SEM).
CLAUDIN-12 deficiency drives compartmentalized immune cell infiltration in cystitis
Immune cell infiltration is a hallmark of cystitis pathogenesis, as recruited leukocytes amplify tissue damage through cytokine and mediator release. Given the exacerbated inflammation observed in Cldn12−/− mice during UPEC infection, we characterized immune cell subtypes infiltrating the bladder using flow cytometry. This analysis revealed significantly increased proportions and absolute numbers in Cldn12−/− versus WT bladders: a 2.06-fold increase in CD45+ leukocytes; 2.03-fold for CD4+ and 2.81-fold CD8+ T cells; 2.7-fold for Ly6G + CD11b+ neutrophils; and 1.57-fold for CD11b+ monocytes and 1.67-fold for F4/80+ macrophages (Figures 4A and 4B). Spatially, immunohistochemistry demonstrated accumulation of these immune populations across compartments—extending from the epithelial layer deep into subepithelial regions (Figure 4C). Collectively, claudin-12 deficiency facilitates pan-compartment immune infiltration, implicating barrier integrity as a critical regulator of cystitis-associated inflammation.
Figure 4.
Claudin-12 deficiency promotes immune cell infiltration in bladder during UPEC cystitis
(A) Representative flow cytometry gating strategy for immune cell subsets in wild-type (WT) versus Cldn12−/− mice: CD45+ leukocytes, F4/80+ macrophages, Ly6G+CD11b+ neutrophils, CD11b+ monocytes, CD4+ T cells, and CD8+ T cells from bladder single-cell suspensions.
(B) Quantitative analysis of immune cell infiltration showing percentage (left) and absolute counts (right) of indicated populations in UPEC-infected bladders. Data represent mean ± SEM (n = 6 WT, n = 5 Cldn12−/−; ∗p < 0.05, ∗∗p < 0.01, and ∗∗∗p < 0.001 by Mann-Whitney U test).
(C) Representative immunohistochemistry images of immune cell markers (CD45, F4/80, CD11b, Ly6G, CD4, CD8) in bladder sections from WT and Cldn12−/− mice. Scale bars, 50 μm. Data are presented as mean ± standard error of the mean (SEM).
Calcium flux mediates epithelial cell apoptosis and CLAUDIN-12 downregulation
Although Claudin-12 protects against UPEC infection, it is downregulated during this process; the underlying mechanism remains unknown. UPEC hemolysin (HlyA) is known to disrupt host membranes, inducing extracellular calcium influx and release from intracellular stores. Consistent with this, we confirmed elevated intracellular calcium levels in UPEC-infected mouse bladder epithelial cells (Figure 5A). Given that elevated intracellular calcium can activate apoptotic pathways, we investigated whether blocking calcium release would reverse infection-induced apoptosis. TMB-8 (8-(N,N-diethylamino)octyl-3,4,5-trimethoxybenzoate), an intracellular calcium antagonist, significantly inhibited UPEC-induced intracellular calcium release (Figure 5B). Concurrently, TMB-8 attenuated UPEC-induced apoptosis and caspase-dependent apoptotic pathways in vitro (Figures 5C and 5D). Notably, TMB-8 also blocked infection-triggered Claudin-12 downregulation (Figures 5C and 5D). These findings implicate intracellular calcium accumulation as a potential mechanism for Claudin-12 downregulation. Collectively, calcium-mediated pathways represent a key mechanism for UPEC-induced epithelial apoptosis, acting partly through regulation of Claudin-12.
Figure 5.
Intracellular calcium inhibition attenuates UPEC-induced epithelial apoptosis and Claudin-12 degradation
(A) Intracellular calcium levels in primary bladder epithelial cells from WT and Cldn12−/− mice after UPEC infection (MOI 10).
(B) Calcium flux quantification in epithelial cells treated with UPEC ± TMB-8 (100 μM intracellular calcium antagonist).
(C and D) Annexin V/PI apoptosis assays: (C) Representative flow cytometry plots; (D) Quantification of apoptotic cells. Data represent mean ± SEM of five independent experiments (Kruskal-Wallis test ∗p < 0.05, ∗∗∗p < 0.001).
(E) Immunoblots of Claudin-12 and caspase-3/8 cleavage in epithelial cells treated with UPEC ± TMB-8. GAPDH serves as loading control. Bubble plot showing the quantification of relative expression levels for the indicated proteins across three independent replicates. Data are presented as mean ± standard error of the mean (SEM).
Discussion
The bladder epithelium serves as a critical physicochemical barrier against urinary pathogens, with claudin-based TJs constituting a central element of its defensive function.9,15,16 Our data identify Claudin-12 as a signature TJ protein in bladder epithelia, demonstrating markedly elevated expression in murine urothelial cells relative to other cell types. This tissue-specific enrichment suggests a specialized role in maintaining urothelial integrity—a premise strongly supported by the rapid downregulation of both Claudin-12 and ZO-1 at 72 h post-UPEC infection. The conservation of this response across both in vivo and in vitro models confirms that targeted TJ disruption represents a core strategy in UPEC pathogenesis, directly facilitating bacterial invasion and tissue compromise.
