ALY688 Protects Against Myocardial Ischemia‐Reperfusion Injury via Direct Effects and Rab8a‐Dependent Extracellular Vesicles

ABSTRACT

Despite advances in percutaneous coronary intervention, ischemia‐reperfusion (IR) injury remains a major cause of morbidity and mortality. Adiponectin confers broad cardioprotective effects, motivating the development of adiponectin receptor agonists. Here, we investigated the cardioprotective efficacy and mechanisms of ALY688, a synthetic adiponectin receptor agonist peptide, in myocardial IR injury. In a clinically translatable rat IR model, intravenous administration of ALY688 during ischemia together with subcutaneous dosing that continued for 28 days reduced troponin‐I levels, cardiomyocyte death, and infarct size, while preserving cardiac function. ALY688 restored autophagic flux, mitigated reactive oxygen species accumulation, and suppressed apoptosis in both IR hearts and hypoxia‐reoxygenation (HR)‐treated cardiomyocytes. Proteomic profiling revealed that Rab8a, downregulated by IR, was maintained with ALY688 treatment. Notably, ALY688 increased extracellular vesicle (EV) abundance in myocardium and plasma, and EVs from treated animals displayed distinct proteomic signatures enriched in glycolytic and oxidative stress‐related proteins. These EVs conferred protection against HR‐induced injury in H9c2 and human iPSC‐derived cardiomyocytes. CRISPR‐mediated Rab8a knockout impaired ALY688‐induced EV biogenesis and attenuated the cytoprotective effects of these EVs. Collectively, these findings identify ALY688 as a promising therapeutic that mitigates IR injury via both direct myocardial protection and Rab8a‐dependent EV‐mediated cardioprotective signalling.

This study identifies ALY688, a synthetic adiponectin receptor agonist, as a potent cardioprotective agent against ischemia‐reperfusion injury. ALY688 reduced infarct size, cardiomyocyte death, and oxidative stress, while preserving cardiac function. Mechanistically, it enhanced extracellular vesicle (EV) number through Rab8a‐dependent signaling and restored autophagic flux. Proteomic analysis showed EVs induced by ALY688 carried protective glycolytic and stress‐related proteins that mitigated cardiomyocyte injury. These findings identify EVs as an important and as yet unidentified mechanism contributing to adiponectin receptor mediated protection from myocardial ischemia reperfusion injury.

1. Introduction

Myocardial ischemia‐reperfusion (IR) injury remains a leading cause of morbidity and mortality worldwide, despite significant advances in reperfusion therapies for acute myocardial infarction (Zhang et al. 2024). While the prompt restoration of coronary blood flow is essential for salvaging viable myocardium, the process of reperfusion paradoxically initiates a cascade of deleterious events, including oxidative stress, inflammation, calcium overload, and mitochondrial dysfunction, which together contribute to substantial cardiomyocyte death and adverse ventricular remodelling (Heusch 2015). It is estimated that up to 50% of the final infarct size may be attributed to reperfusion injury rather than the initial ischemic insult (Hausenloy and Yellon 2016). This phenomenon not only limits the efficacy of current therapeutic interventions but also highlights the complexity of myocardial IR injury as a multifactorial pathophysiological process (Dharmakumar et al. 2025).

Recent mechanistic insights have identified several regulated cell death pathways, including necroptosis, pyroptosis, and ferroptosis, as key contributors to myocardial damage following IR injury (Pischon 2004). The opening of the mitochondrial permeability transition pore during early reperfusion is recognized as a pivotal determinant of cardiomyocyte survival or death, linking mitochondrial dysfunction to the propagation of cell injury. Nevertheless, despite decades of investigation and numerous promising experimental strategies, the successful translation of cardioprotective interventions from bench to bedside has remained elusive, underscoring the urgent need for novel, multifaceted therapeutic approaches that target the diverse mechanisms underlying IR injury (Heusch 2015).

Among endogenous protective factors, adiponectin, an adipocyte‐derived cytokine, has emerged as a central regulator of cardiovascular homeostasis. Multiple preclinical studies have demonstrated that adiponectin exerts potent cardioprotective effects, including the reduction of infarct size, inhibition of apoptosis, and attenuation of oxidative and inflammatory stress, primarily through the activation of AMP‐activated protein kinase (AMPK) and cyclooxygenase‐2 (COX‐2) signalling pathways (Achari and Jain 2017; Shibata et al. 2005; Dębiński et al. 2011; Yue et al. 2024). In addition to its direct effects on cardiomyocytes, adiponectin modulates endothelial function, inhibits vascular inflammation, and improves metabolic homeostasis, further supporting its role in cardiovascular protection (Liu et al. 2015). In individuals with obesity, diabetes, or established cardiovascular disease, adiponectin levels are often pathologically reduced (Lei et al. 2023). This state of relative adiponectin deficiency has spurred interest in the development of strategies to activate adiponectin signalling (Lei et al. 2023; Okada‐Iwabu et al. 2013; Meng et al. 2023). However, clinical application of native adiponectin is hampered by its complex multimeric structure, limited tissue bioavailability, and rapid clearance from circulation (Otvos 2019).

To overcome these limitations, considerable efforts have been directed toward the development of small‐molecule or peptide‐based adiponectin receptor agonists. Among these, ALY688, a synthetic peptide adiponectin receptor agonist, has demonstrated robust cardioprotective efficacy in preclinical models of cardiac injury. ALY688 has been shown to improve cardiac function, reduce fibrosis, and attenuate adverse remodelling following pressure overload induced heart failure (Cho et al. 2024), effects that are potentially mediated at least in part through the activation of AMPK, phosphorylation of acetyl‐CoA carboxylase (ACC), and stimulation of p38MAPK signalling pathway (Tang et al. 2024; Tang et al. 2023; Sung et al. 2022; Da Eira et al. 2020). Yet, the precise molecular mechanisms by which ALY688 confers cardioprotection, especially in the setting of IR injury, remain incompletely defined.

In parallel, there has been growing recognition of the role of extracellular vesicles (EV), as critical mediators of intercellular communication in cardiovascular diseases (Li et al. 2025). EV are membrane‐bound particles released by virtually all cell types and are capable of transferring a diverse array of bioactive molecules, such as proteins, lipids, and nucleic acids, to recipient cells (Cheng and Hill 2022). In the context of myocardial IR injury, EV derived from cardioprotective cell types, such as cardiac progenitor cells or stem cells, have been shown to attenuate injury by delivering anti‐apoptotic, anti‐inflammatory, and pro‐regenerative signals. Conversely, EV released from ischemic or injured myocardium may exacerbate cardiac damage through the transfer of pro‐inflammatory or pro‐apoptotic cargo (Hu et al. 2023; Cao et al. 2023; Sun et al. 2022; Ge et al. 2021; Li et al. 2021; Gan et al. 2020). The biogenesis, cargo composition, and release of EV are tightly regulated processes that reflect the physiological or pathological state of the parent cell.

Notably, recent studies have revealed that adiponectin itself can be packaged into EV, and that adiponectin signalling actively promotes EV biogenesis and secretion. Mechanistically, adiponectin enhances exosome release through interactions with T‐cadherin on the cell surface, a process linked to improved tissue protection and systemic metabolic regulation (Fukuoka et al. 2023). Adiponectin‐enriched EV have been demonstrated to exert protective effects on various target tissues, including the heart, by modulating oxidative stress, inflammatory responses, and cell survival pathways (Hu et al. 2023; Blandin et al. 2023). These findings suggest a complex interplay between adiponectin signalling and EV‐mediated mechanisms in cardiovascular protection.

Despite recent advances, a detailed description of how adiponectin receptor agonists such as ALY688 influence EV biogenesis, cargo composition, and function in the context of myocardial IR injury is lacking. In this study, we investigate the effects of ALY688 on cardiac function and remodelling following IR, with a particular focus on its regulation of EV biogenesis and the cardioprotective properties of ALY688‐modified EV. By elucidating these mechanisms, our work aims to advance the understanding of adiponectin receptor signalling and EV‐based communication in the injured heart, and to identify novel therapeutic strategies for mitigating IR injury and improving cardiac outcomes.

2. Materials and Methods

2.1. Experimental Studies in Animal Models

All study protocols were approved by the Animal Care Committee of Toronto General Hospital. Female Sprague Dawley rats (Charles River, Canada) were maintained with ad libitum access to water and regular chow diet until 12 weeks of age when they were randomly separated into surgical groups (n = 8 per group). All animals were housed in temperature and humidity‐controlled rooms (21 ± 2°C, 35%–40%) with a daily 12 h light/dark cycle in the animal care facility of Toronto General Hospital in accordance with the guidelines of the Canadian Council on Animal Care. Myocardial ischemia reperfusion injury was induced by 45 min of ligation of the left anterior descending coronary artery (LAD) followed by reperfusion. Sham animals were treated identically except that the suture was passed through the myocardium beneath the LAD artery without ligation. ALY688ER at a dose of 10 mg/kg or vehicle was given over 20 min via tail vein infusion 5 min post LAD, together with subcutaneous injection which was repeated daily for 2 days in acute study and for 28 days in chronic study. In the 28‐day study, echocardiography was performed to measure cardiac function at baseline (prior to surgery), and at 14 and 28 days after ligation. M‐mode ultrasound imaging was conducted using LV parasternal short‐axis view.

