Skip to main content
NCBI home page
Wiley Open Access Collection logoLink to Wiley Open Access Collection
. 2026 Aug 31;87(6):e70373. doi: 10.1002/ddr.70373

Dauriporphine Suppresses Cell Proliferation, Metastasis, and Stemness of Non‐Small Cell Lung Cancer Through the Regulation of the USP7/CASK

Pengxiao Hou 1, Qian Wu 1,✉
PMCID: PMC13527751  PMID: 42670798

ABSTRACT

Dauriporphine is a monomer extracted from Menispermum dauricum DC, and it exhibits anti‐cancer effect in non‐small cell lung cancer (NSCLC). The regulatory mechanism of dauriporphine remains incompletely understood, and this study focused on its molecular targets in NSCLC progression. Cell viability, proliferation, apoptosis, invasion, migration, and stemness were evaluated using cell counting kit‐8, ethynyl‐2′‐deoxyuridine assay, flow cytometry, transwell assay, scratch assay, and sphere formation assay, respectively. Bioinformatics analysis and weighted gene co‐expression network analysis (WGCNA) were performed to identify targets of dauriporphine in NSCLC. The mRNA and protein expression was quantified using qPCR and Western blot. Co‐immunoprecipitation was used to analyze protein interaction and ubiquitination regulation between ubiquitin‐specific protease 7 (USP7) and calcium/calmodulin‐dependent serine protein kinase (CASK). The role of dauriporphine in vivo was explored using xenograft tumor model. Dauriporphine restrained proliferation, invasion, migration, and stemness of NSCLC cells (p < 0.05). Bioinformatics analysis and WGCNA identified CASK as a core target of dauriporphine in NSCLC. CASK was highly up‐regulated in NSCLC samples and cells (p < 0.05). Anti‐cancer effects of dauriporphine on NSCLC cells were associated with reduced CASK expression (p < 0.05). USP7 stabilized CASK protein by inducing deubiquitination (p < 0.05). Silencing USP7 restrained NSCLC cell proliferation, metastasis, and stemness by inhibiting CASK (p < 0.05). Dauriporphine interacted with USP7, and then USP7 overexpression reversed the inhibition of dauriporphine in NSCLC cell malignant behaviors (p < 0.05). Dauriporphine reduced tumor growth in vivo and down‐regulated USP7 and CASK expression (p < 0.05). This study suggested that dauriporphine blocked the key malignant phenotypes of NSCLC cells via inhibiting USP7‐mediated deubiquitination of CASK, thereby promoting its proteasomal degradation. The study elucidates a molecular mechanism underlying anti‐tumor role of dauriporphine and providing potential targets for dauriporphine treatment.

Keywords: calcium/calmodulin‐dependent serine protein kinase, dauriporphine, non‐small cell lung cancer, ubiquitin‐specific protease 7

1. Introduction

Non‐small cell lung cancer (NSCLC), which accounts for the majority of lung cancer cases, is tightly related to cancer‐induced deaths globally (Hendriks et al. 2024). Various factors can increase the risk of NSCLC, mainly including smoking, second‐hand smoke, alcohol use, carcinogenic chemicals, family history, and pulmonary fibrosis (Alduais et al. 2023). Apart from traditional treatments (surgery, radiotherapy, and chemotherapy), immunotherapy and targeted therapy have achieved significant improvements in recent years (Alduais et al. 2023; Su et al. 2025). However, NSCLC patients still suffer from metastasis and recurrence, especially those with advanced‐stage disease (Kandemir and Demir 2024). Precision medicine has become the evolving NSCLC treatment paradigm, aiming to prolong survival and enhance quality of life via identification of new drugs and novel targets (Jeon et al. 2025; Satyam et al. 2025). Hence, exploring effective therapeutic agents and investigating useful molecular targets still hold great significance for improving clinical management of NSCLC (Wang et al. 2025a).

Traditional Chinese medicine (TCM) increasingly exhibit significant efficacy in the prevention and treatment of NSCLC (Kong et al. 2023; Wang et al. 2025b), and enhances postoperative recovery (Gu et al. 2025). Menispermum dauricum DC is a common TCM and its extractive has been reported to possess anti‐tumor activity (Liu et al. 2024b; Yang et al. 2024). Dauriporphine, an alkaloid extracted from M. dauricum DC, shows inhibitory effects on cell metastasis and growth in lung adenocarcinoma, a subgroup of NSCLC (Du et al. 2025). However, the mechanism of anti‐cancer effect of dauriporphine on NSCLC still requires further investigation.

Ubiquitination is an important posttranslational modification of proteins, and dysregulation of ubiquitin ligases and deubiquitinases represents a common feature in a variety of cancers (Han et al. 2022; Liu et al. 2024a; Zou et al. 2025). Ubiquitination regulation has been reported to be involved in the pharmacological activities of TCM extracts (Liu et al. 2020; Zhou et al. 2023). For instance, anomanolide C impedes metastasis and progression of triple‐negative breast cancer via inducing ubiquitination of glutathione peroxidase 4 (GPX4) (Chen et al. 2023). Ubiquitin‐specific protease 7 (USP7) is a well‐known deubiquitinase, with abnormal overexpression in various cancers (Saha et al. 2023). USP7 has been demonstrated to promote NSCLC malignant development by deubiquitinating and stabilizing the downstream target proteins (Huang et al. 2024; Jiang et al. 2026). Calcium/calmodulin‐dependent serine protein kinase (CASK) is found as an oncogene promoting malignant progression of multiple cancers, such as prostate cancer (Rathore et al. 2025) and pancreatic cancer (Qu et al. 2021). Nevertheless, the function of CASK in NSCLC has not been reported. Moreover, it remains to be explored whether USP7 can mediate protein stability of CASK, as well as their implications in the anti‐tumor effect of dauriporphine against NSCLC.

This study hypothesized that USP7 can induce deubiquitination of CASK and dauriporphine can inhibit NSCLC progression via targeting USP7/CASK axis based on bioinformatic analysis and prediction, with the purpose of uncovering the mechanism underpinning anti‐cancer role of dauriporphine and identifying molecular targets to improve NSCLC treatment.

2. Materials and Methods

2.1. Clinical Specimens

A total of 36 NSCLC patients at Shanxi Province Cancer Hospital/Shanxi Hospital Affiliated to Cancer Hospital, Chinese Academy of Medical Sciences/Cancer Hospital Affiliated to Shanxi Medical University participated in this study. Inclusion criteria: (1) patients were firstly diagnosed with NSCLC and underwent surgical treatment; (2) NSCLC was confirmed by postoperative pathology; (3) patients had complete clinical and follow‐up information. Those patients who received other therapies (such as chemotherapy and radiotherapy) before surgery, as well as those with other primary malignant tumors or incomplete clinical data, were excluded from this study. Tumor specimens (n = 36) and non‐tumor normal controls (n = 36) were acquired during the surgery, then saved at −80°C. This study followed the Declaration of Helsinki, based on the acquisition of informed consent from patients and the approval by the Ethical Committee of Shanxi Province Cancer Hospital/Shanxi Hospital Affiliated to Cancer Hospital, Chinese Academy of Medical Sciences/Cancer Hospital Affiliated to Shanxi Medical University.