The severe exacerbation of cystitis observed in Cldn12−/− mice provides definitive genetic evidence for Claudin-12’s non-redundant function in UPEC containment. Infected knockout mice exhibited accelerated epithelial denudation, enhanced bacterial colonization, and deeper submucosal invasion. Crucially, Claudin-12 deficiency enabled pan-compartment immune infiltration, including substantial accumulation of neutrophils and macrophages within subepithelial zones. This spatial dysregulation demonstrates that Claudin-12 maintains compartmentalized barrier function, thereby restraining immune cells to appropriate epithelial interfaces where they can control pathogens without inducing destructive transmural damage. Interestingly, our preliminary observations suggest that Claudin-12 deficiency may lead to a concomitant downregulation of ZO-1, without significantly affecting Occludin or E-cadherin levels. This implies that Claudin-12 might play a selective structural role in maintaining specific components of the TJ complex during UPEC infection, a dynamic that warrants further investigation. We further identify calcium overload as a key mechanistic trigger for barrier failure during UPEC infection. UPEC hemolysin (HlyA)-induced membrane perforation causes uncontrolled calcium influx, subsequently activating caspase-3/8-dependent apoptosis—a process markedly amplified by Claudin-12 downregulation. Strikingly, increased intracellular calcium downregulated Claudin-12 expression, whereas pharmacological inhibition of calcium release using TMB-8 prevented Claudin-12 decrease. These data strongly suggest that calcium concentration plays a regulatory role in Claudin-12 transcription and/or protein stability. In other words, calcium-mediated apoptosis may require TJ disassembly, although the precise regulatory mechanisms warrant further investigation. Our experiments establish a bidirectional relationship that positions calcium flux as an upstream regulator of Claudin-12-mediated barrier maintenance. Beyond its mechanistic importance, this calcium/Claudin-12 axis presents a highly promising target for non-antibiotic therapies. As our TMB-8 data suggest, utilizing calcium channel blockers could serve as a host-directed therapy (HDT) to counteract UPEC colonization and bolster local defense. Crucially, this approach enhances the host’s intrinsic barrier functions without exerting selective pressure on bacteria or compromising the beneficial commensal microbiome, thereby offering a significant advantage over conventional antibiotic treatments.
Leveraging this mechanism, we demonstrated that inhibition of intracellular calcium release robustly ameliorated UPEC-induced apoptosis and attenuated epithelial damage—confirming that calcium modulation corrects both molecular and phenotypic hallmarks of infection. The efficacy of calcium inhibition highlights its potential as a targeted intervention against TJ dysfunction and epithelial apoptosis. In an era of rising antibiotic resistance, calcium-mediated barrier reinforcement represents a promising “host-directed” therapeutic strategy to disrupt UPEC pathogenesis.
Our findings significantly expand the functional paradigm of claudins from passive barrier components to active immune modulators. Claudin-12’s role echoes observations in intestinal epithelia, where claudin-18 deficiency permits H. pylori translocation, and in pulmonary epithelium, where claudin-18 and -4 help maintain barrier integrity against pathogens.17,18,19,20,21 However, its specific regulation by calcium influx appears unique to urothelial defense. The profound immune dysregulation in Cldn12−/− mice suggests that TJ integrity finely calibrates leukocyte trafficking, preventing destructive subepithelial accumulation while preserving antimicrobial capacity.11,22 This positions urothelial Claudin-12 as a critical gatekeeper determining infection resolution versus progression to chronic inflammation.
Limitations of the study
Several limitations and future directions emerge from this work. While murine models and transformed cell lines were indispensable for mechanistic dissection, their applicability to human cystitis requires validation in primary human urothelial cultures, patient-derived organoids, or human tissue explants. Evaluating the model at a single 72-h time point may be insufficient to fully capture the dynamics of disease initiation and recovery in UPEC-induced cystitis. The contribution of other calcium-sensitive pathways (e.g., calpain activation, mitochondrial calcium uptake) to TJ disruption merits systematic investigation. Additionally, the potential involvement of other claudins (e.g., claudin-4, -8, -16) in compensatory barrier mechanisms remains an open question. Our data prioritize the development of Claudin-12-enhancing agents—such as calcium channel modulators, HlyA inhibitors, or Claudin-12 stabilizers—as compelling candidates for clinical translation. Future studies should evaluate whether combinatorial regimens incorporating calcium modulation with conventional antibiotics can accelerate cystitis resolution and prevent recurrence.
Resource availability
Lead contact
Requests for further information and resources should be directed to and will be fulfilled by the lead contact, Feng Wang (wangfeng@wmu.edu.cn).
Materials availability
Research materials generated in this study will be provided by the lead contact upon request.
Data and code availability
The datasets generated and analyzed during the study are included with the published manuscript. All other data are available from the corresponding author upon request.
Acknowledgments
This work was supported by the Zhejiang Provincial Medical and Health Science and Technology Program Project and Quzhou Municipal Competitive Sci-Tech Project. Figure abstract was drawed in Figdraw (www.figdraw.com) and we are grateful to Figdraw.
