Winter-associated downregulation of ovarian NR5A2 correlates with impaired follicle development in the striped hamster (Cricetulus barabensis)

Abstract

To investigate the role of Nuclear receptor subfamily 5, group A, member 2 (NR5A2) in the seasonal regulation of follicle development in striped hamsters (Cricetulus barabensis), we collected 32 adult females, eight individuals from each season (spring, summer, autumn, and winter). Hematoxylin and eosin (H&E) staining was performed to quantify seasonal variations in follicle numbers across distinct developmental stages. Serum concentrations of gonadotropin-releasing hormone (GnRH), follicle-stimulating hormone (FSH), and luteinizing hormone (LH), as well as fecal concentrations of estradiol (E2) and progesterone (P4), were measured using enzyme-linked immunosorbent assay (ELISA). Ovarian NR5A2 mRNA levels were quantified by real-time quantitative PCR (qPCR). Spearman’s correlation analyses were conducted to examine associations between ovarian NR5A2 mRNA levels and follicle counts at each developmental stage, as well as between NR5A2 mRNA levels and serum and fecal reproductive hormone concentrations. The numbers of follicles at different developmental stages and ovarian NR5A2 mRNA levels exhibit pronounced seasonal variation (P < 0.01). Specifically, primary follicle counts peak in winter, whereas secondary and antral follicle numbers reach their seasonal minima during this period. Concurrently, ovarian NR5A2 mRNA levels in winter are significantly lower than those in spring, summer, and autumn (P < 0.01). Serum concentrations of GnRH, FSH, and LH, as well as fecal concentrations of E2 and P4, also display significant seasonal differences, all five hormones being markedly lower in winter compared with the other three seasons (P < 0.01). Furthermore, NR5A2 mRNA levels and fecal E2 and P4 concentrations were negatively correlated with primary follicle number but positively correlated with secondary and antral follicle numbers, suggesting that NR5A2, E2, and P4 collectively facilitate the transition from the primary to more advanced follicle stages. These findings indicate that winter environmental conditions suppress overall follicle development in striped hamsters, and the concomitant downregulation of ovarian NR5A2, correlating significantly with follicle counts, suggests a functionally relevant role for this transcription factor in seasonal follicle development. These results provide a theoretical foundation for ecologically sustainable population management strategies, supporting the rational design of targeted interventions, such as pharmacological agents, that selectively modulate population size in the target species while minimizing off-target effects on non-target organisms.

Supplementary Information

The online version contains supplementary material available at https://doi.org/10.1038/s41598-026-60026-7.

Introduction

Rodents constitute a keystone functional group in terrestrial ecosystems, underpinning essential ecological processes, particularly energy transfer and biogeochemical cycling, that collectively sustain ecosystem stability and resilience¹. However, uncontrolled population pullulations can trigger substantial public health risks, including zoonotic disease outbreaks, as well as significant economic losses, such as crop damage, livestock morbidity, and degradation of storage and transportation infrastructure². Consequently, evidence-based rodent management strategies are essential to reconcile biodiversity conservation with human health and socioeconomic well-being. Farmland rodent population exhibits pronounced seasonal fluctuations in abundance, primarily driven by photoperiod-sensitive reproductive physiology. Among seasonally breeding mammals, “long-day breeders” initiate or intensify gonadal development and breeding activity in response to progressively lengthening day lengths; representative species include hares, foxes, and hamsters. In contrast, “short-day breeders” activate reproductive function during periods of decreasing photoperiod; sheep, goats, and deer are well-established examples³. Consequently, breeding phenology varies markedly across seasonal breeders, reflecting species-specific adaptations to local photoperiodic environments. Elucidating the molecular mechanisms underlying seasonal reproduction is therefore essential for developing evidence-based, ecologically sustainable population management strategies.

Seasonal environmental cues, especially photoperiod, precisely regulate the timing of mammalian reproduction by modulating the hypothalamic–pituitary–gonadal (HPG) axis, a conserved neuroendocrine pathway that transduces external seasonal signals into coordinated gonadal responses⁴. In mammals, photoperiod is detected by the brain via retinal input to the suprachiasmatic nucleus (SCN), which relays this information to the pineal gland; the resulting rhythmic melatonin secretion then modulates the activity of hypothalamic neurons that synthesize and pulsatilely release gonadotropin-releasing hormone (GnRH). GnRH then binds to its cognate G protein–coupled receptor (GnRHR) on anterior pituitary gonadotropes, stimulating the synthesis and regulated release of follicle-stimulating hormone (FSH) and luteinizing hormone (LH)^5,6. FSH and LH act synergistically on ovarian granulosa and theca cells to drive estradiol and progesterone synthesis and secretion, thereby orchestrating follicle development⁷. Although sex steroids are well-established regulators of ovarian function, the identity of intraovarian factors, including locally produced neuropeptides, growth factors, and clock-controlled genes, whose transcription is directly regulated by the endogenous circadian clock, that transduce seasonal cues (e.g., photoperiod) to modulate follicle development, as well as the molecular mechanisms governing this local regulation, remains incompletely characterized.

Fecundity in female mammals is primarily determined by ovulation rate and gestational success, both of which depend critically on the developmental status of follicles^8,9. The ovary serves as the principal reproductive organ in females, orchestrating folliculogenesis and subsequent follicle development¹⁰. In the mouse ovary, pregranulosa cells envelop individual oocytes to initiate primordial follicle assembly^11,12. Granulosa cell proliferation drives follicle growth¹³. Thus, granulosa cell fate represents a pivotal regulatory node governing the commitment of follicles to either developmental progression or atretic degeneration¹⁴.