2.2. Cell Culture, Treatment, and Transfection

NSCLC cells (Calu‐6, A549, and H1299) were commercially purchased from Procell (Wuhan, China), and human bronchial epithelial cell line 16HBE was purchased from EK‐Bioscience (Shanghai, China). 16HBE and H1299 were incubated with complete medium (Procell) consisted of Roswell Park Memorial Institute (RPMI)−1640, 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin (P/S). Calu‐6 and A549 cells were maintained in Minimum Essential Medium (MEM, Procell) and F‐12K medium (Procell), respectively, complemented with 10% FBS and 1% P/S. All cells were cultivated in the humid incubator containing 5% CO2 at 37°C.

A549 and H1299 cells were exposed to dauriporphine (Beyotime, Shanghai, China) at different doses (0, 5, 10, and 20 µM). Overexpression plasmid for CASK/USP7 (OE‐CASK and OE‐USP7), small interfering RNAs (siRNAs) for USP7 (si‐USP7) and CASK (si‐CASK), and the negative controls (OE‐NC and si‐NC) were bought from Beyotime. These plasmids and RNAs were transfected into A549 and H1299 cells via Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA), as per the user's manuals.

2.3. Cell Counting Kit‐8 (CCK‐8) Assay

To determine cell viability, A549 and H1299 cells of the 96‐well plates were incubated with 10 µL/well CCK‐8 solution (Dojindo Molecular Technologies, Kumamoto, Japan) under the normal growth environment for 2 h. Finally, absorbance of each well was recorded at 450 nm through the microplate reader.

2.4. Ethynyl‐2′‐Deoxyuridine (EdU) Assay

1 × 104 cells were planted into the 96‐well plates followed by indicated treatment, then detected via EdU Cell Proliferation Assay Kit (Solarbio, Beijing, China). EdU labeling, cell fixation and permeation, and staining reaction were performed according to the manufacturer's specification. Then, DNA staining was administrated with 4′,6‐diamidino‐2‐phenylindole (DAPI) solution (Solarbio), and fluorescence was examined through an fluorescence microscope (Olympus, Tokyo, Japan). Cells with completely overlapping signals of EdU and DAPI were recorded as EdU positive cells.

2.5. Flow Cytometry

Annexin V‐FITC Apoptosis Detection Kit (Solarbio) was utilized to examine cell apoptosis. Cells were resuspended with 1× Binding Buffer, added with 5 µL Annexin V‐FITC and 5 µL propidium iodide (PI), then analyzed using the flow cytometer (BD Biosciences, San Diego, CA, USA). The percentage of Annexin V+/PI− and Annexin V+/PI+ cells in total cells was calculated and expressed as the apoptosis rate (%).

2.6. Transwell Assay

Cell invasion was detected using transwell chamber (Corning Inc. Corning, NY, USA). The chamber coated with 50 μL Matrigel (Corning Inc.) was placed into the 24‐well plate, to form a device containing the top and bottom chambers. Then, 2 × 105 cells in serum‐free medium were inoculated into the top chamber and 600 μL serum‐containing medium was added into the bottom chamber. The uninvasive cells on the upper membrane were gently wiped off after 24 h. The invasive cells were counted under the random five microscopic fields using the inverted microscope (Olympus), following fixation with 4% paraformaldehyde (Solarbio) and staining with 0.1% crystal violet (Solarbio).

2.7. Scratch Assay

For migration detection, A549 and H1299 cells were cultured to 70% confluence, then two vertical scratches were created using a 200‐μL sterile pipette tip. Then cells were incubated with serum‐free medium for 24 h. Scratch width at 0 and 24 h were observed by an inverted microscope (Olympus). Migration distance = scratch widthat 0 h − scratch widthat 24 h.

2.8. Sphere Formation Assay

Cell stemness was assessed using sphere formation assay. Briefly, cells were digested into single‐cell suspensions, and then resuspended in sphere formation medium containing serum‐free DMEM/F12 medium (Gibco, Carlsbad, CA, USA), 1× B‐27 supplement (Gibco), 20 ng/mL epidermal growth factor (EGF; Gibco), 10 ng/mL basic fibroblast growth factor (bFGF; Gibco) and 20 ng/mL insulin‐like growth factor (IGF; Sigma, St. Louis, MO, USA). Subsequently, cells were seeded into 6‐well ultra‐low attachment microplate (Corning Inc.) and cultured at 37°C for 10–14 d. Sphere formation efficiency = tumor spheres (diameter ≥ 50 μm)/total cells × 100%.

2.9. Bioinformatics Analysis

GSE21933 and GSE29249 datasets were downloaded from Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi). GSE21933 contains NSCLC samples (n = 21) and normal paracancerous samples (n = 21). GSE29249 contains NSCLC tissues (n = 6) and normal paracancerous tissues (n = 6). Analysis of differentially expressed genes (DEGs) was conducted by “limma” package in R software, and screened based on false discovery rate < 0.05, and fold change > 2. Target genes of dauriporphine were predicted using SwissTargetPrediction (http://swisstargetprediction.ch/). Intersection analysis was performed using Venn diagram.

2.10. Weighted Gene Co‐Expression Network Analysis (WGCNA)

WGCNA on GSE21933 was performed to identify the functional modules significantly associated with NSCLC. After preprocessing (log2 transformation, normalization, and filtration), 6000 genes in 42 samples were analyzed. The scale‐free topological fitting index (R 2) and average connectivity were evaluated under different soft threshold powers (β). The unsigned adjacency matrix was constructed based on the scale‐free characteristics (R 2 = 0.801, β = 9), and transformed into a topological overlap matrix (TOM). Then, hierarchical clustering analysis was carried out using TOM dissimilarity, and co‐expression modules were identified using the dynamic shear tree algorithm. The key parameters were listed as below: minModuleSize = 30, deepSplit = 2, pamStage = TRUE, and mergeCutHeight = 0.25. The module genes were obtained and the Module Eigengene (ME) in each module was calculated. The modules with p < 0.05 and correlation coefficient > 0.3 were defined as significantly correlated modules. The hub genes (MM/kME > 0.8, gene significance > 0.2) in the key modules were further screened for subsequent analysis.

2.11. Database Prediction

TCGA (https://www.cancer.gov/ccg/research/genome-sequencing/tcga), TNMPlot (https://tnmplot.com/analysis/) and TIMER (https://cistrome.shinyapps.io/timer/) were used for expression prediction of CASK in NSCLC. Ubibrowser (http://ubibrowser.bio-it.cn/ubibrowser/) was employed to predict binding between USP7 and CASK.

2.12. The Quantitative Polymerase Chain Reaction (qPCR)

Total RNA was extracted using Trizol (Invitrogen), and reverse transcription was performed to transcribe RNA into cDNA via First Strand cDNA Synthesis Kit (Beyotime). CASK mRNA was quantified through SYBR Green qPCR Mix (Beyotime), with cDNA as the template. The primer sequences of CASK were listed in Table 1, and glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) was utilized as an endogenous gene.

Table 1.

Primer sequences used for qPCR.