2.2. Histology Analysis

Paraffin embedded heart sections were subjected to H&E (Sigma, HT1079, HT110216), Masson Trichrome (Sigma, HT15), TUNEL (Promega, G3250) according to manufacturer's protocol and visualized using a bright field slide scanning microscopy (Leica, Aperio AT2) or confocal microscopy (Nikon, Ti2).

2.3. Biochemistry Analysis and Chemicals

Commercially available kits were used to measure LDH (Abcam, ab102526 for animal samples), LDH (Biosciences, 786210 for cellular samples), Troponin I (Abcam, ab246529), according to manufacturer's instructions. Bafilomycin (50 µM, Sigma, 196000), Dynasore (80 µM, MedChemExpress, HY‐15304), GW4869 (10 µM, Sigma, D1692) were used to inhibit autophagy, inhibit EV uptake, or inhibit EV biogenesis respectively.

2.4. Heart Tissue Proteomics Analysis

Myocardial infarct zone was frozen and used for proteomic analyses. The frozen sample was ground into powder in a liquid nitrogen‐cooled mortar and pestle and kept on dry ice until mass‐spec analysis. Proteins were extracted from cryopulverized infarct heart tissue in a buffer containing 5% sodium dodecyl sulfate (SDS) and 100 mM TRIS pH 7.8 supplemented with phosphatase and protease inhibitor cocktail. The protein concentration of the lysate was determined using bicinchoninic acid assay (BCA) (Thermo Fisher Scientific, Waltham, MA, USA, part# 23225), and protein disulfide bonds were reduced and free cysteines alkylated with 20 mM tris (2‐carboxyethyl) phosphine (TCEP) and 30 mM iodoacetamide, respectively (Millipore‐Sigma, part# 646547, and l1149 respectively). In brief, proteins were acidified by adding phosphoric acid to a final concentration of 1.3% v/v. The sample was then diluted in 165 µL of S‐TRAP loading buffer (9:1 methanol: water in 100 mM Tris, pH 7.8) and loaded onto an S‐TRAP Micro cartridge (Protifi LLC, Huntington NY) and spun at 4000 x g for 2 min. Samples were washed with 150 µL of S‐TRAP loading buffer three times. Proteins were then digested using trypsin (Promega) at a 1:10 enzyme to substrate ratio for 2 h at 47°C. Peptides were eluted with 40 µL of 50 mM ammonium bicarbonate, 0.1% formic acid in water, and 50% acetonitrile. Peptides were then desalted using self‐made R3‐STAGE tips. Desalted peptides were vacuum concentrated and reconstituted in 0.1% trifluoroacetic acid (TFA) prior to analysis by LC‐MS/MS.

2.5. Plasma EV Proteomics Analysis

A lysis buffer (1.5 M urea, 1 mM DTT, 5% (v⁄v) glycerol, 0.5% DDM, 1/200 (v/v) protease inhibitors, 25 mM HEPES at pH = 8.0) was added to the received samples at a 1:5 (buffer/sample v/v) ratio. The protein concentration and quantity were determined by the Bradford assay using a protein assay kit (#23200, Thermo Fisher Scientific) following the manufacturer's protocol. The assay absorbance was measured with a spectrophotometer (Novaspec III, Biochrom) and semi‐microvolume disposable polystyrene cuvettes (#2239955, Bio‐Rad) at 595 nm. Protein samples (50 µg) were processed using a modified filter‐aided sample preparation (FASP) protocol. Samples were denatured in 8 M urea (25 mM HEPES, pH 8.0), reduced with TCEP, and alkylated with iodoacetamide. After buffer exchange, proteins were digested with MS‐grade trypsin/Lys‐C (1:150, enzyme: protein) at 37°C for 16 h. Peptides were collected by centrifugation and acidified with formic acid to terminate digestion. Samples were desalted using C18 tips, dried by vacuum centrifugation, and reconstituted in 0.1% formic acid for MS analysis. Samples were analysed using an Ultimate 3000 nanoLC system coupled to a Bruker timsTOF HT mass spectrometer. Samples were separated on a C18 column using a gradient of acetonitrile with 0.1% formic acid. MS data were acquired in positive ion mode with data‐dependent acquisition, including full MS scans followed by CID‐based MS/MS of selected precursor ions with dynamic exclusion.

2.6. Nanoparticle Tracking Analysis (NTA)

To determine EV sizes and concentration, 100 µL of EV were diluted 1:10 in filtered PBS to a final volume of 1 mL and analysed by the NanoSight NS300 system (Malvern Panalytical) at The Hospital for Sick Children (SickKids) Research Institute. Light scattering and Brownian motion were video‐captured using a 20× magnification microscope with a mounted sCMOS camera and a 532 nm green laser. 60‐s videos (number of experiments n = 3, number of videos n = 8) of EV were collected, averaged, and analysed. 100 nm polystyrene beads (Malvern Instruments, Saint‐Laurent, Canada) were used for size calibration, and data were captured at 22°C using NTA software (version 3.1).

2.7. Size‐Exclusion Chromatography Isolation of Serum‐EV

Size‐exclusion chromatography (SEC) using the qEV single columns 70 nm (IZON, Cambridge, MA) was the primary method to isolate EV from serum samples. In all experiments, serum was diluted in filtered PBS at a 1:3 ratio. Fractions 3 to 6 were collected and used for subsequent EV characterization and downstream applications as per manufacturer's recommendations.

2.8. Cryogenic Electron Microscopy (Cryo‐EM)

Samples were vitrified in liquid ethane using a Vitrobot Mark IV (Thermo Scientific). Liquid samples were pipetted onto Quantifoil R2/2 copper grids (Ted Pella Inc.) that had been glow discharged in air (Pelco easiGlow, Ted Pella, Inc.). Grids were transferred into a single tilt cryo TEM holder (Gatan). Grids were imaged with a Talos L120C TEM (Thermo Scientific) using a high tension of 120 kV with a 4k x 4k BM‐Ceta CMOS camera. At least 30 images of each sample were taken at magnifications 28,000x, 57,000x, and 120,000x yielding a pixel size of 510 pm, 249 pm, and 121 pm, respectively.

2.9. Genetic Modification of H9c2 Cells

CRISPR knock‐out lines were generated using guide RNAs cloned into the pX459 plasmid, as previously described (Ran et al. 2013). To generate Rab8a KO H9c2 cells, guide RNA targeting the Rab8a gene (TGATTGTCCGAAACCGCTCC) was cloned into pLentiCRISPRv2. We then generated viral particles using this vector as well as a control vector that does not target mammalian genomes and used these particles to transduce H9c2 cells. Following selection with puromycin (1 µg/mL), polyclonal populations were assessed for guide efficiency using a T7 endonuclease I assay as reported before (Sanjana et al. 2014). Autophagy LC3 HiBiT reporter vector (Promega, GA2550) has a HiBiT tag and contains a sequence encoding the MAP1LC3B gene. H9c2 cells were transfected with the autophagy LC3 HiBiT reporter vector according to the manufacturer's manual (Velagapudi et al. 2019). Nano‐Glo HiBiT lytic reagent (Promega, N3040) was added to the cells after each treatment and luminescence was measured on a Thermo Varioskan LUX microplate reader. To generate H9c2 lines stably expressing Venus‐based Caspase‐3 like protease activity indicator (VC3AI; a gift from Dr Binghui Li, Addgene plasmid 78907), lentiviral particles were produced using pCDH‐puro‐CMV‐VC3AI and transduced cells were selected using 1 µg/mL puromycin. This genetically encoded biosensor consists of cyclized chimeras containing a caspase‐3 cleavage site as a switch. Upon cleavage by caspase‐3‐like proteases, the non‐fluorescent indicator rapidly becomes fluorescent and thus detects activation in real‐time.