Follicle development is tightly coordinated.In mice, about one-third of germ cells initiate folliculogenesis to form the primordial follicle pool¹⁵. Primordial follicles, comprising a non-growing oocyte enveloped by a single layer of granulosa cells^16,17, are exclusively localized to the ovarian cortex^18,19. The vast majority remain under inhibitory control and in a dormant state; only a small enters the growing follicle pool^20,21. Upon activation, each primordial follicle commits to one of two mutually exclusive fates, progression toward maturation or elimination via atresia²². In the growing follicle pool, some activated primordial follicles transition to primary follicles as their granulosa cells change from flattened to cuboidal²³. Subsequently, granulosa cells stratify into multiple layers and the oocyte grows, forming the secondary follicle²⁴. As secondary follicles develop, fluid-filled lacunae form among granulosa cells and coalesce into a single, expanding antral cavity, the structure of the antral follicles²⁵. Only a minority of antral follicles progress to the preovulatory stage²⁶. As the antrum expands, the cumulus oophorus matures functionally and releases a competent oocyte at ovulation. After ovulation, the collapsed follicle wall is invaded by blood vessels, and granulosa and theca cells transdifferentiate into active luteal cells²⁷. Bidirectional communication between the oocyte and surrounding granulosa cells is essential for follicle development from the primordial stage onward^19,28. Granulosa cells not only provide structural and metabolic support but also synthesize critical steroid hormones, thereby actively regulating follicle development.

Nuclear receptor subfamily 5, group A, member 2 (NR5A2), commonly designated liver receptor homolog-1 (LRH-1), is an orphan nuclear receptor and sequence-specific transcription factor belonging to the NR superfamily^29,30. It binds with high affinity to conserved response elements, typically 5′- (T/C) CAAGG (T/C) C (A/G)-3′, thereby directly modulating transcription of target genes involved in steroidogenesis, cell proliferation, and metabolic homeostasis³¹. In mammals, NR5A2 exhibits spatially and temporally restricted expression, with robust levels in hypothalamic nuclei, anterior pituitary gonadotropes, ovarian granulosa and theca cells, and uterine endometrium^32,33. Functionally, it orchestrates multiple reproductive processes, including gonadal differentiation, folliculogenesis, steroid hormone biosynthesis, and periovulatory remodeling, through both cell-autonomous and paracrine mechanisms^32,34. Studies have demonstrated that homozygous disruption of the NR5A2 gene results in embryonic lethality around gastrulation, and NR5A2-null embryos exhibit pronounced growth retardation³⁵. In humans, NR5A2 mRNA expression in ovarian follicles progressively increases during follicle development³⁶. Conditional ablation of NR5A2 specifically in granulosa cells of female mice has revealed its indispensable role in folliculogenesis and ovulation³². Moreover, both NR5A2 polymorphisms and its mRNA expression levels are significantly associated with litter size in Hu sheep³⁷. Denizli et al. demonstrate that photoperiod regulates testicular DNA methylation at the NR5A2 promoter³⁸, thereby modulating NR5A2 expression, indicating that epigenetic regulation of the NR5A2 promoter may serve as a key mechanism underlying seasonal testicular function in the Djungarian hamster. In contrast, the mechanism of NR5A2 in ovarian function remains poorly characterized. The role of NR5A2 in granulosa cells is species-dependent. For example, NR5A2 promotes apoptosis in bovine granulosa cells³⁹, suppresses apoptosis in Hu sheep granulosa cells¹³, and stimulates proliferation in murine granulosa cells⁴⁰. Collectively, these findings indicate that NR5A2 critically regulates granulosa cell fate, thereby influencing follicle development, in a species-specific manner; however, its function remains unknown in the striped hamster.

The striped hamster (Cricetulus barabensis) is a major rodent pest in northern China farmlands and exhibits high fecundity⁴¹. The striped hamster typically breeds three times annually, with litter sizes ranging from four to nine⁴¹. Reproductive activity exhibits marked seasonal variation, peaking in spring (March–April) and autumn (September–October), and declining during summer (July–August) and winter (December–January)⁴². This seasonally modulated reproductive intensity is a primary driver of pronounced interseasonal fluctuations in population abundance⁴³. Consistent with this pattern, population density is significantly higher in spring and autumn than in summer and winter, directly mirroring the seasonal peaks in reproductive activity⁴⁴. Therefore, elucidating the role of NR5A2 in regulating follicle development in the striped hamster may inform targeted strategies for population control and contribute to ecosystem stability. In this study, we characterized the seasonal expression dynamics of ovarian NR5A2 across all four seasons in the striped hamster (Cricetulus barabensis) and assessed its correlation with follicle counts across developmental stages. These findings provide a mechanistically informed perspective on the regulation of seasonal follicle development in this specie.