Name Primer sequences (5′−3′)
CASK Forward TCTCCGAAGACCCTACCTCC
Reverse TGCAGTCTGTAAGCGCATGA
GAPDH Forward AATGGGCAGCCGTTAGGAAA
Reverse GCGCCCAATACGACCAAATC
Open in a new tab

2.13. Western Blot

Radio‐immunoprecipitation assay (RIPA) Lysis Buffer (Beyotime) were added to tissues and cells, then the obtained total proteins were utilized for sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS‐PAGE). Next, proteins were moved from gels to polyvinylidene fluoride membranes (Beyotime), followed by blockage of non‐specific antibody binding using Blocking Buffer (Beyotime). The primary antibodies against USP7 (Proteintech, Wuhan, China, 26948‐1‐AP, 1:1000) and CASK (Proteintech, 55277‐1‐AP, 1:2000) were incubated to the membranes overnight at 4°C. GAPDH (Proteintech, 10494‐1‐AP, 1:5000) served as an internal control. After incubation with the goat‐rabbit secondary antibody (Proteintech, RGAR001, 1:5000), blots were observed using Enhanced Chemiluminescence Detection Kit (Proteintech). Grey analysis was performed via ImageJ software.

2.14. Protein Stability Assays

After si‐USP7 transfection, A549 and H1299 cells were added with 20 μM MG132 (Beyotime) for 3 h, then CASK protein level was measured using Western blot. In addition, cells were exposed to 100 μM cycloheximide (CHX, Sigma) and protein expression of CASK was detected at indicated time points (0, 5, 10, and 15 h) using Western blot.

2.15. Co‐Immunoprecipitation (Co‐IP) Assay

A549 and H1299 cells were lysed to obtain the supernatant. The USP7 antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA, sc‐376912) and CASK antibody (Santa Cruz Biotechnology, sc‐13158) were conjugated with Protein G Magnetic Beads (Beyotime), and IgG served the negative control. Cell samples were incubated with antibody‐bead complex at 4°C overnight, then beads were washed and protein levels (USP7 and CASK) were measured by Western blot. Cell supernatant before antibody‐bead incubation were taken as the positive control (Input).

2.16. Ubiquitination Assay

A549 cells were transfected with si‐NC/si‐USP7 and WT‐Ub/K48‐Ub/K63‐Ub, then cell lysates were incubated with Protein G Magnetic Beads (Beyotime) pre‐coated with CASK antibody (Santa Cruz Biotechnology, sc‐13158). After beads were eluted, the ubiquitinated CASK level was examined through Western blot using Ub antibody.

2.17. Molecular Docking

The 3D structures of dauriporphine and USP7 were acquired from PubChem database (https://pubchem.ncbi.nlm.nih.gov/) and RCSB (https://www.rcsb.org/), respectively. Molecular docking between dauriporphine and USP7 was implemented using CB‐DOCK2 (http://183.56.231.194:8001/cb-dock2/index.php).

2.18. Cellular Thermal Shift Assay (CETSA)

The assay was performed using cell lysates. A549 cells were cultivated in 10‐cm dishes for a duration of 12 h. Following harvest, the cells underwent a PBS wash and were subsequently resuspended in PBS containing a full protease inhibitor cocktail. To remove cell debris, the lysates underwent centrifugation at 20,000 g for 20 min at 4°C. The resulting supernatant was split into two equal parts: one part received DMSO treatment, while the other was combined with dauriporphine (20 μM). Following a 30 min incubation period at room temperature, these lysates were further partitioned into smaller aliquots and heated at specific temperatures for 3 min. Finally, the supernatants were collected into new microtubes to prepare for SDS‐PAGE and western blot analysis.

2.19. Tumor Xenograft Model

Six‐week‐old male nude mice (SPF Biotech, Beijing, China) weighed 18–22 g were bred in the standard environment (22 ~ 24°C, 50 ± 10% humidity, and a 12‐h cycle of light/dark). In addition, mice were cared for in accordance with the relevant guidelines and regulations of Care and Use of Laboratory Animals of the National Institutes of Health (NIH). This animal research was authorized by the Animal Ethics Committee of Shanxi Province Cancer Hospital/Shanxi Hospital Affiliated to Cancer Hospital, Chinese Academy of Medical Sciences/Cancer Hospital Affiliated to Shanxi Medical University. According to random number table, mice were randomly divided into two groups (control and dauriporphine, n = 5 per group). A total of 5 × 106 A549 cells were subcutaneously injected into the nude mice, and mice in the dauriporphine group were intraperitoneally injected with 50 mg/kg dauriporphine every other day from the 8th day. Then, tumor length (a) and width (b) were measured for calculation of tumor volume (a × b 2 × 0.5). After 28 d, mice were euthanized by displacing the 30% air of cage each minute. Then tumors were dissected from mice and weighed on an electronic scale. USP7 and CASK protein levels in tumors were detected using Western blot. In addition, tissues were utilized for hematoxylin and eosin (HE) staining and immunohistochemistry (IHC) analysis of Ki67.

2.20. Statistical Analysis

Data obtained from three independently biological replicates were displayed as mean ± standard deviation (SD). GraphPad Prism 11.0 was employed for statistical analysis. All data conformed to a normal distribution through the Shapiro‐Wilk test, and Levene's test was utilized to evaluate the homogeneity of variances. Group's difference was compared utilizing Student's t‐test (two groups) and one‐way analysis of variance (ANOVA) with Tukey's post‐hoc test (multiple groups). Statistically, p < 0.05 was recognized as significant.

3. Results

3.1. Dauriporphine Inhibited NSCLC Cell Proliferation, Metastasis, and Stemness

Firstly, the functional exploration of dauriporphine in NSCLC was performed using A549 and H1299 cells. CCK‐8 assay showed that cell viability was reduced after dauriporphine treatment at 5, 10, and 20 μM groups in A549 and H1299 cells, when compared to 0 μM group (Figure 1A). The effects of 10 and 20 μM dauriporphine were more significant than 5 μM dauriporphine. However, 16HBE cell viability was not affected after dauriporphine treatment at 5, 10, and 20 μM (Figure S1). Results from EdU assay and flow cytometry demonstrated that proliferation ability (Figure 1B) was inhibited and apoptosis rate was increased (Figure 1C) by 10 or 20 μM dauriporphine. Regarding cell metastasis, transwell assay and scratch assay indicated the inhibitory influences of 10 or 20 μM dauriporphine on invasive cells (Figure 1D) and migration distance (Figure 1E). Sphere formation efficiency was decreased following 10 or 20 μM dauriporphine treatment (Figure 1F,G), suggesting the inhibited cell stemness.

Figure 1.

Figure 1

Open in a new tab

Dauriporphine inhibited NSCLC cell proliferation, metastasis, and stemness. (A) Cell viability was detected using CCK‐8 assay after A549 and H1299 cells were treated with 0, 5, 10, and 20 μM dauriporphine (n = 3). (B–G) A549 and H1299 cells were treated with 0, 10, and 20 μM dauriporphine. (B) Cell proliferation was evaluated using EdU assay, scale bar = 50 μm (n = 3). (C) Apoptosis rate was examined using flow cytometry (n = 3). (D) Invasive cells were examined using transwell assay, scale bar = 50 μm (n = 3). (E) Cell migration was assessed using scratch assay, scale bar = 100 μm (n = 3). (F, G) Cell stemness was evaluated using sphere formation assay, scale bar = 50 μm (n = 3).