2.10. H9c2 Cell Culture

H9c2 rat embryonic cardiac myoblasts (ATCC CRL‐1446TM) were grown in Dulbecco's Modified Eagle's Medium (DMEM) (Gibco, 11885‐084) supplemented with 10% fetal bovine serum (FBS, Thermo, A5256701) and 1% (vol/vol) penicillin/streptomycin (Gibco, 15070063) at 37°C and 5% CO₂. Hypoxia was achieved by placing cells in a hypoxic chamber (Onstage Incubator, ThermoFisher, NX7LIVE001) filled with a pre‐analysed gas mixture of 1% O₂ and 5% CO₂. Normoxia and reoxygenation were achieved by placing cells in the Onstage Incubator filled with 20% O₂ and 5% CO₂. Cells were treated with 300 nM ALY688 30 min before hypoxia reoxygenation or normoxia as indicated in each experiment.

iPSC culture and cardiomyocyte differentiation

iPSCs, PGPC14 line validated previously (Hildebrandt et al. 2019), were cultured on Matrigel (Corning, 354277) coated plates in mTeSR plus media (Stemcell Technologies, 100–0276) and passaged with ReLeSR (Stemcell Technologies, 100–0483) using a 1:6–1:12 dilution every 3–4 days, or upon reaching 80%–90% confluence. For cardiomyocyte differentiation, iPSCs were dissociated into single cells using gentle cell dissociation reagent (Stemcell Technologies, 100–0485), and seeded on Matrigel coated plates containing mTeSR plus media supplemented with 10 µM of Y‐27632 (Stemcell Technologies, 72304) for 24 h. Media was changed daily with mTeSR plus media without Y‐27632 until cells reached >95% confluence (3‐4 days post‐seeding), at which point differentiation was initiated using STEMdiff Ventricular Cardiomyocyte Differentiation Kit (Stemcell Technologies, 05010), following manufacturer protocol. Additionally, selection was performed on cardiomyocytes from day 12–day 18 of differentiation with glucose‐free RPMI supplemented with 4 mM lactate and B27 containing insulin. Cells were allowed to recover for a minimum of 2 days, then dissociated using TrypLE Select (ThermoFisher, A1217701) for 30–45 min, pelleted by centrifugation, then seeded in Matrigel coated plates in STEMdiff Cardiomyocyte Support Medium (Stemcell Technologies, 05027) for 24 h. Cardiomyocytes were seeded at a density of 250,000–300,000 cells/cm2 for western blot, and 50,000–60,000 cells/cm² for all other assays. Media change was performed every 2 days thereafter using RPMI media (Sigma, R8758) supplemented with B27 containing insulin (ThermoFisher, 17504044) for a minimum of 4 days. All cell treatments were carried out using RPMI media supplemented with B27 containing insulin.

2.11. EV‐Depleted FBS Preparation

EV‐depleted FBS was prepared by ultracentrifugation at 100,000 × g for 4 h to remove residual EVs (Aswad et al. 2016). Standard DMEM supplemented with 10% FBS was used exclusively for routine cell maintenance and passaging. For EV collection and isolation‐related experiments, cells were switched to serum‐free DMEM (0% FBS) for the duration of the experiments to eliminate potential contamination from serum‐derived vesicles. For assays involving EV treatment, cells were incubated in DMEM supplemented with 0.5% EV‐depleted FBS to maintain cell viability while preventing background vesicle contamination. For experiments involving ALY688 treatment alone, DMEM supplemented with 0.5% standard FBS was used.

2.12. Conditioned Medium EV Isolation

When the cell confluency reached approximately 80%, the culture medium was replaced with DMEM supplemented with 1% penicillin/streptomycin. Cells were then treated as specified for each experiment. To remove residual cells and debris, the conditioned medium was subjected to differential centrifugation at 300 × g for 10 min, followed by 2000 × g for 10 min, both at room temperature. The resulting supernatant was passed through a 0.22 µm filter. EVs were subsequently isolated from the filtered supernatant via ultracentrifugation at 100,000 × g for 2 h at 4°C (Type 70.1 Ti Fixed‐Angle Titanium Rotor, Beckman Coulter Optima MAX‐XP Ultracentrifuge). Final EV pellet was resuspended in filtered PBS for downstream application.

2.13. Western Blot

Heart tissues and H9c2 cells were used for western blot. Cells were suspended in RIPA lysis buffer. BCA (ThermoFisher, A55864) was performed to normalize protein concentration. Proteins were separated by reducing SDS‐PAGE and transferred to PVDF membrane. The following antibodies were used for western blot: GAPDH (1:2000, ThermoFisher, #MA5‐15738), β‐Tubulin (1:2000, Cell Signaling, 2128), Rab8a (1:1000, BD Bioscience, 610844), CD63 (1:1000, ThermoFisher, PA5‐92370), Alix (1:1000, Cell Signaling, 92880), Flotillin 1 (1:1000, Abcam, 133497), Calnexin (1:1000, Abcam, 22595), phospho‐p38 MAPK (1:1000, Cell Signaling, 4511), Total p38 (1:1000, Cell Signaling, 9212), phospho‐AMPK⍺ T172 (1:1000, Cell Signaling, 50081), Total AMPK (1:1000, Cell Signaling, 2532), PKM (1:1000, Proteintech, 10078‐2‐AP), PGK1 (1:1000, Proteintech, 68035‐1‐Ig), ATF4 (1:1000, Proteintech, 10835‐1‐AP), phospho‐eIF2⍺ (1:1000, Cell Signaling, 3398), GRP78 (1:1000, Cell Signaling, 3177), ACTG1 (1:1000, Proteintech, 11227‐1‐AP), Talin1 (1:1000, Proteintech, 14168‐1‐AP), Tuba4a (1:1000, Abcam, ab177479) and anti‐rabbit (1:5000, Cell Signaling, 7074), and anti‐mouse (1:5000, Cell Signaling, 7076). The quantification of signals was performed by densitometry of scanned autoradiographs with the aid of ImageJ (version 1.54v).

2.14. Microscopic Imaging

H9c2 cells were seeded on glass coverslips, which were isolated as described previously (Tang et al. 2024). Staining using different dyes including, CellEvent Caspase 3/7 Detection Reagent (ThermoFisher, C10423), ReadyProbe (ThermoFisher, R37609), CellRox Green (ThermoFisher, C10444), DapRed (Dojindo, D677), DalGreen (Dojindo, D675), MagicRed (Immunochemistry Technologies, 938), and Phalloidin (ThermoFisher, R415) was performed according to manufacturer's protocols and DAPI (HCS NuclearMask Blue Stain, ThermoFisher, H10325) was added simultaneously. Cells were fixed in 4% formaldehyde (Sigma, HT501128) after treatment and mounted with ProLong Gold Antifade Mountant (ThermoFisher, P36930). Slides were visualized under Nikon Eclipse Ti2 and for continuous measurements CellInsight CX7 Platform (ThermoFisher, CX7A1110) was used. Co‐localization analysis was performed with ImageJ JACOP plug‐in.

2.15. Immunofluorescent Analysis

Cells were grown to 70% confluence in 24 well glass bottom plate, then subjected to HR or normoxia with treatment in absence or presence of 500 nM N‐acetylcysteine (Sigma, A720). After treatment, cells were fixed in ice‐cold methanol for 5 min at ‐20°C. Cells were then blocked and permeabilized by incubation with 5% BSA + 0.1% Triton X‐100 in PBS for 30 min at room temperature. Following blocking, cells were incubated overnight at 4°C with conjugated primary antibody (8‐OHdG‐Alexa 488, Santa Cruz, sc‐393871, 1:250; LC3, MBL, M152‐3, 1:200; p62, R&D, MAB8028, 1:200) diluted in 1% BSA + 0.05% Saponin in PBS. After primary incubation, cells were washed once for 5 min using 1% BSA + 0.05% Saponin in PBS, followed with secondary antibody incubation (Goat Alexa 488 Anti‐Rabbit, A11008, 1:500, Donkey Alexa 594 Anti‐Mouse, R37115, 1:500) for 1 h at room temperature. Next, cells were incubated with Hoechst (1:2000 in 1% BSA + 0.05% Saponin in PBS) for 15 min at room temperature. Cells were then washed three times for 5 min each using 1% BSA + 0.05% Saponin in PBS before being immersed in PBS for imaging. Imaging was performed using a Nikon A1 confocal microscope, and mean fluorescence intensity was quantified using ImageJ.

2.16. F‐Actin Quantification

Using phalloidin fluorescent images, actin filament length was quantified using FilamentSensor 2.0 (FS2.0), an open‐source ImageJ‐based toolbox for automated cytoskeletal filament segmentation (Hauke et al. 2023). Focal adhesions were quantified using the CLAHE plugin in ImageJ (Horzum et al. 2014), as previously described.

2.17. Flow Cytometry

After treatment, adherent cells were incubated with appropriate staining dye then harvested with trypsin‐EDTA‐0.25% (Gibco, #25200056) after incubation. CellRox DeepRed (ThermoFisher, C10422) was used in 0.5% FBS‐DMEM at 37°C for 30 min. Upon harvest, cells were re‐suspended in FACS buffer (2% FBS in PBS) and assessed by flow cytometry (Cytek Aurora). Analysis was performed in FlowJO software V10.

2.18. EV Uptake Assay

To confirm EV uptake, EV were stained with DiR (Thermo, D12731) at 37 degrees for 1 h, and then subjected to ultracentrifugation at 120,000 x g for 2 h for removal of unbound DiR dye by OptiPrep density gradient (Sigma, D1556). Recipient cells were first seeded in the μ‐Slide 8 well chamber (ibidi, 80806) in the density of 0.03 × 10⁶ cell per well. When cells reached 80% confluence, cells were treated with DiR‐labelled EV were countered with PlasMem Bright Green (Dojindo, P504). For plasma EV,1 × 10¹⁰ particle per mL was used for EV uptake assay, 1 × 10⁹ particle per mL of cellular EV was used, respectively. After 18 h incubation, visualization was performed using a Nikon A1 confocal microscope with an incubator (37 °C, 5% CO₂). Similarly, the uptake efficiency of DiR‐labelled EV at varied timepoints was collected on all samples using a Cytek Aurora spectral flow cytometer and analysed in FlowJo.