Materials and methods

Sample collection and feeding conditions

In this study, striped hamsters (Cricetulus barabensis) were captured using live traps in open habitats within the mountainous and hilly terrain of Wu Village (116°98′E, 35°58′N), Qufu City, Shandong Province, China. In North China, peak reproductive activity occurs during spring (March-May) and autumn (September-November), whereas reproductive activity is reduced in summer (June-August) and especially in winter (December-February), when most individuals enter a state of reproductive quiescence⁴². To align sampling with biologically relevant reproductive stages, we collected individuals during the following windows: spring (April 5–7), summer (July 5–7), autumn (September 26–29), and winter (December 26–29). These intervals were deliberately selected to capture representative physiological states across the annual reproductive cycle, specifically, active gonadal function in spring and autumn, attenuated function in summer, and profound suppression in winter.

Individuals meeting the criteria, those exhibiting two dentinal rings on the second molar and uniform wear of the dentin across the first, second, and third molars to a single, continuous occlusal surface, with one enamel groove preserved on the third molar, were enrolled as study subjects. Each enrolled animal underwent a standardized physical examination, was assigned a unique identification number, and was transported to the animal housing facility at the Experimental Center of Qufu Normal University. Individuals failing to meet these criteria were excluded from the study and released unharmed. Housing conditions simulated natural environmental cues, rooms were maintained under ambient photoperiod and room temperature. Each hamster was housed individually in a standard cage (38 cm × 17.8 cm × 13.9 cm). Animals were fed ad libitum with commercially prepared complete rodent diet pellets (Jinan Peng Yue Experimental Animal Breeding Co., Ltd.), supplied with daily provision of 2–3 g. Fresh tap water was available continuously.

Sample preparation

In this study, a total of 32 adult female striped hamsters, eight individuals per group, approximately eight months old as estimated by molar wear⁴⁵ were used, balancing statistical reliability and ethical rigor in using biological specimens. The striped hamster exhibits a typical estrous cycle of 4–5 days, with estrus lasting approximately 12 h; this cyclicity remains largely conserved across seasons. In this study, estrus detection was performed daily for five consecutive days between 17:00 and 18:00 h using a combined approach of vulvar inspection and vaginal cytology. This standardized timing, aligned with the species’ nocturnal activity peak, ensured inter-seasonal consistency and minimized confounding effects of circadian rhythm on cytological profiles. Smears were air-dried, stained with crystal violet solution, and examined under light microscopy at 400× magnification. Estrus was identified by a predominance of fully cornified, anucleated squamous epithelial cells, with minimal leukocytes or nucleated epithelial cells⁴⁶. In a previous study, the proportion of 30 adult female striped hamsters (Cricetulus barabensis) exhibiting detectable estrus over a 5-day monitoring period differed significantly across seasons: 80% in spring, 80% in autumn, 60% in summer, and 20% in winter. Animals that failed to show clear estrus signs after five days of observation were sampled at 18:00 h on the fifth day. Animals confirmed to be in estrus or those that showed no unequivocal signs of estrus after five consecutive days of observation were humanely euthanized by CO₂ inhalation. Euthanasia was performed in a dedicated, sound-attenuated chamber (30 cm × 20 cm × 15 cm), pre-filled with room air. CO₂, with a density of approximately 1.98 kg/m³, was introduced at a flow rate achieving a chamber displacement rate of 50–70% per minute. Loss of consciousness typically occurred within 90–180 s, evidenced by respiratory arrest and pupillary dilation. If death does not occur, exposure duration would extend with continued CO₂ administration until apnea, persistent mydriasis, and cardiac arrest are confirmed, thereby ensuring humane endpoint attainment. Procedures were conducted in a quiet and familiar environment to minimize stress and anxiety in the animals.

The striped hamster was positioned supine and securely restrained on a pre-chilled dissection tray. The abdominal skin was aseptically prepared with 70% ethanol–moistened cotton swabs to minimize microbial contamination, thereby preserving native tissue architecture essential for accurate histopathological assessment of follicle developmental stage by hematoxylin–eosin (H&E) staining, and preventing nucleic acid degradation to ensure reliable NR5A2 mRNA quantification via quantitative real-time PCR (qPCR). Subsequently, the abdominal wall was incised to avoid visceral injury; ovarian adipose tissue and the mesovarium ligament were dissected using fine forceps; and the ovary was liberated from surrounding connective tissue. The ovarian pedicle was severed proximal to the uterine horn using micro-scissors, ensuring complete, intact, and morphologically undistorted removal of the ovary. The left ovary was immersion-fixed in ice-cold 4% paraformaldehyde for 24 h, followed by standard paraffin embedding and hematoxylin–eosin (H&E) staining. The right ovary was immediately snap-frozen in liquid nitrogen and stored at − 80 °C for qPCR quantification of NR5A2 mRNA. During estrous cycle monitoring, striped hamsters were housed individually in sterile cages. Fresh fecal samples were collected daily at 8:00 AM using sterile forceps, immediately transferred into pre-chilled sterile 1.5 mL centrifuge tubes, and snap-frozen in liquid nitrogen before storage at − 80 °C. For hormone analysis, only fecal samples collected on the day of euthanasia were used. Blood was also collected into sterile centrifuge tubes and allowed to clot at 4 °C for 30 min. Tubes were then centrifuged at 3,000 × g for 15 min at 4 °C. The serum supernatant was carefully transferred to new sterile centrifuge tubes for storage at − 80 °C.

All unused tissues were temporarily stored at − 80 °C in the Laboratory at the College of Life Sciences, Qufu Normal University, and subsequently transferred to the university hospital for centralized incineration and safe disposal in accordance with biohazard waste management protocols. All procedures were reviewed and approved by the Biomedical Ethics Committee of Qufu Normal University (Permit No.: 2024019) and conducted in strict accordance with the Guidelines set by the Chinese Experimental Animal Ethics Committee.