Author contributions
Conceptualization, Y.T., L.H., and F.W.; methodology, Y.T., H.T., and Y.S.; investigation, Y.T., H.T., Y.S., and L.H.; writing – original draft, Y.T., Y.S., L.H., and F.W.; writing – review and editing, X.L. and F.W.; funding acquisition, F.W.; supervision, L.H. and X.L.
Declaration of interests
The authors declare that they have no conflicts of interests.
Declaration of generative AI and AI-assisted technologies in the writing process
The author(s) declare that no Generative AI and AI-assisted technologies were used in the creation of this manuscript.
STAR★Methods
Key resources table
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Anti-claudin-12 antibody used at 1:50 for IHC | Thermo Fisher | Cat #38-8200; RRID: AB_2533384 |
| Anti-ZO-1 antibody used at 1:200 for IHC | Invitrogen | Cat #33-9100; RRID: AB_2533147 |
| Anti-Occludin Antibody used at 1:200 for IHC | Cell Signaling Technology | Cat #91131; RRID: AB_2934013 |
| Anti-E-cadherin Antibody used at 1:400 for IHC | Abcam | Cat # ab76055; RRID: RRID: AB_1310159 |
| Anti-CD4 Antibody used at 1:1000 for IHC | Abcam | Cat # ab183685; RRID: AB_2686917 |
| Anti-CD8 Antibody used at 1:100 for IHC | Abcam | Cat # ab217344; RRID: AB_2890649 |
| Anti-F4/80 Antibody used at 1:200 for IHC | Cell Signaling Technology | Cat # 30325S; RRID: AB_2798990 |
| Anti-CD11b Antibody used at 1:200 for IHC | Thermo Fisher | Cat #14-0112-82; RRID: AB_467108 |
| Anti-Ly6G Antibody used at 1:100 for IHC | Cell Signaling Technology | Cat # 75028 |
| HRP-conjugated secondary antibodies | Thermo Fisher | Cat # 2460; RRID: AB_1185567 |
| DAB | Vector | Cat # SK4100; RRID: AB_2336382 |
| Anti-CD45-APC Antibody used at 1:100 for Flow Cytometry | BioLegend | Cat # 147707; RRID: AB_2563539 |
| Anti-Ly6G-PE/Cy7 Antibody used at 1:100 for Flow Cytometry | BioLegend | Cat # 127617; RRID: AB_1877262 |
| Anti-CD11b-BV421 Antibody used at 1:100 for Flow Cytometry | BioLegend | Cat # 101235; RRID: AB_10897942 |
| Anti-F4/80-FITC Antibody used at 1:100 for Flow Cytometry | BioLegend | Cat # 123107; RRID: AB_893500 |
| Anti-CD4-PerCP Antibody used at 1:100 for Flow Cytometry | BioLegend | Cat # 100433; RRID: AB_893330 |
| Anti-CD8-PE Antibody used at 1:100 for Flow Cytometry | BioLegend | Cat # 100707; RRID: AB_312746 |
| DAPI | Boster | Cat # AR1176 |
| Anti-Claudin-12 antibody used at 1:1000 for Immunoblotting | Thermo Fisher Scientific | Cat # 38-8200; RRID: AB_2533384 |
| Anti-ZO-1 antibody used at 1:500 for Immunoblotting | Invitrogen | Cat # 33-9100; RRID: AB_2533147 |
| Anti-α-SMA antibody used at 1:1000 for Immunoblotting | Abcam | Cat # ab5694; RRID: AB_2223021 |
| Anti-E-cadherin antibody used at 1:1000 for Immunoblotting | Abcam | Cat # ab76055; RRID: RRID: AB_1310159 |
| Anti-cleaved caspase-3 antibody used at 1:1000 for Immunoblotting | Cell Signaling Technology | Cat # 9661; RRID: AB_2341188 |
| Anti-caspase-3 antibody used at 1:2000 for Immunoblotting | Cell Signaling Technology | Cat # 9662; RRID: AB_331439 |
| Anti-cleaved caspase-8 antibody used at 1:1000 for Immunoblotting | Cell Signaling Technology | Cat # 9429; RRID: AB_2068300 |
| Anti-caspase-8 antibody used at 1:2000 for Immunoblotting | Cell Signaling Technology | Cat # 9746; RRID: AB_2275120 |
| Anti-GAPDH antibody used at 1:5000 for Immunoblotting | Cell Signaling Technology | Cat # 2118; RRID: AB_561053 |
| Horseradish peroxidase-conjugated secondary antibodies | Thermo Fisher | Cat # 32460; RRID: AB_1185567 |
| Biological samples | ||
| UPEC Strain UTI89 | ATCC | 700414 |
| Critical commercial assays | ||
| APC Annexin V Apoptosis Detection Kit with PI | BioLegend | Cat # 640932 |
| iScript™ Reverse Transcription Supermix | Bio-Rad | Cat # 1708841 |
| SYBR® Green FastMIX® | TaKaRa | Cat # RR820A |