2.19. Seahorse Flux Assay

Oxygen consumption rates (OCRs) were determined by a Seahorse XFe24 extracellular flux analyzer (Agilent) as previously described (Ouimet et al. 2015). Briefly, WT H9c2 cells, RKO and AKO were seeded in each well of a pre‐coated XFe24 cell culture plate and treated with Lalistat1, Paraoxon, ATGL, Rapamycin, Bafilomycin, and ALY688 prior to H/R. After H/R, cells were washed with XF media twice and incubated in a CO₂‐free incubator at 37°C for 1 h. The following reagents were used: Oligomycin (1 µM, Sigma, 75351), FCCP (carbonyl cyanide p‐trifluoromethoxy phenylhydrazone, 3 µM, Sigma, C2920), and Antimycin A (1 µM, Sigma, A8674) plus Rotenone (1 µM, Sigma, R8875).

2.20. Quantitative Real‐Time PCR

Total RNA was extracted using the PureLink RNA Mini Kit (Thermo, 12183018A), and first‐strand cDNA was synthesized with the cDNA Synthesis Kit (Thermo, K1691) following the manufacturer's instructions. 1 µg RNA was used for cDNA synthesis. qPCR was performed using SYBR Green Supermix (Bio‐Rad, 1725274). 50 ng cDNA was used for each reaction of qPCR. Primers are listed in Table S3. Data were normalized to 18S RNA, and fold changes were calculated using the 2^−ΔΔCt method. Relative mRNA levels are expressed in arbitrary units, with the untreated group set to 1.

2.21. Statistical Analysis

Data are presented as mean ± SEM. Statistical analysis was performed using GraphPad Prism 9. Student's t‐test was used for comparison of two groups and one‐way ANOVA or two‐way ANOVA was used for comparison of more than two groups. P<0.05 was considered statistically significant.

3. Results

3.1. ALY688 Intervention Attenuated IR‐Induced Cardiac Dysfunction

To evaluate the effects of ALY688, as structurally illustrated (Figure 1A) on cardiac function and ventricular remodelling following IR injury, we subjected rats to 45 min of coronary artery ligation followed by reperfusion. Two cohorts were analysed at 48 h and 28 days post‐IR. Groups of rats were administered ALY688ER during ischemia (IR‐AI) or administered during reperfusion (IR‐AR) or vehicle (IR) systemically (10 mg/kg) by intravenous infusion starting 5 min after ischemia onset or upon reperfusion, followed by daily subcutaneous injections (10 mg/kg) for up to 28 days (Figure 1B). Cardiac function and structure were assessed by transthoracic echocardiography at baseline (day 0), day 14, and day 28 (Figure S1A, Table S1). IR injury resulted in a significant reduction in both ejection fraction (EF) and fractional shortening (FS) in the IR group compared to sham controls (Figure 1C–H). Treatment with ALY688 significantly attenuated the decline in EF and FS, indicating preserved systolic function. Notably, the magnitude of functional improvement was similar whether ALY688 was administered during ischemia or initiated at reperfusion (Figure 1E,H). In addition to functional benefits, ALY688 treatment led to a significant reduction in infarct length and an increase in overall myocardial thickness in the region of the infarct regardless of the ALY688 intervention time (Figure 1I,J), indicating attenuation of adverse ventricular remodelling.

FIGURE 1.

ALY688 improves cardiac function and reduces myocardial dysfunction following IR injury. (A) Structure of ALY688. (B) Schematic diagram of animal study design. (C–E) Ejection fraction measured at day 0, 14, and 28 after LAD. (F–H) Fractional shortening measured at day 0, 14, and 28 after LAD. (I–J) Infarct length and infarct thickness measured by echocardiography at day 28 after LAD. Results are presented as mean ± SEM (n = 4 in sham and IR group, n = 8 in IR‐AI and IR‐AR group). *P<0.05, **P<0.01, ***P<0.001 versus IR control. One‐way ANOVA with Tukey post hoc test was run for statistical analysis.

3.2. ALY688 Effects on Cell Death, Oxidative Stress and Autophagy Following IR

Next, we examined IR‐induced cell death by measuring circulating levels of cardiac troponin‐I and both circulating and tissue levels of lactate dehydrogenase (LDH), which are commonly used biomarkers of acute cardiac damage. IR markedly increased troponin‐I and LDH levels, which were significantly attenuated by ALY688 treatment administered during either the ischemic or reperfusion phase (Figure 2A–C). Consistently, TUNEL (terminal deoxynucleotidyl transferase–mediated dUTP nick‐end labelling) staining revealed a significant reduction in IR‐induced apoptotic cells in myocardial tissue from animals receiving ALY688 during either phase (Figure 2D,E). In line with the reduced infarct size, quantitative analysis of H&E‐stained myocardial tissue sections indicated a decrease in necrotic area (Figure S1B).

FIGURE 2.

IR and HR induced apoptosis and cell death was ameliorated by ALY688. (A) Troponin I level in serum of rats subjected to 2‐day sham, IR, IR‐AI, and IR‐AR. (B) LDH level in serum as indicated in panel A. (C) LDH level in infarct heart as indicated in panel A. (D) Representative image of TUNEL staining in infarct zone (20x, scale bar:100 µm). (E) Quantification of positive TUNEL staining. (F) LDH level in culture medium at endpoint. (G) Progression of cell death in H9c2 cells measured by caspase 3/7 activity on an hourly basis. Data were normalized to HR. (H) Endpoint caspase 3/7 activity in H9c2 subjected to HR. Data was normalized to HR. (I) Representative image of VC3A I biosensor H9c2 cells (60x, 3x zoom, scale bar: 10 µm), ReadyProbe staining in H9c2 cells (20x, scale bar: 100 µm) treated with or without 300 nM ALY688 and subjected to normoxia or HR. (J) Quantification of Caspase 3 activation in VC3AI biosensor H9c2 cells. (K) Quantification of ReadyProbe staining in H9c2 cells. Data was normalized by fold change over normoxia control. (L) Representative image of ReadyProbe staining in iPSC‐CM (20x, scale bar: 250 µm). (M) Quantification of ReadyProbe staining in iPSC‐CM. Results are presented as mean ± SEM (n = 3–5 per group). *P<0.05, **P<0.01, ***P<0.001 versus control. One‐way ANOVA with Tukey post hoc test was run for statistical analysis of panel A–C, E and H. Two‐way ANOVA with Tukey multiple comparisons post hoc test was run for statistical analysis of panel F, J, K, and M.

Next, we used a cellular model of hypoxia‐reoxygenation (HR) in H9c2 cells derived from rat ventricle, subjected to hypoxia (H: 1% O₂) for 6 h followed by up to 24 h reoxygenation (R: 20% O₂). The small but significant increase in LDH release induced by HR was significantly reduced when cells were pre‐treated with ALY688 (Figure 2F). A more detailed temporal analysis of caspase 3/7 activation, assessed using an activatable fluorescent probe and real‐time confocal microscopy, indicated a sustained elevation upon reoxygenation that peaked after 30 h (Figure 2G) that was reduced in the presence of ALY688 (Figure 2H). Additional studies in cells engineered to express the VC3Ai biosensor confirmed the ability of ALY688 to reduce HR‐induced caspase activation (Figure 2I,J).

To further validate the findings in the H9c2 cell line, we applied human induced pluripotent stem cell‐derived cardiomyocytes (iPSC‐CM), which are well‐established for supplementing in vitro studies of cardiac IR models (Lebek et al. 2023). Cell viability staining (ReadyProbe) was used to identify cell death induced by HR and the effect of ALY688 in both H9c2 and iPSC‐CM (Figure 2I,K–M). As shown, HR triggered a significant increase in dead cells, indicated by green fluorescence, but the number of dead cells was reduced upon ALY688 treatment (Figure 2I,K–M).

Reactive oxygen species (ROS) production is a crucial early driver of IR injury‐induced cell death (Xiang et al. 2024). To elucidate the role of ALY688 in ROS‐associated IR‐induced cell death, ROS was measured in cellular models. HR‐induced ROS generation, measured by CellRox Green probe in both H9c2 and iPSC‐CM (Figure 3A–C) and CellRox DeepRed analysed by flow cytometry in H9c2 (Figure S2A, B), was attenuated by ALY688 pretreatment. To determine whether ALY688 diminished HR‐triggered cell death via reducing ROS accumulation, we applied immunofluorescence staining of 8‐OHdG to measure DNA oxidative stress. 8‐OHdG expression was significantly enhanced upon HR incubation and reduced when treated with ALY688 in H9c2 cells as well as iPSC‐CM (Figures 3D, E, and S2C, D).

FIGURE 3.

Disrupted autophagy flux induced by IR was restored by ALY688 administration.