Microstructure observation of ovarian follicles

Ovaries were fixed in 4% paraformaldehyde (G1101-500ML, Servicebio, Wuhan, China) for 48 h at 4 °C. Fixed tissues were then processed through graded ethanol series for dehydration, cleared in xylene, and embedded in paraffin. Serial 5-µm-thick sections were cut from the mid-portion of each ovary using a microtome, mounted on poly-L-lysine-coated glass slides, and subjected to hematoxylin and eosin (H&E) staining. Stained sections were coverslipped with neutral balsam and imaged under an upright light microscope (Eclipse E100, Nikon, Tokyo, Japan) equipped with a digital camera system. Follicles were classified and counted according to established morphological criteria: primary follicles (PF) were defined as oocytes surrounded by a single layer of flattened granulosa cells; secondary follicles (SF) exhibited two or more complete layers of cuboidal granulosa cells without antrum formation; and antral follicles (AF) contained a clearly discernible fluid-filled antrum. To ensure sampling representativeness and minimize bias, three non-consecutive sections spaced at least 30 μm apart were selected per ovary; follicle counts from these sections were averaged to yield a single value per ovary.

Hormone concentration detection

Fecal samples were homogenized in physiological saline at a ratio of 5 mL per 1 g of wet weight and centrifuged at 12,000 × g for 15 min at 4 °C. The supernatant was then transferred to sterile centrifuge tubes and stored at − 80 °C. E2 and P4 concentrations in fecal samples, as well as GnRH, FSH, and LH concentrations in serum, were quantified using commercially available enzyme-linked immunosorbent assay (ELISA) kits, following the manufacturer’s instructions. All samples were diluted 1:5 in the respective assay buffer immediately prior to analysis to ensure signal intensities remained within the linear range of each standard curve. Hormone concentrations were quantified using commercially available ELISA kits (Shanghai Jining Biotechnology Co., Ltd., Shanghai, China): GnRH (cat. no. JN85260; standard range: 2.5–40 ng/L; limit of detection [LOD]: 1.0 ng/L), FSH (cat. no. JN83272; 0.25–4 U/L; LOD: 0.1 U/L), LH (cat. no. JN00518; 2.5–40 ng/L; LOD: 0.1 U/L), estradiol (E₂) (cat. no. JN82367; 5–80 pmol/L; LOD: 1 pmol/L), and progesterone (P₄) (cat. no. JN01373; 10–160 pmol/L; LOD: 1 pmol/L). All standard curves generated using the ELISA kit exhibited excellent linearity (R² ≥ 0.9900), and low assay variability, with intra-assay and inter-assay coefficients of variation both consistently < 10%, fully satisfying criteria for ELISA method validation.

Real-time fluorescence-based quantification PCR

Extraction of total RNA from ovaries

Total RNA was extracted from frozen tissue samples (stored at − 80 °C) using RNAiso Plus (Cat. #9108, Takara) according to the manufacturer’s instructions, with minor modifications. Briefly, individual tissue samples were rapidly transferred to pre-chilled 1.5 mL microcentrifuge tubes, and 400 µL of ice-cold lysis buffer was added. Tissues were homogenized thoroughly by mechanical grinding on ice. An additional 400 µL of ice-cold lysis buffer was then added, followed by a 5-min incubation at room temperature to ensure complete dissociation of nucleoprotein complexes. Samples were centrifuged at 12,000 × g for 5 min at 4 °C; the resulting supernatant was carefully transferred to a new RNase-free tube. Chloroform (20% v/v of the supernatant volume) was added, and the mixture was vortexed vigorously for ≥ 30 s until a uniform emulsion formed. After 5 min incubation on ice, samples were centrifuged at 12,000 × g for 15 min at 4 °C. The upper aqueous phase was aspirated and transferred to a fresh RNase-free tube. An equal volume of ice-cold isopropanol was added, mixed gently but thoroughly by inversion, and incubated at 4 °C for 10 min to maximize RNA precipitation efficiency. Following centrifugation at 12,000 × g for 10 min at 4 °C, the supernatant was completely removed without disturbing the pellet. The RNA pellet was washed once with 800 µL of ice-cold 75% ethanol (v/v, prepared with DEPC-treated water), centrifuged at 12,000 × g for 5 min at 4 °C, and the ethanol supernatant was carefully discarded. The pellet was air-dried, then dissolved in 30 µL of RNase-free, 0.1% DEPC-treated water.

RNA quality assessment

RNA purity was assessed spectrophotometrically (Eppendorf, Germany) using 1 µL of RNA; samples exhibiting an A260/A280 ratio between 1.8 and 2.0 were accepted as protein- and phenol-free. RNA integrity was evaluated by denaturing agarose gel electrophoresis (1.5% w/v agarose in 1×TAE buffer, containing 2.2 M formaldehyde), with 3 µL of RNA mixed with 0.5 µL of 6×RNA loading buffer. Electrophoresis was conducted at 100 V for 30 min in 1×TAE buffer at room temperature, followed by visualization under UV light using a gel documentation system (Gel Doc XR+, BIO-RAD, USA). Intact RNA was confirmed by the presence of sharp, discrete 28 S and 18 S rRNA bands, with the 28 S band intensity approximately twice that of the 18 S band, and a faint but distinct 5 S band; absence of smearing, trailing, or low-molecular-weight degradation products further supported high integrity. RNA concentration was provided directly by spectrophotometry using the A₂₆₀-based conversion factor.