3.2. Bioinformatics Analysis Showed the Targets of Dauriporphine in NSCLC

To explore the targets associated with NSCLC, bioinformatics datasets GSE21933 and GSE29249 were analyzed. A total of 2996 DEGs were screened from GSE21933, including 1425 up‐regulated genes and 1571 down‐regulated genes. The volcano plot of all DEGs and the heatmap of the top 30 up/down‐regulated DEGs were indicated in Figure 2A. For GSE29249, 2464 DEGs (up‐regulated: 1018, down‐regulated: 1446) were identified, as illustrated by the volcano plot of all DEGs and heatmap of the top 30 up/down‐regulated DEGs (Figure 2B). SwissTargetPrediction predicted 100 targets for dauriporphine. Venn diagram indicated that 6 intersecting genes were generated among GSE21933, GSE29249, and SwissTargetPrediction (Figure 2C).

Figure 2.

Figure 2

Open in a new tab

Bioinformatics analysis showed the targets of dauriporphine in NSCLC. (A) Volcano plot of all DEGs and heatmap of the top 30 up/down‐regulated DEGs from GSE21933 dataset. (B) Volcano plot of all DEGs and heatmap of the top 30 up/down‐regulated DEGs from GSE29249 dataset. (C) Venn diagram of intersection genes among GSE21933, GSE29249, and SwissTargetPrediction.

3.3. WGCNA Further Identified CASK as a Core Gene

Then, WGCNA was performed to screen key modules and genes in GSE21933 dataset. The unsigned adjacency matrix was constructed based on β = 9 (R 2 = 0.801 and mean connectivity = 160.7) (Figure 3A). The gene system clustering dendrogram and corresponding modules were drawn based on TOM (Figure 3B). Brown module was identified as a significant module related to tumor, according to module‐trait relationship heatmap (Figure 3C). Hub genes (201) in brown module was further intersected with the above 6 intersection genes, finally identifying CASK as a core gene (Figure 3D).

Figure 3.

Figure 3

Open in a new tab

WGCNA further identified CASK as a core gene. (A) Dcale‐free topological fitting index (R 2) and network connectivity under soft threshold powers (β) = 9 were analyzed. (B) Cluster dendrogram was graphed based on TOM. (C) Heatmap showed the module‐trait relationships. (D) Venn diagram obtained the core gene between 6 intersection genes and brown module‐related genes in WGCNA.

3.4. CASK Was Significantly Up‐regulated in NSCLC

Online databases predicted the high expression of CASK in NSCLC, according to TCGA (Figure 4A), TNMPlot (Figure 4B), and TIMER (Figure 4C). GSE21933 dataset also showed the mRNA upregulation of CASK in NSCLC samples (Figure 4D). A total of 36 paired tissues were collected from NSCLC patients for CASK expression detection. Relative to normal tissues, CASK mRNA and protein levels were highly increased in tumor tissues (Figure 4E,F). In addition, CASK protein was obviously elevated in three NSCLC cell lines (Calu‐6, A549, and H1299) compared with normal 16HBE cells (Figure 4G).

Figure 4.

Figure 4

Open in a new tab

CASK was significantly up‐regulated in NSCLC. (A–C) The expression of CASK in NSCLC was predicted by TCGA (A), TNMPlot (B), and TIMER (C). (D) GSE21933 dataset showed the CASK mRNA expression in NSCLC. (E) CASK mRNA expression was quantified by qPCR in NSCLC samples (n = 36). (F) CASK protein was measured using Western blot in NSCLC samples (n = 6). (G) CASK protein detection was performed using Western blot in NSCLC cells (n = 3).

3.5. Dauriporphine Reduced CASK Expression to Block NSCLC Progression

The effect of dauriporphine (20 μM) on CASK was evaluated in A549 and H1299 cells. As presented in Figure 5A, dauriporphine significantly reduced CASK protein expression and OE‐CASK transfection exhibited effective overexpression of CASK protein in dauriporphine‐treated cells. After CASK was overexpressed, dauriporphine‐induced suppressive impacts on cell viability (Figure 5B) and proliferation (Figure 5C), and promoting influence on cell apoptosis (Figure 5D) were markedly abolished. Meanwhile, invasive cells were increased (Figure 5E,F), migration ability was promoted (Figure 5G), and cell stemness was enhanced (Figure 5H) after CASK overexpression under the administration of dauriporphine. Further, the study transfected si‐CASK and si‐NC into A549 and H1299 cells to determine the effects on the key malignant phenotypes of cells. The efficiency of CASK knockdown is shown in Figure S2A. As shown in Figure S2B–H, CASK silencing inhibited cell viability, proliferation, invasion, migration and cell stemness and induced cell apoptosis.

Figure 5.

Figure 5

Open in a new tab

Dauriporphine reduced CASK expression to block NSCLC progression. (A–H) A549 and H1299 cells were treated with 20 μM dauriporphine, with or without OE‐NC/OE‐CASK transfection. (A) Western blot revealed CASK protein level (n = 3). (B) CCK‐8 assay revealed cell viability (n = 3). (C) EdU assay revealed cell proliferation ability (n = 3). (D) Flow cytometry revealed cell apoptosis rate (n = 3). (E, F) Transwell assay revealed cell invasion, scale bar = 50 μm (n = 3). (G) Scratch assay revealed cell migration capacity (n = 3). (H) Sphere formation assay revealed cell stemness (n = 3).

3.6. USP7 Removed Ubiquitination to Stabilize CASK Protein

Dauriporphine did not affect mRNA expression of CASK in A549 and H1299 cells (Figure 6A). Ubibrowser prediction found the possible modification of deubiquitin‐related enzyme USP7 for CASK (Figure 6B). Western blot revealed that USP7 protein expression was inhibited by dauriporphine in A549 and H1299 cells (Figure 6C). USP7 protein was significantly knocked down by si‐USP7 transfection, compared with si‐NC transfection (Figure 6D). Knockdown of USP7 was observed to inhibit CASK protein level, which this regulation was reversed by proteasome inhibitor MG132 (Figure 6E). Moreover, treatment of protein synthesis inhibitor CHX suggested that silencing USP7 suppressed CASK protein stability in A549 and H1299 cells (Figure 6F,G). Co‐IP confirmed the protein interaction between USP7 and CASK in A549 and H1299 cells (Figure 6H), and USP7 knockdown promoted ubiquitination of CASK via K48 ubiquitin chain in A549 cells (Figure 6I).

Figure 6.