(A) Representative image of CellRox staining in H9c2 cells (60x, scale bar: 10 µm) and iPSC‐CM (20x, scale bar: 50 µm) treated with or without 300 nM ALY688 and subjected to normoxia or HR. (B) Quantification of CellRox staining in H9c2 cells. (C) Quantification of CellRox staining in iPSC‐CM. (D) Representative image of immunofluorescence staining of 8‐OHdG. Data was normalized to normoxia control (20x, scale bar: 50 µm). (E) Quantification of immunofluorescence staining of 8‐OHdG. Data was normalized by fold change to normoxia control. (F) SDS‐PAGE and immunoblot analysis of rat infarct heart lysate for LC3 andp62; GAPDH was used as a loading control. (G,H) Quantification of LC3 and p62. (I) SDS‐PAGE and immunoblot analysis of iPSC‐CM for LC3 and p62; β‐actin was used as a loading control. (J,K) Quantification of LC3 and p62. (L) Representative images of HiBiT‐LC3 autophagy reporter cells acquired at 60x magnification (60x, 3x digital zoom); MagicRed (MR) staining in H9c2 cells (60x); MR staining in iPSC‐derived cardiomyocytes (iPSC‐CM) (60x); DapRed (DR) and DalGreen (DG) staining in iPSC‐CM (60x, 3x zoom); and tandem fluorescent LC3 (tf‐LC3) in H9c2 cells (40x) subjected to hypoxia–reoxygenation (HR) with or without ALY688 treatment. (scale bar: 10 µm) (M) Quantification of Janelia positive signals in HiBit LC3 reporter cells. (N) Quantification of MR staining in H9c2 cells. Data was normalized by fold change to normoxia control. (O) Quantification of MR staining in iPSC‐CM. (P) Quantification of DR in iPSC‐CM. (Q) Quantification of DG in iPSC‐CM. (R) Quantification of autophagosome and autolysosome in tf‐LC3 cell line. Results are presented as mean ± SEM. (n = 3–8 per group). *P<0.05, **P<0.01, ***P<0.001 versus control. Two‐way ANOVA with Tukey multiple comparisons post hoc test was run for statistical analysis of panel B–E, J–K, M–Q. One‐way ANOVA with Tukey post hoc test was run for statistical analysis of panel G,H, and R.

In myocardial ischemia, induction of autophagy via the AMPK pathway is protective, whereas reperfusion stimulates autophagy with BECLIN‐1 upregulation, and is implicated in causing myocyte death. An appropriate balance of autophagy is an important determinant of outcomes in ischemia (Ma et al. 2012). The processes through which adiponectin signalling induces autophagy activation to elicit cardioprotective or detrimental effects in IR injury have not been elucidated (Sciarretta et al. 2018). We have previously shown that adiponectin mediates similar effects via stimulation of autophagy (Sung et al. 2024). With this in mind, autophagy analysis in infarcted heart was performed. Increased heart tissue LC3‐II and p62 levels were observed in rats subjected to IR compared to the sham group, whereas ALY688 intervention significantly attenuated p62 accumulation (Figure 3F–H). Autophagosome accumulation during HR was further validated in the iPSC‐CM model, demonstrated by increased steady‐state LC3 lipidation and decreased p62 degradation (Figure 3I–K). With the administration of ALY688, this abnormal accumulation was partially mitigated (Figure 3I–K). To further evaluate autophagosome accumulation under extreme stress, H9c2 and iPSC‐CM cells subjected to HR with or without ALY688 were treated with bafilomycin (Baf) to block lysosomal degradation. ALY688‐treated HR cells exhibited altered LC3‐II and p62 abundance compared to vehicle‐treated HR controls (Figure S2E–J). Because static immunoblots primarily reflect steady‐state levels rather than dynamic turnover, we next sought to rigorously quantify true autophagic flux using a suite of functional reporters.

First, we performed real‐time quantitative analysis of dynamic autophagy flux using a genetically engineered H9c2 cell line expressing the LC3 HiBiT reporter (Tang et al. 2024; Tang et al. 2026). A significant increase of red fluorescent signal, indicating accumulation of LC3‐II, was detected in cells subjected to HR, while pretreatment with ALY688 effectively mitigated this (Figure 3L,M). To clarify whether lysosome activity was altered in response to HR ± ALY688, we used MagicRed (MR), a cathepsin B probe, to measure lysosomal enzyme activity. We observed that in response to ALY688, lysosomal activity was increased, and that no change occurred in response to HR in H9c2 and iPSC‐CM (Figure 3L,N,O). As reported previously, DapRed labels both autophagosomes and autolysosomes, while DalGreen labels autophagosomes but fluoresces strongly only in autolysosomes, allowing their distinction (Tang et al. 2024). ALY688 partially restored the HR‐disrupted autophagic flux, as further supported by DapRed (DR) and DalGreen (DG) staining, which showed an increase in DR but a decrease in DG during HR compared to normoxia. The decreased DG induced by HR was enhanced in ALY688‐treated iPSC‐CM cells, suggesting an increased number of autolysosomes compared to the HR control (Figure 3L,P,Q).

Lastly, to further interrogate the effect of HR and ALY688 on autophagic flux, we used H9c2 cells stably expressing the tandem GFP‐RFP‐LC3 plasmid (tf‐LC3 cell). Using this construct, autophagosomes contain both red and green fluorescence; after fusing with lysosomes, GFP is quenched and only the RFP signal remains, allowing tracking of autophagic flux (Tang et al. 2024). Data indicated that the total number of autophagosomes and autolysosomes was decreased when cells were exposed to HR, and ALY688 restored autophagic flux with more autolysosome content evident (Figure 3L,R). The ability of ALY688 to elicit adiponectin‐like signalling was demonstrated by a significant increase in phosphorylation of p38 MAPK and AMPKα in H9c2 cells (Figure S2K,L).

3.3. Proteome Profiling of Tissue From Myocardial Infarct Region to Discover New Mechanisms of ALY688 Action

To further elucidate the mechanisms underlying the cardioprotective effects of ALY688 against IR, we conducted proteomic profiling of the infarct and border regions of heart tissue collected at 28 days. Given the cardiac outcome including cardiac function and remodelling regardless of the time of ALY688 intervention, subsequent mechanistic investigations focused on the groups receiving ALY688 or vehicle at ischemia (IR‐AI). Proteomic data were analysed using partial least squares‐discriminant analysis (PLS‐DA) and hierarchical clustering, which revealed distinct protein expression profiles among the sham, IR, and IR‐AI groups (Figure 4A,D). Differential expression analysis (FC ≥ 1.5, FDR ≤ 0.05) identified 58 upregulated and 52 downregulated proteins in IR compared to sham (Figure 4B), and 71 upregulated and 47 downregulated proteins in IR‐AI compared to IR (Figure 4C). Pathway enrichment analysis of these differentially expressed proteins showed that IR was associated with activation of pathways implicated in cardiac remodelling, including extracellular matrix, collagen deposition, metabolic dysregulation and inflammatory activation (Figure S3A). On the other hand, the most prominent pathway altered by ALY688 treatment (IR‐AI vs. IR) was adiponectin‐like (autophagy) signalling, with additional changes observed in metabolism (including sphingolipid signalling pathway and metabolic pathways), inflammatory pathways (such as Innate immune system, Toll‐like receptor cascades) (Figure 4E). Of note, volcano plot analysis highlighted a marked downregulation of the small GTPase Rab8a in IR versus sham, with ALY688 treatment restoring Rab8a expression to baseline levels relative to the IR group (Figure 4B,C). This result was further confirmed by Western blot analysis of tissue homogenates from the infarct region (Figure 4F,G).

FIGURE 4.

Proteomic analysis revealed altered protein expression in infarcted rat hearts following IR injury. (A) PCA analysis of infarct heart proteomics. (B) Volcano plot of the comparison of IR versus sham. (C) Volcano plot of the comparison of IR‐AI versus IR. (D) Hierarchical clustering heatmap. (E) Pathway enrichment analysis in the comparison of IR‐AI versus IR. (F) SDS‐PAGE and immunoblot analysis of infarct heart lysate using Rab8a. β‐tubulin was used as a loading control. (G) Quantification of panel F. (H) Representative image of scanning electron microscopy (SEM) of infarct area. (I) NTA analysis of EV isolated as indicated, and quantification of particle number in (J), size quantification in (K). (L) Representative image of CryoEM of serum derived EV. (M) SDS‐PAGE and immunoblot analysis of EV isolated from serum of rats subjected to sham, IR, and IR‐AI using Alix, CD63, Flotillin‐1, and Rab8a. (N) Quantification of Rab8a expression in EV. Results are presented as mean ± SEM. (n = 3–8/group). *P<0.05, **P<0.01, ***P<0.001 versus control. One‐way ANOVA with Tukey post hoc test was run for statistical analysis of panel G, J, K, and N.

3.4. Characterization of EV Derived From IR Rat Serum

Given that Rab8a regulates vesicle transport and EV secretion (Hu et al. 2022) and was upregulated by ALY688 in the heart, we examined EV dynamics post‐IR with ALY688 treatment. SEM of infarcted myocardium revealed EV accumulation (white arrows) (Figure 4H). Upon ALY688 administration, the abundance of particles in the infarct area was greater compared to IR controls (Figure 4H). Serum EVs from IR and ALY688‐treated rats were isolated via size exclusion chromatography. NTA showed a trend toward reduced EV levels in IR rats compared to sham, partially restored by ALY688 (Figure 4I,J). IR significantly decreased the particle size, and there was no difference between IR and IR‐AI (Figure 4K). SEM results aligned with NTA findings (Figure 4J). Cryo‐EM confirmed lipid bilayers and electron‐dense cargo in EVs (Figure 4L). EVs were positive for Alix, CD63, and Flotillin1, and negative for Calnexin, and nucleoporin, with cell lysate from H9c2 as control (Figures 4M and S3B–E). Notably, Rab8a was present in serum EVs, mirroring its pattern in infarcted heart tissue post‐IR and ALY688 treatment (Figure 4M,N). All EV samples showed expected size ranges by NTA, expressed canonical EV markers, and demonstrated acceptable purity via electron microscopy.