cDNA synthesis

Reverse transcription was performed using the TaKaRa RNA PCR Kit (AMV) Ver. 3.0 (Cat. #RR014A, TaKaRa), following the manufacturer’s protocol with strict adherence to RNase-free conditions. Total RNA (500 ng per reaction) from all samples was reverse transcribed in parallel using AMV Reverse Transcriptase (5 U/µL) and oligo(dT)₁₈ primer (20 pmol/µL). Each 10 µL reaction contained: 2 µL of 25 mM MgCl₂, 1 µL of 10× RT Buffer, 3.75 µL of RNase-free water, 1 µL of dNTP Mixture (10 mM each), 0.25 µL of RNase Inhibitor (40 U/µL), 0.5 µL of AMV Reverse Transcriptase, 0.5 µL of oligo(dT)₁₈ primer, and 1 µL of RNA template (equivalent to 500 ng total RNA). Reactions were incubated at 58 °C for 20 min for cDNA synthesis, followed by immediate enzyme inactivation at 95 °C for 5 min and rapid cooling to 5 °C for 5 min to prevent cDNA degradation or secondary structure formation. All cDNA products were aliquoted and stored at − 20 °C to minimize freeze-thaw cycles and preserve integrity prior to qPCR analysis.

Quantitative real-time PCR

qPCR assays were performed on an Agilent Stratagene Mx3000P Real-Time PCR System (Agilent Technologies, Germany) using Brilliant II SYBR Green QPCR Master Mix (TaKaRa Bio, Japan), at the Biology Experiment Center, School of Life Sciences, Qufu Normal University. The stability of the reference gene β-actin was evaluated in ovarian tissues from 12 striped hamsters (n = 3 per season: spring, summer, autumn, and winter) using geNorm software, which calculates the average expression stability measure (M-value); lower M-values reflect greater transcriptomic stability across experimental conditions⁴⁷. The calculated M-value for β-actin was 0.786, well below the empirically established threshold of 1.5, indicating high expression stability across all seasonal groups. Consequently, β-actin was selected as the reference gene for normalization of target gene expression in all downstream quantitative analyses. Primer sequences for NR5A2 and β-actin are listed in Table 1. Primer specificity was rigorously validated using NCBI Primer-BLAST against the RefSeq mRNA and genomic databases, confirming exclusive alignment to NR5A2 sequence with no off-target hits.

Table 1.

Primers for real-time quantitative PCR of NR5A2 and β-actin.

Genes	Primer sequences	Product length (bp)	Annealing temperature (℃)	GenBank accession numbers
NR5A2	F: AGTGCTGAGATTCCGTTCC − 3′	179	58	JN367458
	R: 5′- CTGTTTGCTGTGGGTAGTTG − 3′
β-actin	R: 5′- GAGACCTTCAACACCCCAGC − 3′	263	58	NM_001244575.1
	R: 5′- ATGTCACGCACAATTTCCC − 3′

The reaction mixture was prepared in a total volume of 20 µL, containing 9 µL SYBR Green, 0.4 µL each of forward and reverse primers (10 µmol/L), 0.3 µL ROX, 2 µL cDNA template, and 7.9 µL nuclease-free water treated with diethylpyrocarbonate (DEPC). Thermal cycling was performed as follows: initial enzyme activation at 94 °C for 30 s; followed by 40 cycles of denaturation at 94 °C for 10 s, annealing at 58 °C for 30 s, and extension at 72 °C for 30 s. Amplification specificity was verified by post-PCR melting curve analysis, which yielded a single, sharp melting peak for each target amplicon, indicating absence of primer dimers or nonspecific products. Amplification efficiency of the NR5A2 and β-actin assays was 105.0% and 99.9%, respectively, indicating robust and reliable quantitative performance.

Relative NR5A2 mRNA expression levels were quantified using the 2^−ΔΔCt method⁴⁸, with β-actin serving as the endogenous reference gene for normalization. To ensure the accuracy of the results, all samples were analyzed in technical triplicate, and the intra-assay coefficient of variation (CV) was consistently below 5%. The mean Ct values for NR5A2 were 23.53 ± 0.52 (spring), 24.89 ± 0.54 (summer), 24.30 ± 0.35 (autumn), and 28.02 ± 0.62 (winter); corresponding mean Ct values for the reference gene β-actin were 23.15 ± 0.42, 23.61 ± 0.57, 23.41 ± 0.39, and 23.03 ± 0.40, respectively. All no-template controls (NTCs) across PCR plates exhibited undetermined Ct values, confirming the absence of genomic DNA contamination, primer-dimer artifacts, or reagent carryover, and thereby validating assay specificity and analytical reliability for downstream relative quantification.

Statistical analyses

Experimental data are expressed as mean ± standard deviation (SD). Assumptions of normality and homogeneity of variances were rigorously evaluated using the Shapiro–Wilk test and Levene’s test, respectively, implemented in IBM SPSS Statistics 22. Inter-seasonal variations in all parameters were analyzed using one-way ANOVA, followed by Tukey’s post hoc test for pairwise comparisons (SPSS v22.0, IBM Corp.). Correlations were assessed using Spearman’s correlation coefficient (GraphPad Prism v8.0.2, GraphPad Software). Statistical significance was defined as *P < 0.05 and **P < 0.01 (two-tailed).