Figure 6

Open in a new tab

USP7 removed ubiquitination to stabilize CASK protein. (A) The effect of 20 μM dauriporphine on CASK mRNA was evaluated by qPCR (n = 3). (B) Ubibrowser database predicted the binding between USP7 and CASK. (C) USP7 protein expression was measured after 20 μM dauriporphine treatment (n = 3). (D) Silencing effect of si‐USP7 was assessed using Western blot (n = 3). (E) CASK protein level was examined by Western blot after A549 and H1299 cells were transfected with si‐NC/si‐USP7 and treated with proteasome inhibitor MG132 (n = 3). (F, G) CASK protein stability was evaluated by CHX treatment in USP7‐silenced cells (n = 3). (H) Co‐IP was performed to analyze protein interaction between USP7 and CASK (n = 3). (I) Ubiquitination assay was performed to assess the ubiquitinated effect of si‐USP7 on CASK in A549 cells (n = 3).

3.7. USP7/CASK Axis Facilitated NSCLC Cell Proliferation, Metastasis, and Stemness

The interaction between USP7 and CASK was further validated in NSCLC progression. Cell viability (Figure 7A) and proliferation (Figure 7B) were suppressed, and apoptosis was accelerated (Figure 7C,D) in USP7‐silenced A549 and H1299 cells, while manipulative upregulation of CASK counteracted these influences. Cell invasion (Figure 7E), migratory potential (Figure 7F), and sphere formation efficiency (Figure 7G) were conspicuously promoted by transfection of si‐USP7 + OE‐CASK, contrasted to alone transfection of si‐USP7, indicating that USP7 contributed to metastasis and stemness via increasing CASK.

Figure 7.

Figure 7

Open in a new tab

USP7/CASK axis facilitated NSCLC cell proliferation, metastasis, and stemness. A549 and H1299 cells were transfected with si‐NC, si‐USP7, si‐USP7 + OE‐NC, and si‐USP7 + OE‐CASK. (A) CCK‐8 was performed for detection of cell viability (n = 3). (B) EdU assay was performed for detection of proliferation (n = 3). (C, D) Flow cytometry was performed for examination of apoptosis rate (n = 3). (E) Transwell assay was performed for examination of invasive cells, scale bar = 50 μm (n = 3). (F) Scratch assay was performed for examination of migration distance (n = 3). (G) Sphere formation assay was performed for detection of cell stemness (n = 3).

3.8. Dauriporphine Impeded NSCLC Cell Malignant Development by Inhibiting USP7

Increased USP7 protein expression in OE‐USP7 group relative to OE‐NC group validated the successful overexpression of USP7 in A549 and H1299 cells (Figure 8A). As the results of USP7 overexpression, cell viability was increased (Figure 8B), cell proliferation was promoted (Figure 8C), and apoptosis was inhibited (Figure 8D) in dauriporphine‐treated A549 and H1299 cells. Additionally, the inhibiting regulation of dauriporphine in invasion (Figure 8E,F), migration (Figure 8G), and cell stemness (Figure 8H) was abrogated following expression increase in USP7. More importantly, molecular docking indicated the binding between dauriporphine and USP7 protein, with a binding affinity of −9.4 kcal/mol (Figure S3A). Moreover, dauriporphine treatment significantly increased the thermal stability of USP7 (Figure S3B).

Figure 8.

Figure 8

Open in a new tab

Dauriporphine impeded NSCLC cell malignant development by inhibiting USP7. (A) USP7 protein expression was measured by Western blot after OE‐NC/OE‐USP7 transfection in A549 and H1299 cells (n = 3). (B–H) A549 and H1299 cells were treated with 20 μM dauriporphine, with or without OE‐NC/OE‐USP7 transfection. (B) Cell viability detection was carried out by CCK‐8 assay (n = 3). (C) Cell proliferation assessment was carried out by EdU assay (n = 3). (D) Cell apoptosis detection was carried out by flow cytometry (n = 3). (E, F) Cell invasion examination was conducted by transwell assay, scale bar = 50 μm (n = 3). (G) Cell migration detection was conducted by scratch assay (n = 3). (H) Cell stemness was evaluated by sphere formation assay.

3.9. Dauriporphine Reduced Tumor Growth and Inhibited USP7 and CASK Expression In Vivo

Tumor xenograft model showed that tumor volume and weight in mice were significantly reduced by dauriporphine administration (Figure 9A,B). The isolated tissues were used for expression detection, and Western blot demonstrated the down‐regulated USP7 and CASK protein levels in dauriporphine group compared with the control group (Figure 9C,D). HE staining revealed the decreased cell density and inhibited morphological damage following dauriporphine treatment, confirming the anti‐tumor effect of dauriporphine. IHC also indicated that Ki67‐positive cells were reduced in dauriporphine group, relative to untreated xenograft model (Figure 9E). Histological analysis further validated the inhibition of dauriporphine in NSCLC tumor growth in vivo.

Figure 9.

Figure 9

Open in a new tab

Dauriporphine reduced tumor growth and inhibited USP7 and CASK expression in vivo. Xenograft tumor models were established in nude mice, with n = 5 of control and dauriporphine groups. (A) Tumor volume was calculated (n = 5). (B) Tumor images were photographed and tumor weight was measured (n = 5). (C, D) USP7 and CASK protein levels in tumor tissues were examined by Western blot (n = 5). (E) HE staining and IHC‐Ki67 staining were performed in tumor tissues (n = 5).

4. Discussion

By performing a series of experiments, the present research elucidated the tumor‐suppressive influence of dauriporphine on NSCLC cell progression in vitro and tumor growth in vivo, and revealed USP7/CASK axis as a specific molecular mechanism underlying the role of dauriporphine.

Various extracts from M. dauricum DC exhibit anti‐tumor activity. For example, N‐desmethyldauricine reduces proliferation and triggers cell cycle arrest in breast c, and daurisoline inhibits pancreatic cancer cell invasion and migration (Xu et al. 2025). Deng et al. reported that dauricine isolated from the root of M. dauricum DC blocks cell growth and enhance cell death of melanoma (Deng et al. 2021). Dauriporphine is primarily isolated from the rhizome of M. daericum DC. In addition, it has been previously identified as a key anti‐tumor active compound of Polygonatum sibiricum flower (Huang et al. 2020). Herein, functional experiments indicated that dauriporphine not only reduced NSCLC cell proliferation and induced apoptosis, but also hampered cell invasive and migratory potentials in vitro. The anti‐cancer activities of dauriporphine in NSCLC were consistent with its effects on lung cancer reported in a recent study (Du et al. 2025), as well as the other extracts from M. daericum DC in other cancer types. This common biological characteristic may result from the same plant origin. In addition to proliferation and metastasis, cell stemness is recognized as a pivotal component of cancer progression (Du et al. 2022; Loh and Ma 2024). Targeting cancer stem cells may provide opportunity for improving cancer therapy (Chu et al. 2024; Liang et al. 2025; Tsui et al. 2020), including in lung cancer (Liu et al. 2023). Trilobatin has the potential to inhibit stemness phenotype of gefitinib resistant lung cancer cells (Li et al. 2022), and triptolide restrains NSCLC cell stemness (Ren et al. 2024). Results from this study demonstrated that dauriporphine reduced sphere formation efficiency, disclosing its inhibition in NSCLC cell stemness. This result further supported the anti‐tumor regulation of dauriporphine in NSCLC.