3.5. ALY688 Regulates Cardiomyocyte EV‐Mediated Pro‐Survival Effect via Rab8a Activation During HR

Given the established role of superoxide anions and ROS in cardiovascular pathologies, particularly IR injury (Sanchez‐Perez et al. 2023), we investigated whether serum EV from IR‐AI rats exert protective effects by enhancing ROS clearance post‐IR. Using HR‐exposed H9c2 cells and iPSC‐CM as in vitro models of IR, we assessed the impact of serum EV from IR‐AI rats on cell death and antioxidant responses. First, we assessed the uptake efficiency by H9c2 cells of serum EV isolated from sham (EV^Sham), IR (EV^IR), and IR‐AI (EV^IR‐AI) rat serum. H9c2 cells were incubated with DiR‐labelled EV, and uptake was evaluated using confocal microscopy and flow cytometry. Confocal and flow cytometry data confirmed efficient internalization of all EV types (EV^Sham, EV^IR, and EV^IR‐AI), with no significant difference in uptake efficiency (Figure S4A–C). To establish the causal requirement for EV internalization in mediating the functional effects, we next validated pharmacological blockade of EV uptake using dynasore, a dynamin GTPase inhibitor. DiR‐labelled EVs were administered to H9c2 cells in the presence or absence of dynasore, and internalization efficiency was assessed by confocal microscopy. Dynasore treatment markedly reduced DiR‐EV internalization compared to vehicle controls, confirming effective blockade of serum EV uptake under the experimental conditions used (Figure S4D). Functionally, EV^IR‐AI significantly reduced HR‐induced cell death in both cell types, as shown by ReadyProbe staining (Figure 5A–D) and LDH release (Figure 5I,J). EV^IR‐AI also attenuated ROS accumulation (Figure 5E–H), indicating that ALY688‐modified serum EV exert cytoprotective and antioxidant effects in vitro. To directly establish that EV internalization is required for the cytoprotective effect of EV^IR‐AI, HR‐challenged H9c2 cells treated with EV^Sham, EV^IR, or EV^IR‐AI were administered Dynasore to block EV uptake, or GW4869 to inhibit endogenous EV biogenesis in recipient cells. Dynasore co‐treatment abolished the LDH‐lowering effect of EV^IR‐AI, with cell death levels remaining comparable to untreated HR controls, demonstrating that physical internalization of EVs is required for cytoprotection (Figure 5K). In contrast, GW4869 did not significantly alter the protective effect of EV^IR‐AI (Figure 5K), indicating that the cardioprotective outcome is attributable to the exogenously delivered ALY688‐reprogrammed EV cargo rather than autocrine amplification through recipient cell EV secretion.

FIGURE 5.

ALY688 enhances cardiomyocyte EV‐mediated pro‐survival effects under HR. (A) Representative image of ReadyProbe signal in H9c2 cells (20x, scale bar: 100 µm) subjected to HR and treated with EV isolated from serum of rats subjected to sham, IR, and IR‐AI. (B) Quantification of ReadyProbe staining in H9c2 cells. (C) Representative image of ReadyProbe signal in iPSC‐CM (20x, scale bar: 125 µm) subjected to HR and treated with EV isolated from serum of rats subjected to sham, IR, and IR‐AI. (D) Quantification of ReadyProbe staining in iPSC‐CM. (E) Representative image of CellRox staining in H9c2 cells (60x, scale bar: 10 µm) subjected to HR and treated with EV as indicated in panel A. (F) Quantification of CellRox in H9c2 cells. (G) iPSC‐CM subjected to HR and treated with EV as indicated in panel A (60x, scale bar: 10 µm). (H) Quantification of CellRox in iPSC‐CM. (I) LDH activity in H9c2 cells subjected to HR and treated with EV as indicated in panel A. (J) LDH level measured in iPSC‐CM. (K) LDH level measured in H9c2 cells treated with or without dynasore, GW4869, with EV isolated from serum of rats subjected to sham, IR, and IR‐AI, and subjected to HR. Results are presented as mean ± SEM. (n = 3 per group), *P<0.05, **P<0.01, ***P<0.001 versus control. In panel I, *P<0.05, **P<0.01, ***P<0.001 versus normoxia PBS. #P<0.05 versus HR PBS. Two‐way ANOVA with Tukey multiple comparisons post hoc test was run for statistical analysis.

To explore the underlying mechanism, we considered the predominance of cardiomyocytes in the adult human left ventricle (Litviňuková et al. 2020), Rab8a's role in EV biogenesis (Hu et al. 2022), and our proteomics data (Figure 4A). We hypothesized that ALY688 enhances cardiomyocyte EV secretion via Rab8a activation, contributing to protection. Rab8a knockout (RKO) H9c2 cells were generated and validated by western blot (Figure S5A,B). Conditioned medium (CM) from WT and RKO cells was used for EV isolation by ultracentrifugation. Immunoblotting revealed reduced Alix and CD63 expression in EV from RKO cells treated with ALY688 compared to WT (Figure 6A–C), as well as the absence of negative control calnexin (Figure S5C,D). NTA confirmed EV presence in both cell types, but particle secretion was significantly lower in RKO cells (Figure 6D,E). Although ALY688 increased EV output in both groups, the effect was markedly greater in WT cells (Figure 6E), supporting that Rab8a mediates ALY688‐enhanced EV biogenesis and release, linking this pathway to ALY688's cardioprotective effects.

FIGURE 6.

ALY688 modulates EV release and function via Rab8a‐dependent mechanisms, attenuating HR‐induced injury in H9c2 cells. (A) SDS‐PAGE and immunoblot analysis of EV isolated from WT and RKO H9c2 cells treated with or without 300 nM ALY688 for 24 h using Alix and CD63, and quantification in (B) and (C). (D) NTA analysis of EV isolated from WT and RKO H9c2 cells treated with or without ALY688. (E) Quantification of particle number by NTA. (F) Representative image of ReadyProbe staining (20x, 3x zoom, scale bar: 10 µm) in H9c2 cells subjected to HR and treated with EV isolated from conditioned medium of WT or RKO cells treated with or without 300 nM ALY688, and quantification in (G)(H) Representative image of CellRox signal in H9c2 cells (60x, 2x zoom, scale bar: 10 µm) subjected to HR and treated with EV indicated previously, and quantification in (I). (J) LDH level measured in H9c2 cells treated with or without dynasore, GW4869, with EV isolated from WT and RKO H9c2 cells treated with or without 300 nM ALY688 for 24 h, and subjected to HR. Results are presented mean ± SEM. (n = 3–6 per group), *P<0.05, **P<0.01, ***P<0.001 versus control. Two‐way ANOVA with Tukey multiple comparisons post hoc test was run for statistical analysis.

We also confirmed that CM EV from all sources were efficiently taken up by WT H9c2 cells (Figure S5E), with no difference in uptake efficiency as measured by flow cytometry (Figure S5F,G). Similarly, EV uptake inhibition by dynasore was also validated in the presence of DiR‐labelled CM EV for the subsequent functional effect evaluation (Figure S5H). Finally, we evaluated whether EV derived from WT and RKO cells treated with or without ALY688 could ameliorate HR injury. Equal concentrations of CM EV were added to H9c2 cells prior to HR challenge, and cell death and oxidative stress were assessed. Consistent with the protective effect of IR‐AI serum EV, EV from WT cells treated with ALY688 reduced HR‐induced cell death and ROS in H9c2 cells (Figure 6F–I). In contrast, the beneficial effects of ALY688‐stimulated CM EV were abolished in the absence of Rab8a (Figure 6F–I). To confirm that the cytoprotective effects of EV^WT‐ALY are dependent on active EV internalization by recipient cells, HR‐challenged H9c2 cells treated with conditioned medium‐derived EVs were co‐administered dynasore or GW4869. Consistent with the serum EV findings, dynasore abolished the reduction in LDH release conferred by EV^WT‐ALY, while leaving the impaired protection of EV^RKO‐ALY unchanged (Figure 6J). GW4869 did not attenuate the protective effect of EV^WT‐ALY (Figure 6J), further confirming that the Rab8a‐dependent cardioprotective signal resides within the internalized EV cargo rather than in paracrine EV‐independent mechanisms. These results demonstrate that Rab8a is an essential mediator of the pro‐survival function of ALY688‐derived EV in the HR model.