| Pierce BCA Protein Assay Kit | Thermo Fisher Scientific | Cat # 23228 |
| ECL Western Blot Kit | CWBIO | Cat # CW0049S |
| Oligonucleotides | ||
| Cldn1 forward: GGACTGTGGATGTCCTGCGTTT | This paper | N/A |
| Cldn1 reverse: GCCAATTACCATCAAGGCTCGG | This paper | N/A |
| Cldn2 forward: AGGACTTCCTGCTGACATCCAG | This paper | N/A |
| Cldn2 reverse: AATCCTGGCAGAACACGGTGCA | This paper | N/A |
| Cldn4 forward: CGAGCCCTTATGGTCATCAGCA | This paper | N/A |
| Cldn4 reverse: ATGCTTGCCACGATGAACACGG | This paper | N/A |
| Cldn8 forward: ATGCAGTGCAAGGTCTACGA | This paper | N/A |
| Cldn8 reverse: AGCCGGTGATGAAGAAGATG | This paper | N/A |
| Cldn12 forward: GAGCAGTGACTGCCTGATGTAC | This paper | N/A |
| Cldn12 reverse: GCACATTCCAATCAGGCAGAGC | This paper | N/A |
| Ocln forward: TGGCAAGCGATCATACCCAGAG | This paper | N/A |
| Ocln reverse: CTGCCTGAAGTCATCCACACTC | This paper | N/A |
| Zo1 forward: GTTGGTACGGTGCCCTGAAAGA | This paper | N/A |
| Zo1 reverse: GCTGACAGGTAGGACAGACGAT | This paper | N/A |
| GAPDH forward: CATCACTGCCACCCAGAAGACTG | This paper | N/A |
| GAPDH reverse: ATGCCAGTGAGCTTCCCGTTCAG | This paper | N/A |
| TNFA forward: GGTGCCTATGTCTCAGCCTCTT | This paper | N/A |
| TNFA reverse: GCCATAGAACTGATGAGAGGGAG | This paper | N/A |
| IL6 forward: TACCACTTCACAAGTCGGAGGC | This paper | N/A |
| IL6 reverse: CTGCAAGTGCATCATCGTTGTTC | This paper | N/A |
| IL1B forward: TGGACCTTCCAGGATGAGGACA | This paper | N/A |
| IL1B reverse: GTTCATCTCGGAGCCTGTAGTG | This paper | N/A |
| CCL2 forward: GCTACAAGAGGATCACCAGCAG | This paper | N/A |
| CCL2 reverse: GTCTGGACCCATTCCTTCTTGG | This paper | N/A |
| CCL5 forward: CCTGCTGCTTTGCCTACCTCTC | This paper | N/A |
| CCL5 reverse: ACACACTTGGCGGTTCCTTCGA | This paper | N/A |
| CXCL3 forward: TGAGACCATCCAGAGCTTGACG | This paper | N/A |
| CXCL3 reverse: CCTTGGGGGTTGAGGCAAACTT | This paper | N/A |
| CXCL5 forward: CCGCTGGCATTTCTGTTGCTGT | This paper | N/A |
| CXCL5 reverse: CAGGGATCACCTCCAAATTAGCG | This paper | N/A |
| CXCL10 forward: ATCATCCCTGCGAGCCTATCCT | This paper | N/A |
| CXCL10 reverse: GACCTTTTTTGGCTAAACGCTTTC | This paper | N/A |
| Software and algorithms | ||
| ChemiDoc MP Imaging System | Bio-Rad | www.bio-rad.com |
| FlowJo v.10.8 | FlowJo | https://www.flowjo.com/solutions/flowjo |
| Imaris v.9 | OXFORD | https://imaris.oxinst.com/versions/9 |
| GraphPad Prism 8.0 | GraphPad software | https://www.graphpad.com/ |
| ImageJ | National Institutes of Health | https://imagej.nih.gov/ij/ |
Experimental model and study participant details
Wild-type (WT) C57BL/6 mice (8–10 weeks old, female) were purchased from Charles River Laboratories (Beijing, China). Claudin-12 knockout mice (Cldn12−/−; C57BL/6 background, 8–10 weeks old, female) were obtained from Cyagen Biosciences (Nanjing, China; Stock No. S-KO-11456). Mice were housed under specific pathogen-free (SPF) conditions with ad libitum access to food and water, under standardized 12-h light/dark cycles.
Method details
UPEC culture
UPEC Strain UTI89 (ATCC 700414), a canonical cystitis isolate chosen for its robust capacity to invade the bladder uroepithelium, was cultured in Luria-Bertani (LB) broth at 37°C until mid-log phase growth (OD600 = 0.8). For in vivo infections, bacterial pellets were resuspended in sterile phosphate-buffered saline (PBS) to achieve 1 × 108 CFU/100 μL. For in vitro assays, cultured cells were first washed with PBS. UPEC bacteria were added at a multiplicity of infection (MOI) of 10, and the infection was carried out strictly in antibiotic-free culture medium. To evaluate the effect of UPEC infection on TJ protein expression, in vivo UPEC-challenged ECs were isolated, cultured in RPMI-1640 complete medium, and treated with gentamicin (100 μg/mL) to eliminate extracellular bacteria. This procedure was performed in three independent experiments.