To explore the molecular targets of dauriporphine in NSCLC, researchers combined bioinformatics analysis and WGCNA and finally identified CASK as the core target. Accumulating evidence has demonstrated the oncogenic function of CASK in several cancers. For instance, inhibiting the expression of CASK elicits apoptosis and arrest cell cycle progression in osteosarcoma (Yang et al. 2026). Also, silencing CASK restrains invasive and migratory potentials in prostate cancer cells (Rathore et al. 2025), and suppresses colony formation and invasion of pancreatic cancer cells (Qu et al. 2021). However, its function in NSCLC remains unclear. Database validation and tissue detection indicated that CASK was highly expressed in NSCLC. CASK silencing inhibited the key malignant phenotypes of NSCLC cells. More importantly, CASK overexpression partly abolished the anti‐tumor effects of dauriporphine on NSCLC cells, suggesting that CASK functioned as an oncogene and its inhibition was responsible for the role of dauriporphine. The tumor‐promoting regulation of CASK in NSCLC was in line with that in other cancers, possibly due to its aberrant upregulation in these cancer types.

Interestingly, CASK mRNA expression was not affected by dauriporphine, leading to a speculation that dauriporphine may regulate CASK via posttranslational modification. Online prediction showed the binding between USP7 and CASK, implying the ubiquitination regulation of USP7 on CASK. As predicted, USP7 was validated to induce deubiquitination and thus stabilize CASK protein in NSCLC cells. USP7 stabilizes kelch‐like ECH‐associated protein 1 (KEAP1) (Tang et al. 2026) and Ki‐67 (Zhang et al. 2016) in NSCLC. USP7‐mediated ERβ stabilization via deubiquitination elevates osimertinib resistance in NSCLC (Meng et al. 2024). Also, USP7 has been indicated to promote cell survival and glycolysis in NSCLC by acting as a deubiquitinase of c‐Abl (He et al. 2023). Consistently, USP7 knockdown was found to inhibit NSCLC cell proliferation and metastasis via inhibiting CASK, validating USP7/CASK axis in NSCLC progression. Regarding cancer stemness, USP7 can maintain stemness of p53‐mutant colorectal cancer cells through stabilization of mutant p53 (Li et al. 2024), and it promotes cell stemness in hepatocellular carcinoma via stabilization of basic transcription factor 3 (BTF3) (Hu et al. 2024). Herein, reduced sphere formation efficiency also suggested that USP7 enhanced NSCLC cell stemness and this effect was achieved by deubiquitination and stabilization of CASK.

Moreover, molecular docking revealed the direct binding of dauriporphine to USP7, and USP7 overexpression rescued the inhibitory effects of dauriporphine. Daurisoline, a bisbenzylisoquinoline alkaloid from M. dauricum DC, has been shown to block pancreatic cancer progression via preventing ubiquitination of peroxisome proliferator‐activated receptor alpha (PPARα) (Xu et al. 2025). The roles of TCM in NSCLC have also been found to be associated with USP7‐mediated protein deubiquitination. Yifei Sanjie Formula inhibits USP7 to enhance the ubiquitin‐mediated degradation of nuclear receptor subfamily 1 group H member 4 (NR1H4), ultimately suppressing lung cancer malignant behaviors (Ren et al. 2026). Avicularin accelerates cell apoptosis in NSCLC via promoting USP7‐mediated degradation of forkhead box protein M1 (FOXM1) (Du et al. 2026). Combining with the discovery of USP7/CASK axis and the functional rescue of USP7 or CASK for dauriporphine, this study concluded that dauriporphine functioned as a tumor inhibitor in the key malignant phenotypes of NSCLC cells by downregulating CASK through reducing USP7‐induced deubiquitination. Further animal research also validated the inhibiting regulation of dauriporphine in tumor growth in vivo. However, animal model only focused on the role of dauriporphine, which may limit the applicability of the current conclusion. Although the expression of USP7 and CASK was detected after dauriporphine treatment, whether USP7/CASK axis could reverse the function of dauriporphine in vivo remains further studies. It also should be noted that the current CETSA was performed using cell lysates, where endogenous cofactors or interacting proteins might indirectly influence USP7 thermal stability. Therefore, while these results suggest an interaction, future studies employing purified recombinant USP7‐based biophysical assays are warranted to definitively confirm the direct binding between dauriporphine and USP7.

In summary, dauriporphine was suggested to inhibit NSCLC cell proliferation, metastasis and stemness via interacting with USP7 and inhibiting USP7‐mediated deubiquitination of CASK, thereby promoting its proteasomal degradation. These findings may contribute to the understanding of anti‐tumor mechanism of dauriporphine in NSCLC. The application of USP7 and CASK as molecular targets for predicting the prognosis of patients with dauriporphine treatment still needs to be verified in future clinical studies.

Author Contributions

Pengxiao Hou designed and performed the research. Pengxiao Hou and Qian Wu analyzed the data. Pengxiao Hou wrote the manuscript. All authors read and approved the final manuscript.

Funding

The authors have nothing to report.

Ethics Statement

The study on clinical samples followed the Declaration of Helsinki, and approved by the Ethical Committee of Shanxi Province Cancer Hospital/Shanxi Hospital Affiliated to Cancer Hospital, Chinese Academy of Medical Sciences/Cancer Hospital Affiliated to Shanxi Medical University All patients provided informed consent to participate in this study. Animal study was approved by the Animal Ethics Committee of Shanxi Province Cancer Hospital/Shanxi Hospital Affiliated to Cancer Hospital, Chinese Academy of Medical Sciences/Cancer Hospital Affiliated to Shanxi Medical University and animals were cared for according to the relevant guidelines and regulations of Care and Use of Laboratory Animals of the National Institutes of Health (NIH).

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Figure S1: The effects of dauriporphine treatment on 16HBE cell viability. 16HBE cells were treated various concentrations of dauriporphine (0, 5, 10, and 20 μM), and cell viability was analyzed by CCK‐8 assay (n = 3).

DDR-87-e70373-s002.tif (117.2KB, tif)

Figure S2: CASK knockdown inhibited the key malignant phenotypes of NSCLC cells. (A‐H) A549 and H1299 cells were transfected with si‐CASK or si‐NC. (A) Western blot was used to detect CASK protein level (n = 3). (B) CCK‐8 assay revealed cell viability (n = 3). (C) EdU assay revealed cell proliferation ability (n = 3). (D and E) Flow cytometry revealed cell apoptosis rate (n = 3). (F) Transwell assay revealed cell invasion, scale bar = 50 μm (n = 3). (G) Scratch assay revealed cell migration capacity (n = 3). (H) Sphere formation assay revealed cell stemness (n = 3).

DDR-87-e70373-s003.tif (3.1MB, tif)

Figure S3: Analysis of the association of dauriporphine and USP7 by molecular docking and CETSA. (A) CB‐DOCK2 showed molecular docking result between dauriporphine and USP7. (B) CETSA was performed on A549 cell lysates at different temperatures (n = 3).

DDR-87-e70373-s001.tif (2.7MB, tif)

Data Availability Statement

The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.