3.6. Serum‐Derived EV From Rats With ALY688 Intervention Exert Cardioprotective Metabolic Effects

To investigate the EV‐mediated mechanisms underlying the beneficial effects of ALY688 at the proteomic level, we performed quantitative proteomic analysis from serum EV isolated from sham, PBS‐, and ALY688‐injected IR rats. A total of 247 proteins were identified in serum EV. Of these, 27 matched entries in the Vesiclepedia database, 182 corresponded to the ExoCarta database, and 38 were not listed in either database (Figure 7A). Principal component analysis (PCA) and hierarchical clustering of the serum EV proteome revealed clear separation among the experimental groups (Figure 7B,C). Differential protein expression analysis demonstrated that most proteins were significantly upregulated (greater than two‐fold change; adjusted P‐value < 0.05) in EV from IR serum compared to sham. In contrast, when comparing the serum EV proteome of IR‐AI versus IR, downregulated proteins outnumbered upregulated ones (Figure S6A,B). The top 22 significantly regulated proteins and their functions are listed (Table S2). Notably, Grp78, a key regulator of protein refolding and ER stress, was downregulated in IR‐AI versus IR (Figure S6C). Predicted protein targets included GAPDH, PKM and PGK1 in the glucose metabolism pathway (Figure 7D–G). Functional metabolic assessment in H9c2 challenged by HR and treated with EVs mentioned above using Seahorse analysis further the beneficial effect of EV^IR‐AI protected HR induced impaired energy metabolism (Figure 7H,I). Concurrently, cytoskeletal proteins (Actb, Actg1, Talin1, Tuba4a) were dysregulated in IR EVs but normalized by ALY688 (Figure S6D–G), aligning with phalloidin staining showing EV^IR‐AI preserved filament structure post‐HR (Figures 7J–L and S6H). These findings demonstrate that ALY688 reprograms EV proteomes to attenuate metabolic stress, ER dysfunction, and cytoskeletal disruption, collectively mitigating IR injury.

FIGURE 7.

Proteomics analysis of serum derived EV and functional effect in HR cellular model. (A) Venn diagram of serum‐derived EV proteomics overlapping with ExoCarta and Vesiclepedia. (B) PCA analysis of serum‐derived EV proteomics. (C) Hierarchical clustering heatmap. (D) Pathway analysis of significantly expressed proteins. (E–G) Expression of GAPDH, PGK1 and PKM in serum EV. (H) Seahorse analysis of H9c2 treated with or without EV isolated from serum of rats subjected to sham, IR, and IR‐AI, and subjected to normoxia or HR. (I) Measurement of maximal respiratorycapacity during Seahorse experiment. (J) Representative image of Phalloidin staining in H9c2 treated with or without EV isolated from serum of rats subjected to sham, IR, and IR‐AI, and subjected to normoxia or HR (60x, scale bar: 10 µm). (K) Filament length quantification of Phalloidin staining. (L) Filament focal adhesions quantification of Phalloidin staining. Results are presented as mean ± SEM. (n = 3‐5/group) *P<0.05, **P<0.01, ***P<0.001 versus control. One‐way ANOVA with Tukey post hoc test was run for statistical analysis of panel E–G. Two‐way ANOVA with Tukey multiple comparisons post hoc test was run for statistical analysis for I, K and L.

To directly examine whether ALY688‐reprogrammed serum EVs modulate ER stress responses and cytoskeletal integrity in recipient cardiomyocytes, H9c2 cells subjected to HR were treated with serum EVs isolated from sham, IR, or IR‐AI rats (EV^Sham, EV^IR, and EV^IR‐AI, respectively), and recipient cell protein expression of ATF4, GRP78, and Tuba4a was assessed by Western blot. HR significantly reduced ATF4 and GRP78 protein expression in recipient H9c2 cells compared to normoxic controls, indicative of a collapse of adaptive unfolded protein response (UPR) signalling under severe reoxygenation stress (Figure S7A–C). Treatment with EV^IR‐AI significantly restored ATF4 and GRP78 expression toward normoxia levels, whereas EV^IR did not rescue this deficit. These findings provide direct evidence that ALY688‐reprogrammed serum EVs reconstitute adaptive UPR capacity in recipient cardiomyocytes, establishing a functional link between the reduced GRP78 packaging observed in EV^IR‐AI cargo and active rebalancing of ER proteostasis in target cells. Consistent with the cytoskeletal proteomic data, HR significantly reduced Tuba4a protein expression in recipient H9c2 cells compared to normoxic controls (Figure S7D,E). EV^IR‐AI treatment significantly ameliorated this reduction, whereas EV^IR provided no rescue. This result directly demonstrates that ALY688‐reprogrammed EVs sustain cytoskeletal protein expression in stressed recipient cardiomyocytes, providing molecular‐level evidence for the functional cytoskeletal preservation observed by phalloidin staining (Figure 7J–L) and corroborating the normalization of Tuba4a within the EV^IR‐AI cargo proteome (Figure S6F).

To further delineate the mechanisms by which Rab8a‐dependent EVs confer cardioprotection, we examined whether EV^WT‐ALY and EV^RKO‐ALY differentially regulate cytoskeletal integrity and mitochondrial morphology and function in HR‐challenged H9c2 cells. Cytoskeletal integrity, assessed by phalloidin staining of filamentous actin (F‐actin), was markedly disrupted by HR, evidenced by significant reductions in filament length and loss of focal adhesion contacts (Figure S8A–C). EV^WT‐ALY significantly preserved cytoskeletal architecture toward normoxia levels, whereas EV^RKO‐ALY failed to provide this protection. Mitochondrial morphology, visualized by Mitotracker staining, was severely disrupted by HR, with significant reductions in mitochondrial density, branch length, and network connectivity indicative of pathological fragmentation (Figure S8D–G). EV^WT‐ALY significantly preserved mitochondrial network complexity and branch length, while EV^RKO‐ALY conferred no morphological recovery. ATP production, used as a functional readout of mitochondrial energetic capacity, was significantly reduced by HR (Figure S8H). EV^WT‐ALY showed a trend toward elevated ATP levels, though this did not reach statistical significance. EV^RKO‐ALY showed no improvement. Together, these data establish that EV^WT‐ALY, but not EV^RKO‐ALY, preserves cytoskeletal integrity and mitochondrial network architecture in HR‐challenged cardiomyocytes in a Rab8a‐dependent manner, directly validating the functional relevance of the EV proteomic signatures identified in Figure 7. Lastly, to validate the proteomics findings at the tissue level we performed additional Western blot analysis on infarct heart tissue from sham, IR, and IR‐AI rats, focusing on representative proteins from enriched pathways identified in the serum EV proteome. Specifically, we examined PGK1 and PKM, as well as Talin1, Tuba4a, and Actg1, selected from the top 22 significantly regulated proteins. PGK1 and PKM protein levels were significantly increased in IR hearts compared to sham, while IR‐AI attenuated this upregulation, restoring levels toward sham (Figure S8I–K). In contrast, the cytoskeletal proteins Talin1, Tuba4a, and Actg1 were reduced in IR tissue, with Talin1 and Actg1 restored following ALY688 (IR‐AI) treatment (Figure S8L–O). These findings are consistent with the known roles of glycolytic dysregulation and cytoskeletal disruption in IR injury and support the protective effects of IR‐AI.

4. Discussion

Myocardial IR injury remains a major complication post‐infarction, as reperfusion, though essential, can exacerbate damage via oxidative stress, inflammation, and mitochondrial dysfunction (Zhang et al. 2024). Despite progress in reperfusion strategies, no therapies directly target IR‐induced injury, highlighting the need for new interventions (Hausenloy and Yellon 2013). We found that the synthetic adiponectin receptor agonist peptide ALY688 provided robust cardioprotection, improving left ventricular function, reducing infarct size, and limiting remodelling, consistent with adiponectin's known effects (Cho et al. 2024). Decreased serum troponin‐I and LDH levels further support its role in mitigating myocardial damage, and further experimental evidence indicated this was partly through mitochondrial stabilization and mPTP inhibition (Ren et al. 2017). Proteomic analysis confirmed activation of cardioprotective pathways, underscoring ALY688's therapeutic potential in IR injury.

Our data indicated that ALY688 conferred cardioprotection by restoring autophagic flux in HR‐challenged cardiomyocytes. In this model, ALY688 mitigated abnormal LC3‐II accumulation and normalized dynamic autophagic flux as evidenced by our live‐cell reporters and increased lysosomal activity, which prevents both the buildup of dysfunctional organelles and excessive self‐digestion. While moderate autophagy during ischemia is cytoprotective, reperfusion induces excessive, dysregulated autophagy via ROS and aberrant signalling, promoting cell death through degradation of vital cellular components. ALY688 mitigates this maladaptive response, preserving cardiomyocyte viability through adequate autophagic flux capacity (Sanchez‐Perez et al. 2023). Mechanistically, ALY688 appears to fine‐tune autophagy via AMPK signalling, consistent with the action of adiponectin in suppressing excessive autophagy and promoting cellular homeostasis (Sung et al. 2024; Guo et al. 2022). By restoring autophagic flux, ALY688 enhances the clearance of damaged organelles, reduces oxidative stress, which collectively contribute to its cardioprotective effects.