Results

Seasonal variation in body weight, ovarian weight, and ovarian coefficient

Thirty-two adult female striped hamsters (Cricetulus barabensis), approximately 8 months of age, were used in this study, eight individuals per season (spring, summer, autumn, and winter). Body weights were measured, and inter-seasonal differences were analyzed using one-way ANOVA followed by Tukey’s post hoc test. Results are presented in Fig. 1(5). No significant inter-seasonal difference in body weight was observed among adult female striped hamsters (F(3,28) = 0.6849, P = 0.5688). The reproductive organs of adult female striped hamsters across seasons is shown in Fig. 1 (panels 1–4), representing spring, summer, autumn, and winter, respectively. Structures include the uterus, oviducts, ovaries (indicated by black arrows), and periovarian adipose tissue. Uterine wall thickness and ovarian size were greater in spring, summer, and autumn; in contrast, both structures were reduced in winter. Subsequently, bilateral ovaries were weighed after removal of the oviducts and periovarian adipose tissue; results are presented in Fig. 1 (Panel 6), revealing a statistically significant inter-seasonal variation in ovarian weight among adult female striped hamsters (one-way ANOVA: F(3, 28) = 21.08, P < 0.001). As shown in panel 6, ovarian weight was significantly higher in spring, summer, and autumn than in winter (P < 0.01); moreover, ovarian weight in autumn was significantly greater than in both spring and summer (P < 0.01). A parallel seasonal pattern was also observed in the ovarian coefficient (ovary weight normalized to body weight), which showed a statistically significant inter-seasonal variation (one-way ANOVA: F(3, 28) = 17.54, P < 0.001) : values in autumn were significantly higher than in spring and summer (P < 0.01), and all three warm-season groups (spring, summer, autumn) exhibited significantly greater ovarian coefficients than the winter group (P < 0.01), as shown in Fig. 1 (panel 7). These results indicate that winter suppresses gonadal development in adult female striped hamsters (Cricetulus barabensis).

Fig. 1.

Seasonal variations in body weight, ovarian weight, and ovarian coefficient in striped hamsters. Panels (1–4) show representative images of reproductive organs from the Spring, Summer, Autumn, and Winter groups, respectively; arrows indicate the ovaries. Panels (5–7) present quantitative data: (5) body weight, (6) ovarian weight, and (7) ovarian coefficient (ovarian weight (mg)/body weight (g) × 100%). Data are presented as means ± SD (n = 8 per group). Bars labeled with different uppercase letters differ significantly (P < 0.01).

Seasonal variation in ovarian histomorphology and follicle count

Hematoxylin–eosin (HE)-stained ovarian sections from adult female striped hamsters across seasons (spring, summer, autumn, and winter) are shown in Fig. 2 (panels 1–4); distinct histomorphological differences were observed among seasonal groups. Primary follicles are characterized by a single layer of granulosa cells and the absence of an antrum⁴⁹. Secondary follicles feature multiple layers of granulosa cells and increased volume compared with primary follicles²⁴. Antral follicles are characterized by multiple granulosa cell layers and a fully formed antrum⁴⁹. Quantitative analysis (Fig. 2, Panel 5) revealed a statistically significant inter-seasonal variation in primary follicle count among adult female striped hamsters (one-way ANOVA: F(3, 28) = 199.2, P < 0.001). The winter group had the highest primary follicle count, significantly exceeding those of the spring, summer, and autumn groups (P < 0.01). The summer group exhibited a significantly greater count than both the spring and autumn groups (P < 0.01), whereas the autumn group showed a significantly higher count than the spring group only (P < 0.05). As shown in Fig. 2 (Panels 6 and 7), statistically significant inter-seasonal variations in secondary and antral follicle counts were observed among adult female striped hamsters (one-way ANOVA: F(3, 28) = 79.69, P < 0.001; F(3, 28) = 56.71, P < 0.001). Ovaries from the winter group exhibited significantly lower counts of secondary and antral follicles than all other seasonal groups (P < 0.01). Post hoc analysis revealed that the spring and autumn groups had significantly higher secondary follicle counts than the summer group (P < 0.01); moreover, the spring group exhibited a significantly greater count than the autumn group (P < 0.05), as quantified in panel 6. In contrast, no significant difference in antral follicle count was observed among the spring, summer, and autumn groups (P > 0.05), as shown in panel 7. Collectively, these findings demonstrate that ovarian follicle development in adult female striped hamsters (Cricetulus barabensis) is strictly seasonal: the warm-season months (spring, summer, autumn) promote the transition of primary follicles to secondary and antral stages, whereas winter suppresses progression beyond the primary stage.

Fig. 2.

Seasonal differences in ovarian histomorphology and follicle count in striped hamsters. Panels (1–4) show representative hematoxylin-eosin (HE)-stained ovarian sections from the Spring, Summer, Autumn, and Winter groups, respectively. PF, primary follicles; SF, secondary follicles; AF, antral follicles. Panels (5–7) quantify follicle counts: (5) primary follicles, (6) secondary follicles, and (7) antral follicles. Data are presented as means ± SD (n = 8 per group). Bars labeled with different uppercase letters differ significantly (P < 0.01), and those with different lowercase letters differ significantly (P < 0.05).