Mouse husbandry and CR protocol
All murine studies were approved by the Institutional Animal Care and Use Committee of Hunan University of Chinese Medicine. Wild-type (WT) C57BL/6 mice (8–10 weeks old, female) were purchased from Charles River Laboratories (Beijing, China). Claudin-12 knockout mice (Cldn12−/−; C57BL/6 background, 8–10 weeks old, female) were obtained from Cyagen Biosciences (Nanjing, China; Stock No. S-KO-11456). Mice were housed under specific pathogen-free (SPF) conditions with ad libitum access to food and water, under standardized 12-h light/dark cycles.
In vivo UPEC cystitis model
An acute cystitis model was established using 8-10 week-old female C57BL/6J mice (n = 6–8 per group). Mice were anesthetized by intraperitoneal injection of Tribromoethanol (Merck, #75-80-9). Under anesthesia, intravesical instillation was performed using a sterile 24-gauge catheter to administer either UPEC strain UTI89 (1 × 108 CFU in 100 μL sterile PBS) or PBS alone (sham control). All mice were euthanized 72 h post-infection via cervical dislocation under deep anesthesia for tissue collection and analysis.
Cell isolation and culture
Primary bladder epithelial cells (ECs) and smooth muscle cells (SMCs) were isolated from wild-type (WT) or Cldn12−/− mouse bladders using an established protocol with modifications. For epithelial cell isolation: Bladder were digested in 0.2 mg/mL collagenase P (Roche, #11213857001, France) and DNase I (10 U/mL; Roche, # 4716728001) dissolved in phosphate-buffered saline (PBS) using a spinner flask with gentle agitation at 37°C for 1 h. The urothelial layer was then carefully detached by gentle scraping. Harvested cells were washed twice with PBS, centrifuged at 300 × g for 5 min, and resuspended in complete growth medium. For smooth muscle cell isolation: Remaining tissues were minced into 0.5 × 0.5 mm fragments and digested in collagenase D solution (0.2 mg/mL, #11088858001, Roche) at 37°C for 1 h on a rocking platform. The enzymatic reaction was neutralized by adding 10 mL of RPMI-1640 complete medium. The cell suspension was filtered, centrifuged at 300 × g for 5 min, and the pellet was resuspended in fresh RPMI-1640 complete medium. Cells were seeded into 6-well plates and maintained in RPMI-1640 medium (Gibco, #11875093) supplemented with 10% fetal bovine serum (FBS, Gibco, #A5670701) and 1% penicillin/streptomycin (Gibco, #15140112) at 37°C in a humidified 5% CO2 incubator. Medium was changed after 2–3 days of undisturbed culture. The purity of ECs and SMCs was determined by Western blotting by detecting the expression of E-cadherin and α-SMA.
Western blot analysis
Total proteins were extracted from cells using RIPA lysis buffer (Beyotime, P0013B) supplemented with Protease Inhibitor Cocktail (MCE, HY-K0010). Protein concentration was determined using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific, #23228) according to the manufacturer’s instructions. For immunoblotting analysis, protein lysates (20 μg per lane) were separated by 10% SDS-PAGE and transferred to PVDF membranes (Millipore). Membranes were blocked with 5% non-fat milk in TBST for 1 h at room temperature and subsequently incubated overnight at 4°C with the following primary antibodies: Anti-Claudin-12 (1:1000; Thermo Fisher Scientific, #38–8200); Anti-ZO-1 (1:500; Invitrogen, #33–9100); Anti-α-SMA (1:1000; Abcam, #ab5694); Anti-E-cadherin (1:1000; Abcam, #ab76055); Anti-cleaved caspase-3 (1:1000; Cell Signaling Technology, #9661S); Anti-caspase-3 (1:2000; Cell Signaling Technology, #9662S); Anti-cleaved caspase-8 (1:1000; Cell Signaling Technology, #9429S); Anti-caspase-8 (1:2000; Cell Signaling Technology, #9746S); Anti-GAPDH (1:5000; Cell Signaling Technology, #2118). After primary antibody incubation, membranes were washed three times with 1×TBST and incubated with horseradish peroxidase-conjugated secondary antibodies (1:5000; Thermo) for 1 h at room temperature. Protein bands were visualized using an ECL Western Blot Kit (CWBIO, CW0049S) and imaged with a ChemiDoc MP Imaging System (Bio-Rad). GAPDH served as the loading control for normalization.
RNA isolation and quantitative real-time RT-PCR
Total RNA was isolated from bladder epithelial cells and smooth muscle cells using TRIzol reagent (Invitrogen, # 15596026) following the manufacturer’s protocol. cDNA synthesis was performed with 1 μg of total RNA using the iScript Reverse Transcription Supermix (Bio-Rad) in a 20 μL reaction volume. Quantitative real-time PCR (qPCR) was conducted using the SYBR Green FastMIX (TaKaRa, #RR820A) on a StepOne Real-Time PCR System. All samples were run in technical triplicates on 96-well plates sealed with optical adhesive covers. mRNA expression levels were calculated using the comparative CT method (2ˆ(−ΔCT)) relative to Gapdh endogenous control. Three independent biological replicates were performed per experimental condition. The primers were listed in Table 1.