Emerging evidence suggests that autophagy and EV biogenesis share regulatory pathways, prompting our hypothesis that ALY688 may also modulate EV dynamics. Cardiac proteomics revealed that ALY688 significantly restored Rab8a expression, a small GTPase essential for vesicle trafficking and increasingly recognized as a regulator of secretory autophagy and EV biogenesis (Kim et al. 2017). Rab8a loss impairs degradation of autophagic cargo and inhibits secretion of autophagic and lysosomal proteins via Golgi‐derived vesicles, whereas Rab8a activation enhances secretory autophagy and cargo export (Chen et al. 2017). Functionally, Rab8a facilitates docking and fusion of vesicles with the plasma membrane by interacting with the exocyst complex, allowing precise vesicular release through transient membrane fusion events (Essid et al. 2012). In secretory autophagy, Rab8a specifically mediates the fusion of amphisomes with the plasma membrane, enabling EV‐mediated release of autophagic cargo, such as annexin A2 (Essid et al. 2012). Its role in EV biogenesis is further supported by evidence that Rab8a knockdown reduced EV release and disrupted cargo trafficking (Hu et al. 2022; Wu et al. 2023). Thus, ALY688‐induced Rab8a upregulation may enhance both secretory autophagy and EV biogenesis, linking improved autophagic flux with augmented intercellular communication.

Proteomic profiling of serum EVs from ALY688‐treated rats revealed downregulation of glycolytic enzymes such as PKM and PGK1, key contributors to proton accumulation and calcium overload during reperfusion. Emerging evidence shows that PGK1 and PKM contribute to ischemic heart disease beyond glycolysis. PGK1 supports ATP generation while modulating the Na⁺/H⁺ exchanger and macrophage polarization, thereby influencing cardiac remodelling and inflammation. Altered PGK1 activity affects mitochondrial function, calcium handling, and cell death pathways in cardiomyocytes and immune cells (Horvath et al. 2021; Gao et al. 2024). Similarly, PKM, particularly the PKM2 isoform, acts as a metabolic and signalling hub. Its upregulation during ischemia‐reperfusion (IR) promotes metabolic reprogramming, inflammation, and dysregulation of mitochondrial dynamics and autophagy (Lorenzana‐Carrillo et al. 2022; Canonico et al. 2023; Ni et al. 2022). Dysregulated PKM/PGK1 exacerbates acidosis and ionic imbalance, aggravating myocardial injury. In infarcted hearts, EV‐mediated downregulation of these enzymes supports metabolic restoration and may mitigate calcium overload. Targeting PKM/PGK1 may thus offer new therapeutic strategies for modulating metabolism and inflammation in ischemic heart disease. Simultaneously, ALY688‐EV restored cytoskeletal protein expression (e.g., Actb, Tuba4a, and Talin1) and we demonstrated enhanced filament structure and organization in cardiomyocytes, thus preserving structural integrity alongside enhanced autophagic clearance of damaged organelles. This directional change aligns with evidence that cytoskeletal disruption, including loss of Talin‐mediated integrin‐cytoskeleton coupling and tubulin depolymerization is a hallmark of ischemic myocardial injury, and that structural integrity of the sarcomere and costamere is critical for cardiomyocyte survival and contractile recovery (Manso et al. 2013; Manso et al. 2017).

These adaptations, combined with ER stress reduction via GRP78 downregulation, extend ALY688's cardioprotective effects beyond cell‐autonomous mechanisms to intercellular coordination of repair. This aligns with reports that EV‐mediated metabolic reprogramming mitigates IR injury by orchestrating tissue‐level responses (Hu et al. 2023; Gan et al. 2020). Moreover, EVs from regenerative or stem cells carry anti‐apoptotic, anti‐fibrotic, and angiogenic miRNAs and proteins to injured myocardium, amplifying repair (Salybekov et al. 2021). Functionally, ALY688‐EV reduced HR‐induced cell death and ROS accumulation in vitro, recapitulating the cardioprotective actions of stem cell‐derived EVs (Xiao et al. 2016; Wu et al. 2020; Peng et al. 2020; Li et al. 2024). Downregulation of GRP78 further suggests a role in relieving ER stress, consistent with effects observed in MSC‐EV treatment (Huang et al. 2022). These findings underscore the therapeutic promise of modulating EV biogenesis and cargo in IR injury.

The translational potential of ALY688 is underscored by its favourable pharmacokinetics and its dual action of direct cardiomyocyte protection coupled with systemic EV‐mediated effects. The ability to modulate both intracellular and intercellular signalling pathways positions ALY688 as a promising candidate for clinical translation in acute myocardial infarction and other cardiovascular diseases characterized by IR injury.

Challenges for clinical translation of ALY688 include optimizing its timing, dosage, and delivery route. The therapeutic window remains undefined, especially in comorbidities like diabetes, where adiponectin resistance may impair efficacy. Additionally, the heterogeneity of EV populations and cargo complicates standardization and quality control in therapeutic EV production (Morales and Ko 2022). Pathological conditions can markedly alter EV composition and function, affecting the enrichment of cardioprotective miRNAs and proteins (Hu et al. 2023). For example, cytokine stimulation may shift EV cargo profiles, enhancing or diminishing cardioprotective potential (Wendt et al. 2018). Whether adiponectin signalling selectively enriches EVs with cardioprotective factors remains unknown. Future studies should determine if adiponectin‐induced EVs possess a unique molecular signature and whether Rab8a upregulation can enhance EV uptake and therapeutic efficacy in ischemic myocardium. The timing of EV release and administration post‐IR also warrants investigation, as delayed delivery might better address chronic remodelling. Lastly, EV‐immune system interactions must be considered. Although ALY688‐EV exhibited anti‐inflammatory effects, the risks of immunogenicity or unintended immune modulation require thorough evaluation in preclinical and clinical settings.

This study has several limitations. While Rab8a's role in EV biogenesis is established in vitro, its in vivo contribution requires validation using cardiomyocyte‐specific knockout models. The proteomic analysis of EV cargo did not distinguish between exosome and microvesicle subsets, which may have distinct functional roles. The long‐term effects of ALY688‐EV on cardiac remodelling and function were not assessed. While the present study focuses on cardiomyocyte‐autonomous Rab8a‐dependent EV biogenesis as a key mechanism of ALY688‐mediated cardioprotection, we acknowledge that systemic ALY688 administration engages adiponectin receptors on multiple cardiac cell types, and that additional anti‐inflammatory, anti‐fibrotic effects likely operate in parallel and contribute to the overall improvement in cardiac function observed in vivo. Furthermore, given Rab8a's established role in suppressing inflammatory response by recruiting phosphatidylinositol 3‐kinase γ (PI3Kγ) as an effector upon toll‐like receptors (TLRs) activation in macrophages (Wall et al. 2019; Luo et al. 2014; Wall et al. 2017; Luo et al. 2018), its restoration by ALY688 may additionally modulate inflammatory secretion in non‐cardiomyocyte populations, a possibility that warrants dedicated investigation in future studies. The relative contributions of these parallel mechanisms, and the extent to which Rab8a‐dependent EV biogenesis in non‐cardiomyocyte cell types contributes to the in vivo cardioprotective phenotype, remain important open questions. Finally, the relevance of our findings to human myocardial IR injury remains to be established, and further studies in large animal models and human tissues are warranted.

In summary, our findings highlight ALY688 as a potent adiponectin receptor agonist capable of mitigating IR injury through multiple mechanisms. We demonstrated that ALY688 protects against myocardial damage in vivo, reduces oxidative stress and apoptosis in vitro, and modulates EV biogenesis and cargo composition. Importantly, we identified Rab8a‐mediated EV regulation as a key contributor to ALY688's cardioprotective effects, pinpointing EV as crucial mediators in its therapeutic potential. These insights provide a foundation for the development of novel EV‐targeted therapies for myocardial IR injury and support further investigation of ALY688 in clinical settings.

Author Contributions

Lina Antounians: investigation, methodology. Christoph H. Borchers: supervision, resources. Dylan Burger: conceptualization, methodology, writing – review and editing, resources. Ren‐Ke Li: supervision, conceptualization, methodology. Yubin Lei: investigation, methodology, writing – review and editing. Khang Nguyen: investigation, methodology. Vincent Richard: investigation, methodology, validation, visualization. Gary Sweeney: conceptualization, funding acquisition, writing – review and editing, validation, methodology, supervision, resources, project administration. Hye Kyoung Sung: supervision, project administration, methodology, conceptualization, writing – review and editing, investigation. Jialing Tang: conceptualization, investigation, writing – original draft, writing – review and editing, visualization, methodology, formal analysis. Eddie Tam: methodology, investigation. Jun Wu: investigation, methodology. Augusto Zani: resources, supervision, methodology, conceptualization.

Ethics Statement

Animal study is approved by Toronto General Hospital in accordance with the guidelines of the Canadian Council on Animal Care.

Conflicts of Interest

Gary Sweeney and Ren‐Ke Li have acted as consultants for Allysta Pharmaceuticals Inc. All other authors have no conflict of interest with this study to declare.

Supporting information

Supporting Information: jev270357‐sup‐0001‐Tables.docx

Supporting Information: jev270357‐sup‐0002‐Figures.docx

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.