References

  1. Alduais, Y. , Zhang H., Fan F., Chen J., and Chen B.. 2023. “Non‐Small Cell Lung Cancer (NSCLC): A Review of Risk Factors, Diagnosis, and Treatment.” Medicine 102, no. 8: e32899. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Chen, Y. M. , Xu W., Liu Y., et al. 2023. “Anomanolide C Suppresses Tumor Progression and Metastasis by Ubiquitinating GPX4‐driven Autophagy‐Dependent Ferroptosis in Triple Negative Breast Cancer.” International Journal of Biological Sciences 19, no. 8: 2531–2550. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Chu, X. , Tian W., Ning J., et al. 2024. “Cancer Stem Cells: Advances in Knowledge and Implications for Cancer Therapy.” Signal Transduction and Targeted Therapy 9, no. 1: 170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Deng, B. , Jiang X. L., Tan Z. B., et al. 2021. “Dauricine Inhibits Proliferation and Promotes Death of Melanoma Cells via Inhibition of Src/STAT3 Signaling.” Phytotherapy Research 35, no. 7: 3836–3847. [DOI] [PubMed] [Google Scholar]
  5. Du, J. , Yu K., Zeng J., et al. 2026. “Avicularin Induces Apoptosis in NSCLC by Promoting USP7‐mediated Degradation of FOXM1.” Naunyn‐Schmiedeberg's Archives of Pharmacology 399, no. 1: 1371–1380. [DOI] [PubMed] [Google Scholar]
  6. Du, L. , Cheng Q., Zheng H., Liu J., Liu L., and Chen Q.. 2022. “Targeting Stemness of Cancer Stem Cells to Fight Colorectal Cancers.” Seminars in Cancer Biology 82: 150–161. [DOI] [PubMed] [Google Scholar]
  7. Du, Y. J. , Lv J. P., Fu Y., et al. 2025. “Dauriporphine Inhibited Lung Cancer Cell Viability, Motility, and Energy Metabolism Through the miR‐424‐5p/MAPK14 Axis.” Hereditas 162, no. 1: 101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Gu, Y. , Wang Y., Zhou H., et al. 2025. “Efficacy of Chinese Medicine on Postoperative Rehabilitation of Non‐Small Cell Lung Cancer (NSCLC), a Randomized Controlled Study.” Integrative Cancer Therapies 24: 15347354251314529. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Han, S. , Wang R., Zhang Y., et al. 2022. “The Role of Ubiquitination and Deubiquitination in Tumor Invasion and Metastasis.” International Journal of Biological Sciences 18, no. 6: 2292–2303. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. He, Y. , Jiang S., Zhong Y., et al. 2023. “USP7 Promotes Non‐Small‐Cell Lung Cancer Cell Glycolysis and Survival by Stabilizing and Activating c‐Abl.” Clinical and Translational Medicine 13, no. 12: e1509. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Hendriks, L. E. L. , Remon J., Faivre‐Finn C., et al. 2024. “Non‐Small‐Cell Lung Cancer.” Nature Reviews Disease Primers 10, no. 1: 71. [DOI] [PubMed] [Google Scholar]
  12. Hu, M. , Dai C., Sun X., et al. 2024. “Ubiquitination‐Specific Protease 7 Enhances Stemness of Hepatocellular Carcinoma by Stabilizing Basic Transcription Factor 3.” Functional & Integrative Genomics 24, no. 1: 28. [DOI] [PubMed] [Google Scholar]
  13. Huang, B. , Cao D., Yuan X., et al. 2024. “USP7 Deubiquitinates KRAS and Promotes Non‐Small Cell Lung Cancer.” Cell Reports 43, no. 11: 114917. [DOI] [PubMed] [Google Scholar]
  14. Huang, Z. , Du X., Ma C., Zhang R., Gong W., and Liu F.. 2020. “Identification of Antitumor Active Constituents in Polygonatum sibiricum Flower by UPLC‐Q‐TOF‐MS(E) and Network Pharmacology.” ACS Omega 5, no. 46: 29755–29764. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Jeon, H. , Wang S., Song J., Gill H., and Cheng H.. 2025. “Update 2025: Management of Non‑Small‐Cell Lung Cancer.” Lung 203, no. 1: 53. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Jiang, S. , Rong L., Yi F., Yang P., and Yang L.. 2026. “USP7 Stabilizes MESP1 To Promote the Malignant Progression of Non‐Small Cell Lung Cancer.” Applied Biochemistry and Biotechnology 198, no. 4: 2623–2638. [DOI] [PubMed] [Google Scholar]
  17. Kandemir, O. , and Demir F.. 2024. “An Investigation of the Relationship Between 18F‐FDG PET/CT Parameters of Primary Tumors and Lymph Node Metastasis in Resectable Non‐Small Cell Lung Cancer.” Current Radiopharmaceuticals 17, no. 1: 111–116. [DOI] [PubMed] [Google Scholar]
  18. Kong, F. , Wang C., Zhao L., et al. 2023. “Traditional Chinese Medicines for Non‐Small Cell Lung Cancer: Therapies and Mechanisms.” Chinese Herbal Medicines 15, no. 4: 509–515. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Li, W. , Zihan X., Yizhe W., Yanyang L., Zhixi L., and Xi Y.. 2022. “Trilobatin Induces Apoptosis and Attenuates Stemness Phenotype of Acquired Gefitinib Resistant Lung Cancer Cells via Suppression of NF‐κB Pathway.” Nutrition and Cancer 74, no. 2: 735–746. [DOI] [PubMed] [Google Scholar]
  20. Li, X. , Pan J., and Zheng P.. 2024. “USP7 Regulates Growth and Maintains the Stemness of p53‐mutant Colorectal Cancer Cells via Stabilizing of Mutant p53.” Frontiers in Oncology 14: 1427663. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Liang, H. , Zhou B., Li P., et al. 2025. “Stemness Regulation in Prostate Cancer: Prostate Cancer Stem Cells and Targeted Therapy.” Annals of Medicine 57, no. 1: 2442067. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Liu, F. , Chen J., and Li K., et al. 2024a. “Ubiquitination and Deubiquitination in Cancer: From Mechanisms to Novel Therapeutic Approaches.” Molecular Cancer 23, no. 1: 148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Liu, M. , Wu H., and Xu C.. 2023. “Targeting Cancer Stem Cell Pathways for Lung Cancer Therapy.” Current Opinion in Oncology 35, no. 1: 78–85. [DOI] [PubMed] [Google Scholar]
  24. Liu, W. , Yu Y., and Hou T., et al. 2024b. “N‐Desmethyldauricine from Menispermum dauricum DC Suppresses Triple‐Negative Breast Cancer Growth in 2D and 3D Models by Downregulating the NF‐κB Signaling Pathway.” Chemico‐Biological Interactions 398: 111113. [DOI] [PubMed] [Google Scholar]
  25. Liu, Y. , Liu X., Zhang N., et al. 2020. “Berberine Diminishes Cancer Cell PD‐L1 Expression and Facilitates Antitumor Immunity via Inhibiting the Deubiquitination Activity of CSN5.” Acta Pharmaceutica Sinica B 10, no. 12: 2299–2312. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Loh, J. J. , and Ma S.. 2024. “Hallmarks of Cancer Stemness.” Cell Stem Cell 31, no. 5: 617–639. [DOI] [PubMed] [Google Scholar]