Histopathology and immunostaining
Mouse bladders were fixed in 10% neutral-buffered formalin for 24 h, processed through graded ethanol series, embedded in paraffin, and sectioned at 5 μm thickness. For histological assessment, sections were deparaffinized in xylene and rehydrated through graded ethanol series before hematoxylin and eosin (H&E) staining. Bladder inflammation was evaluated using a validated cystitis scoring system (0–5 scale) as previously described.23 Briefly, the grading criteria were defined as follows: score 0, normal bladder tissue with an intact urothelium and no signs of inflammation; score 1, mild inflammation characterized by slight submucosal edema and minimal immune cell infiltration; score 2, moderate inflammation with noticeable submucosal edema and scattered leukocyte infiltration; score 3, severe inflammation featuring dense leukocyte infiltration, pronounced edema, and early signs of epithelial desquamation; score 4, extensive mucosal damage with widespread inflammatory cell infiltration and focal hemorrhage; and score 5, massive transmural inflammation accompanied by severe hemorrhage and complete loss of the uroepithelial layer (ulceration/necrosis). Two independent pathologists, blinded to experimental groups, performed all pathological assessments. For immunohistochemical analysis, antigen retrieval was performed using citrate buffer (pH 6.0) at 95°C for 20 min. Sections were incubated overnight at 4°C with the following primary antibodies: anti-claudin-12 (Thermo Fisher, #38–8200), anti-ZO-1 (Invitrogen, #33–9100), anti-Occludin (CST, #91131) anti-E-cadherin (Abcam, #ab76055), anti-CD4 (Abcam, #ab183685), anti-CD8 (Abcam, #ab217344), anti-F4/80 (Cell Signaling Technology, #30325S), anti-CD11b (Thermo Fisher, #14-0112-82), and anti-Ly6G (Cell Signaling Technology, #75028). After primary antibody incubation, sections were treated with HRP-conjugated secondary antibodies (Thermo Fisher) for 1 h at room temperature and developed with DAB substrate (Vector, #SK4100). All stained sections were digitized using a Nikon Eclipse microscope. Immunohistochemical (IHC) scoring was conducted in accordance with previously established protocols.24 Briefly, the proportion of immunoreactive cells was semi-quantitatively evaluated and assigned a score from 0 to 5 as follows: 0 (0%), 1 (>0%–1%), 2 (>1%–10%), 3 (>10%–33%), 4 (>33%–66%), and 5 (>66%–100%). The staining intensity was independently graded on a scale of 0–3, defined as 0 (negative), 1 (weak), 2 (moderate), and 3 (strong). To determine the final IHC score for each specimen, the proportion and intensity scores were multiplied, yielding a composite score ranging from 0 to 15.
Flow cytometry
Single-cell suspensions were prepared from mouse bladders through enzymatic digestion with collagenase D (0.2 mg/mL; Roche) and DNase I (10 U/mL; Roche) in RPMI-1640 medium for 45 min at 37°C with constant agitation. Cells were filtered through a 70-μm strainer and washed twice with FACS buffer (PBS supplemented with 2% FBS). For immunophenotyping, cells were stained with the following fluorochrome-conjugated antibodies for 30 min at 4°C: Anti-CD45-APC (clone 30-F11; BioLegend, #147707); Anti-Ly6G-PE/Cy7 (clone 1A8; BioLegend, #127617); Anti-CD11b-BV421 (clone M1/70; BioLegend, #101235); Anti-F4/80-FITC (clone BM8; BioLegend, #123107); Anti-CD4-PerCP (clone GK1.5; BioLegend, #100433); Anti-CD8-PE (clone 53–6.7; BioLegend, #100707) Following staining, cells were washed and resuspended in FACS buffer. DAPI (Boster, #AR1176-10; 1:500) was added to the FACS loading buffer to exclude dead cells. Flow cytometry was performed on a BD FACSCanto II Flow Cytometer, and data were analyzed using FlowJo v10.8 software (BD Biosciences) with established gating strategies as previously described.
Annexin V/PI apoptosis assay by flow cytometry
Apoptosis rates in UPEC-infected epithelial cells were quantified using the APC Annexin V Apoptosis Detection Kit with PI (BioLegend, #640932) according to the manufacturer’s protocol. Briefly: Epithelial cells were collected 1 h post-infection (UPEC MOI:10); Cells were resuspended in Annexin V binding buffer and stained with APC-conjugated Annexin V and propidium iodide (PI) for 15 min at room temperature (RT) in the dark. Samples were immediately analyzed using a BD FACSCanto II Flow Cytometer (BD Biosciences). Apoptotic populations (Annexin V+) were quantified using FlowJo v10.8 software (BD Biosciences) with standardized gating strategies.