Seasonal variation in serum gonadotropin levels, fecal steroid hormone concentrations, and ovarian NR5A2 mRNA

Reproductive activity is governed by the hypothalamic-pituitary-gonadal (HPG) axis, with gonadotropin-releasing hormone (GnRH), follicle-stimulating hormone (FSH), luteinizing hormone (LH), estradiol (E2), and progesterone (P4) serving as key regulatory hormones. As shown in Fig. 3 (Panels 1–5), statistically significant inter-seasonal variations in serum concentrations of GnRH (one-way ANOVA: F(3, 28) = 61.62, P < 0.001), FSH (F(3, 28) = 90.57, P < 0.001), and LH (F(3, 28) = 129.9, P < 0.001), as well as fecal concentrations of estradiol (E2) (F(3, 28) = 286.0, P < 0.001) and progesterone (P4) (F(3, 28) = 34.43, P < 0.001), were observed among adult female striped hamsters. Serum concentrations of GnRH, FSH, and LH, and fecal concentrations of E2 and P4, were significantly lower in the winter group compared with those in the spring, summer, and autumn groups (P < 0.01). In contrast, no significant differences were observed in serum GnRH or LH levels among the spring, summer, and autumn groups (P > 0.05; Fig. 3, panels 1 and 3, respectively). For serum FSH concentration, levels in the summer and autumn groups were significantly higher than those in the spring group (P < 0.01), whereas no significant difference was observed between the summer and autumn groups (P > 0.05; Fig. 3, panel 2). Fecal E2 concentrations were significantly higher in the autumn group than in both the spring and summer groups (P < 0.01), and significantly higher in the spring group than in the summer group (P < 0.05; Fig. 3, panel 4). Similarly, fecal P4 concentration in the autumn group was significantly higher than that in the spring group (P < 0.05; Fig. 3, panel 5). As shown in Fig. 3 (Panel 6), a statistically significant inter-seasonal variation in ovarian NR5A2 mRNA expression was observed among adult female striped hamsters (one-way ANOVA: F(3, 28) = 13.89, P < 0.001). Ovarian NR5A2 mRNA expression in winter striped hamsters was significantly lower than that in the spring, summer, and autumn groups (P < 0.01), and significantly higher in the spring group than in the summer group (P < 0.05; Fig. 3, panel 6). These results further demonstrate that key components of the hypothalamic-pituitary-gonadal (HPG) axis, including GnRH, FSH, LH, estradiol (E2), progesterone (P4), and ovarian NR5A2 mRNA exhibit significant seasonal variation in the striped hamster.

Fig. 3.

Seasonal variations in serum gonadotropin and fecal steroid hormone concentrations, and ovarian NR5A2 mRNA in striped hamsters. (1) Serum gonadotropin-releasing hormone (GnRH); (2) Serum follicle-stimulating hormone (FSH); (3) Serum luteinizing hormone (LH); (4) Fecal estradiol (E2); (5) Fecal progesterone (P4); (6) Relative ovarian NR5A2 mRNA. Data are presented as means ± SD (n = 8 per group). Bars labeled with different uppercase letters differ significantly (P < 0.01), and those with different lowercase letters differ significantly (P < 0.05).

Correlation between serum gonadotropin levels and fecal steroid hormone concentrations

GnRH, FSH, LH, estradiol (E2), and progesterone (P4) are key hormonal regulators of reproductive activity in mammals. Correlation analysis demonstrated a statistically significant positive association between serum GnRH concentrations and both serum FSH (r = 0.7864, P < 0.001) and LH (r = 0.5345, P = 0.0016) levels, as shown in Fig. 4A and B, respectively. Serum FSH concentration exhibited a statistically significant positive correlation with both fecal estradiol (E2) (r = 0.6863, P < 0.001) and progesterone (P4) (r = 0.7389, P < 0.001) concentrations, as shown in Fig. 4C and D, respectively. Furthermore, serum LH concentration showed a statistically significant positive correlation with both fecal estradiol (E2) (r = 0.7431, P < 0.001) and progesterone (P4) (r = 0.6377, P < 0.001) concentrations, as shown in Fig. 4E and F, respectively. Collectively, these findings indicate that the core hormones of the hypothalamic-pituitary-gonadal (HPG) axis, GnRH, FSH, LH, E2, and P4, function in a coordinated, seasonally conserved manner to regulate reproductive activity in the striped hamster.

Fig. 4.

Associations between serum gonadotropin levels and fecal steroid hormone levels in the striped hamster. (A) Serum gonadotropin-releasing hormone (GnRH) concentration versus follicle-stimulating hormone (FSH) concentration; (B) serum GnRH concentration versus luteinizing hormone (LH) concentration; (C) serum FSH concentration versus fecal estradiol (E2) concentration; (D) serum FSH concentration versus fecal progesterone (P4) concentration; (E) serum LH concentration versus fecal estradiol (E2) concentration; (F) serum LH concentration versus fecal progesterone (P4) concentration. n = 32. Data are presented as mean ± SD.