  27. Meng, Y. , Lin W., Wang N., et al. 2024. “USP7‐mediated ERbeta Stabilization Mitigates ROS Accumulation and Promotes Osimertinib Resistance by Suppressing PRDX3 SUMOylation in Non‐Small Cell Lung Carcinoma.” Cancer Letters 582: 216587. [DOI] [PubMed] [Google Scholar]
  28. Qu, J. , Zhou Y., Li Y., Yu J., and Wang W.. 2021. “CASK Regulates Notch Pathway and Functions as a Tumor Promoter in Pancreatic Cancer.” Archives of Biochemistry and Biophysics 701: 108789. [DOI] [PubMed] [Google Scholar]
  29. Rathore, V. , Cheng C. Y., Chen S. P., Lin C. Y., Chang C. R., and Lin W. W.. 2025. “CASK Promotes Prostate Cancer Progression via Kinase‐Dependent Activation of AKT.” International Journal of Biological Macromolecules 311, no. Pt 2: 143965. [DOI] [PubMed] [Google Scholar]
  30. Ren, J. , Zhao S., and Lai J.. 2024. “Triptolide Restrains the Growth, Invasion, Stemness, and Glycolysis of Non‐Small Cell Lung Cancer Cells by PFKFB2‐mediated PI3K/AKT Pathway.” Chemical Biology & Drug Design 103, no. 1: e14450. [DOI] [PubMed] [Google Scholar]
  31. Ren, Y. , Li Y., Fang C., Chen Z., and Xiao Z.. 2026. “Yifei Sanjie Formula in Improving the Response to PD‐1 Blockade by Lung Cancer Through the Attenuation of the USP7‐NR1H4‐bile Acid Metabolism Axis.” Journal of Thoracic Disease 18, no. 3: 243. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Saha, G. , Roy S., Basu M., and Ghosh M. K.. 2023. “USP7—A Crucial Regulator of Cancer Hallmarks.” Biochimica et Biophysica Acta (BBA)—Reviews on Cancer 1878, no. 3: 188903. [DOI] [PubMed] [Google Scholar]
  33. Satyam Kumar, A. , Sushmita Sunil J., and Madhunika A.. 2025. “Precision Medicine: Transforming Cancer Research Through Targeted Therapies.” Current Genomics 26, no. 6: 447–457. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Su, P. L. , Furuya N., Asrar A., et al. 2025. “Recent Advances in Therapeutic Strategies for Non‐Small Cell Lung Cancer.” Journal of Hematology & Oncology 18, no. 1: 35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Tang, J. , Xu L., Gong Z., and Chen L.. 2026. “USP7‐mediated Deubiquitination of the KEAP1‐NRF2‐HMOX1 Axis Enhances Radioresistance in Non‐Small Cell Lung Cancer by Suppressing Ferroptosis.” Oncogene 45: 2196–2210. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Tsui, Y. M. , Chan L. K., and Ng I. O. L.. 2020. “Cancer Stemness in Hepatocellular Carcinoma: Mechanisms and Translational Potential.” British Journal of Cancer 122, no. 10: 1428–1440. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Wang, L. , Zhou D., and Ou Y.. 2025a. “NSUN2/FOXM1 Positive Feedback Pathway Promotes the Malignant Development of Non‐Small Cell Lung Cancer.” Current Proteomics 22, no. 4: 100029. [Google Scholar]
  38. Wang, Z. , Zhong Z., and Yang W., et al. 2025b. “Traditional Chinese Medicines as Anticancer Agents for Non‐Small Cell Lung Cancer With EGFR Mutations: A Review.” Drug Design, Development and Therapy 19: 5169–5191. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Xu, D. , Zhu Y., Ye W., et al. 2025. “Daurisoline Inhibits Pancreatic Cancer Progression by Direct Binding to PPARα and Blocking Its Ubiquitination‐Mediated Degradation.” Phytomedicine 148: 157245. [DOI] [PubMed] [Google Scholar]
  40. Yang, H. , Zhong W., Shen D., and Chen S.. 2026. “Identification and Validation of the Potential Therapeutic Value of CASK in Osteosarcoma: A Computational Analysis and In Vitro Experiments.” Frontiers in Oncology 16: 1693570. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Yang, P. , Zhai Y., Liu Q., et al. 2024. “The Ameliorative Effect on Chemotherapy‐Induced Injury and Tumor Immunosuppressive Microenvironment of the Polysaccharide From the Rhizome of Menispermum dauricum DC.” International Journal of Biological Macromolecules 268, no. Pt 1: 131828. [DOI] [PubMed] [Google Scholar]
  42. Zhang, C. , Lu J., Zhang Q. W., et al. 2016. “USP7 Promotes Cell Proliferation Through the Stabilization of Ki‐67 Protein in Non‐Small Cell Lung Cancer Cells.” International Journal of Biochemistry & Cell Biology 79: 209–221. [DOI] [PubMed] [Google Scholar]
  43. Zhou, C. , Yu T., Zhu R., et al. 2023. “Timosaponin AIII Promotes Non‐Small‐Cell Lung Cancer Ferroptosis Through Targeting and Facilitating HSP90 Mediated GPX4 Ubiquitination and Degradation.” International Journal of Biological Sciences 19, no. 5: 1471–1489. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Zou, Y. , Guo Z., Rong R., Zhang H., and Han S.. 2025. “Exploration of Atractylenolide III Targeting MDM2/p53 Axis in Breast Cancer Cell Progression Based on Network Pharmacology, Molecular Docking and Ubiquitination Analysis.” Current Proteomics 22, no. 2: 100016. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1: The effects of dauriporphine treatment on 16HBE cell viability. 16HBE cells were treated various concentrations of dauriporphine (0, 5, 10, and 20 μM), and cell viability was analyzed by CCK‐8 assay (n = 3).

DDR-87-e70373-s002.tif (117.2KB, tif)

Figure S2: CASK knockdown inhibited the key malignant phenotypes of NSCLC cells. (A‐H) A549 and H1299 cells were transfected with si‐CASK or si‐NC. (A) Western blot was used to detect CASK protein level (n = 3). (B) CCK‐8 assay revealed cell viability (n = 3). (C) EdU assay revealed cell proliferation ability (n = 3). (D and E) Flow cytometry revealed cell apoptosis rate (n = 3). (F) Transwell assay revealed cell invasion, scale bar = 50 μm (n = 3). (G) Scratch assay revealed cell migration capacity (n = 3). (H) Sphere formation assay revealed cell stemness (n = 3).

DDR-87-e70373-s003.tif (3.1MB, tif)

Figure S3: Analysis of the association of dauriporphine and USP7 by molecular docking and CETSA. (A) CB‐DOCK2 showed molecular docking result between dauriporphine and USP7. (B) CETSA was performed on A549 cell lysates at different temperatures (n = 3).

DDR-87-e70373-s001.tif (2.7MB, tif)

Data Availability Statement

The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.

Articles from Drug Development Research are provided here courtesy of Wiley

RESOURCES