Quantification of intracellular bacteria in bladder tissue
To quantify intracellular bacterial loads, bladder tissues were digested using 0.1 mg/mL collagenase D (Roche, #11088858001) in PBS at 37°C for 1 h with gentle agitation. Single-cell suspensions were washed three times in PBS (centrifugation: 300 × g, 5 min) and resuspended in complete medium. Cells (1 × 106) were incubated with 100 μg/mL gentamicin (MCE, #HY-A0276A) for 1 h to eliminate extracellular bacteria, followed by three PBS washes. Cell pellets were lysed in 0.1% Triton X-100 (Sigma-Aldrich, #T8787) for 10 min at room temperature. Serial dilutions (10−1 to 10−4) of lysates were plated onto LB agar (BD Difco, #244510) in technical triplicates. Colony-forming units (CFUs) were quantified after 24 h of incubation at 37°C. The CFU counts were normalized to the total protein concentration of the tissue lysates, with uninfected bladders serving as negative controls.
Intracellular calcium flux measurement
Bladder epithelial cells were loaded with Fluo-4 AM dye (5 μM; Invitrogen, #HY-101896) for 30 min at 37°C under light-protected conditions. Cells were washed three times with PBS and seeded at 1 × 104 cells/well in black-walled 96-well plates. Cell viability was monitored using Hoechst 33342 staining to ensure that calcium fluxes were recorded exclusively from viable cells. Cell populations were then treated with either UPEC suspension (MOI 10) or combination with TMB-8 (100 μM; MCE, #HY-117099). Fluorescence intensity (excitation 494 nm/emission 516 nm) was quantified using a SpectraMax i3x Multi-Mode Microplate Reader. Measurements were recorded at baseline and at 1-min intervals for 20 min. All conditions were performed in triplicate wells across five independent biological replicates.
Quantification and statistical analysis
Data are presented as mean ± standard error of the mean (SEM). Statistical significance was determined using GraphPad Prism 8.0 (GraphPad Software, San Diego, CA, USA). For comparisons between two groups, a Mann-Whitney U test was applied. For comparisons among more than two groups, Kruskal-Wallis test was used. A p-value of less than 0.05 was considered statistically significant. All experiments were repeated at least three times independently.
Contributor Information
Longcheng Hong, Email: longchenghong@zju.edu.cn.
Feng Wang, Email: wangfeng@wmu.edu.cn.
References
- 1.Chung S.D., Praveen Rajneesh C., Chen K.C., Tai H.C., Chang M.L., Tseng X.W., Cheng J.H., Tsai W.K., Chiang H.S., Wu Y.N. Specific impacts of ketamine on bladder dysfunction and associated histological alterations in rats-a time course validation through transmission electron microscopy. Int. J. Mol. Sci. 2022;23 doi: 10.3390/ijms23042194. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Lin C.J., Liu C.K., Hsieh H.Y., Chen M.J., Tsai C.P. Changes in cystoscopic findings after intravesical hyaluronic acid instillation therapy in patients with interstitial cystitis. Diagnostics. 2022;12 doi: 10.3390/diagnostics12082009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Jhang J.F., Ho H.C., Hsu Y.H., Jiang Y.H., Kuo H.C. Bladder ultrastructure and urinary cytokine abnormality in patients with recurrent urinary tract infection and the changes after intravesical platelet-rich plasma injections. Biomedicines. 2022;10 doi: 10.3390/biomedicines10020245. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Justice S.S., Hunstad D.A., Seed P.C., Hultgren S.J. Filamentation by escherichia coli subverts innate defenses during urinary tract infection. Proc. Natl. Acad. Sci. USA. 2006;103:19884–19889. doi: 10.1073/pnas.0606329104. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Jafari N.V., Rohn J.L. An immunoresponsive three-dimensional urine-tolerant human urothelial model to study urinary tract infection. Front. Cell. Infect. Microbiol. 2023;13 doi: 10.3389/fcimb.2023.1128132. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Kardos J., Chai S., Mose L.E., Selitsky S.R., Krishnan B., Saito R., Iglesia M.D., Milowsky M.I., Parker J.S., Kim W.Y., Vincent B.G. Claudin-low bladder tumors are immune infiltrated and actively immune suppressed. JCI Insight. 2016;1 doi: 10.1172/jci.insight.85902. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Fedwick J.P., Lapointe T.K., Meddings J.B., Sherman P.M., Buret A.G. Helicobacter pylori activates myosin light-chain kinase to disrupt claudin-4 and claudin-5 and increase epithelial permeability. Infect. Immun. 2005;73:7844–7852. doi: 10.1128/IAI.73.12.7844-7852.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Lapointe T.K., O'Connor P.M., Jones N.L., Menard D., Buret A.G. Interleukin-1 receptor phosphorylation activates rho kinase to disrupt human gastric tight junctional claudin-4 during helicobacter pylori infection. Cell. Microbiol. 2010;12:692–703. doi: 10.1111/j.1462-5822.2010.01429.x. [DOI] [PubMed] [Google Scholar]
- 9.Acharya P., Beckel J., Ruiz W.G., Wang E., Rojas R., Birder L., Apodaca G. Distribution of the tight junction proteins zo-1, occludin, and claudin-4, -8, and -12 in bladder epithelium. Am. J. Physiol. Ren. Physiol. 2004;287:F305–F318. doi: 10.1152/ajprenal.00341.2003. [DOI] [PubMed] [Google Scholar]
- 10.Beggs M.R., Young K., Pan W., O'Neill D.D., Saurette M., Plain A., Rievaj J., Doschak M.R., Cordat E., Dimke H., Alexander R.T. Claudin-2 and claudin-12 form independent, complementary pores required to maintain calcium homeostasis. Proc. Natl. Acad. Sci. USA. 2021;118 doi: 10.1073/pnas.2111247118. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Plain A., Pan W., O’Neill D., Ure M., Beggs M.R., Farhan M., Dimke H., Cordat E., Alexander R.T. Claudin-12 knockout mice demonstrate reduced proximal tubule calcium permeability. Int. J. Mol. Sci. 2020;21:2074. doi: 10.3390/ijms21062074. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Bien J., Sokolova O., Bozko P. Role of uropathogenic escherichia coli virulence factors in development of urinary tract infection and kidney damage. Internet J. Nephrol. 2012;2012 doi: 10.1155/2012/681473. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Russell S.K., Harrison J.K., Olson B.S., Lee H.J., O'Brien V.P., Xing X., Livny J., Yu L., Roberson E.D.O., Bomjan R., et al. Uropathogenic escherichia coli infection-induced epithelial trained immunity impacts urinary tract disease outcome. Nat. Microbiol. 2023;8:875–888. doi: 10.1038/s41564-023-01346-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Ashraf Z., Rasool M.H., Aslam B., Ejaz H., Mujahid F., Khurshid M. Dynamics of urinary tract infections: a comprehensive study on antimicrobial susceptibility, virulence profiling and molecular epidemiology of uropathogenic escherichia coli from pakistan. Mol. Biol. Rep. 2025;52:694. doi: 10.1007/s11033-025-10799-3. [DOI] [PubMed] [Google Scholar]
- 15.Furuse M., Hata M., Furuse K., Yoshida Y., Haratake A., Sugitani Y., Noda T., Kubo A., Tsukita S. Claudin-based tight junctions are crucial for the mammalian epidermal barrier: a lesson from claudin-1-deficient mice. J. Cell Biol. 2002;156:1099–1111. doi: 10.1083/jcb.200110122. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Klein R.D., Hultgren S.J. Urinary tract infections: microbial pathogenesis, host-pathogen interactions and new treatment strategies. Nat. Rev. Microbiol. 2020;18:211–226. doi: 10.1038/s41579-020-0324-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Sun J., Zhang Y.G. Vitamin d receptor influences intestinal barriers in health and disease. Cells. 2022;11 doi: 10.3390/cells11071129. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Garcia-Hernandez V., Quiros M., Nusrat A. Intestinal epithelial claudins: expression and regulation in homeostasis and inflammation. Ann. N. Y. Acad. Sci. 2017;1397:66–79. doi: 10.1111/nyas.13360. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Suzuki K., Sentani K., Tanaka H., Yano T., Suzuki K., Oshima M., Yasui W., Tamura A., Tsukita S. Deficiency of stomach-type claudin-18 in mice induces gastric tumor formation independent of h pylori infection. Cell. Mol. Gastroenterol. Hepatol. 2019;8:119–142. doi: 10.1016/j.jcmgh.2019.03.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Li G., Flodby P., Luo J., Kage H., Sipos A., Gao D., Ji Y., Beard L.L., Marconett C.N., Demaio L., et al. Knockout mice reveal key roles for claudin 18 in alveolar barrier properties and fluid homeostasis. Am. J. Respir. Cell Mol. Biol. 2014;51:210–222. doi: 10.1165/rcmb.2013-0353OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Zheng Y., Li G., Shi A., Guo J., Xu Y., Cai W. Role of mir-455-3p in the alleviation of lps-induced acute lung injury by allicin. Heliyon. 2024;10 doi: 10.1016/j.heliyon.2024.e39338. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Cao H., Ni C., Han L., Wang R., Blasig R., Haseloff R., Qin Y., Lan J., Lou X., Ma P., et al. Claudin-12 deficiency inhibits tumor growth by impairing transendothelial migration of myeloid-derived suppressor cells. Cancer Res. 2022;82:2472–2484. doi: 10.1158/0008-5472.CAN-21-3896. [DOI] [PubMed] [Google Scholar]
- 23.Wang Z., Jiang Z., Zhang Y., Wang C., Liu Z., Jia Z., Bhushan S., Yang J., Zhang Z. Exosomes derived from bladder epithelial cells infected with uropathogenic escherichia coli increase the severity of urinary tract infections (utis) by impairing macrophage function. PLoS Pathog. 2024;20 doi: 10.1371/journal.ppat.1011926. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Kim S., Kim J.M., Lee H.J., Lim J.S., Seong I.O., Kim K.H. Alteration of cyp4a11 expression in renal cell carcinoma: diagnostic and prognostic implications. J. Cancer. 2020;11:1478–1485. doi: 10.7150/jca.36438. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The datasets generated and analyzed during the study are included with the published manuscript. All other data are available from the corresponding author upon request.