Association of ovarian NR5A2 mRNA expression with fecal steroid hormone levels and follicle count

NR5A2, a key transcription factor, plays a critical role in ovarian follicle development. Correlation analyses revealed a statistically significant positive association between ovarian NR5A2 mRNA expression levels and fecal estradiol (E2) (r = 0.5723, P < 0.001) and progesterone (P4) (r = 0.4038, P = 0.0219) concentrations in the striped hamster, as shown in Fig. 5A and B, respectively. Conversely, ovarian NR5A2 mRNA expression levels exhibited a statistically significant negative correlation with the number of primary follicles (r = − 0.7709, P < 0.001; Fig. 5C) and statistically significant positive correlations with the numbers of secondary (r = 0.7605, P < 0.001; Fig. 5D) and antral follicles (r = 0.7230, P < 0.001; Fig. 5E). These findings collectively indicate that NR5A2 may play a critical role in promoting the transition of primary follicles to secondary follicles and, subsequently, to antral follicles, either through direct transcriptional regulation of genes encoding key factors governing follicle development, or indirectly via modulation of estradiol (E2) and progesterone (P4) synthesis, supported by correlation analyses. However, the precise molecular mechanisms by which NR5A2 governs this developmental progression remain to be experimentally determined.

Fig. 5.

Associations between ovarian NR5A2 mRNA expression and fecal steroid hormone levels or ovarian follicle counts in the striped hamster. (A) Ovarian NR5A2 mRNA expression versus fecal estradiol (E2) concentration; (B) ovarian NR5A2 mRNA expression versus fecal progesterone (P4) concentration; (C) ovarian NR5A2 mRNA expression versus primary follicle count; (D) ovarian NR5A2 mRNA expression versus secondary follicle count; (E) ovarian NR5A2 mRNA expression versus antral follicle count. n = 32. Data are presented as mean ± SD.

Association between fecal steroid hormone levels and follicle count

Estradiol (E2) and progesterone (P4), the principal ovarian steroid hormones, critically regulate follicle development. Correlation analyses revealed statistically significant negative correlations between fecal estradiol (E2) concentration and the number of primary follicles (r = − 0.7121, P < 0.001; Fig. 6A), and between fecal progesterone (P4) concentration and the number of primary follicles (r = − 0.4687, P = 0.0068; Fig. 6D). Fecal estradiol (E2) concentration showed statistically significant positive correlations with the numbers of secondary follicles (r = 0.7710, P < 0.001; Fig. 6B) and antral follicles (r = 0.6541, P < 0.001; Fig. 6C). Fecal progesterone (P4) concentration also exhibited statistically significant positive correlations with the numbers of secondary follicles (r = 0.5290, P = 0.0019; Fig. 6E) and antral follicles (r = 0.4299, P = 0.0141; Fig. 6F). These findings collectively indicate that E2 and P4 act synergistically to promote the stepwise progression of ovarian follicles, from primary to secondary and subsequently to antral stages, as supported by correlation analyses. However, the precise mechanisms by which E2 and P4 regulate follicle development remain unclear and require further functional validation.

Fig. 6.

Associations between fecal steroid hormone levels and ovarian follicle counts in the striped hamster. (A) Fecal estradiol (E2) concentration versus primary follicle count; (B) fecal estradiol (E2) concentration versus secondary follicle count; (C) fecal estradiol (E2) concentration versus antral follicle count; (D) fecal progesterone (P4) concentration versus primary follicle count; (E) fecal progesterone (P4) concentration versus secondary follicle count; (F) fecal progesterone (P4) concentration versus antral follicle count. n = 32. Data are presented as mean ± SD.

Discussion

Seasonal variations in body weight, ovarian weight, and follicle developmental status

The present study reveals no significant seasonal variation in body mass among adult striped hamsters (Cricetulus barabensis), consistent with findings reported for the african spiny mouse (Acomys cahirinus)⁵⁰ and the large Japanese field mouse (Apodemus speciosus)⁵¹. In contrast, seasonal body mass patterns differ markedly in other rodent species: the brandt’s vole (Lasiopodomys brandtii)⁵² and the siberian hamster (Phodopus sungorus)⁵³ exhibit higher body mass in summer and lower mass in winter, whereas the golden hamster (Mesocricetus auratus)⁵⁴ and the collared lemming (Dicrostonyx groenlandicus)⁵⁵ show the opposite pattern, lower summer mass and peak mass during winter. These interspecific discrepancies in seasonal body mass dynamics likely reflect divergent adaptive strategies in energy metabolism regulation, shaped by species-specific ecological pressures, life-history traits, and thermal environments.

This study demonstrates that adult female striped hamsters exhibit significantly lower ovarian mass, ovarian index, numbers of secondary follicles, and antral follicles in winter compared with spring, summer, and autumn, indicating seasonal suppression of ovarian function and reproductive readiness during winter. These findings align with photoperiodic studies in the same species: female striped hamsters exposed to short-day photoperiods show markedly reduced ovarian mass and ovarian index, as well as diminished secondary and antral follicle populations relative to those maintained under long-day conditions⁵⁶, confirming that short photoperiod, mimicking natural winter, is a key environmental cue suppressing follicle development in female striped hamsters. In camels (Camelus dromedarius)⁵⁷ and mongooses (Herpestes auropunctatus)⁵⁸, ovarian mass is significantly greater during the breeding season than during the non-breeding season, a pattern consistent with the seasonal ovarian enlargement in the striped hamster in the present study.

In the striped hamster, primary follicle counts are significantly elevated in winter relative to spring, summer, and autumn, yet notably lower during the high-fertility seasons of spring and autumn compared with the low-fertility seasons of summer and winter. This pattern suggests accelerated transition from primary to secondary follicles during spring and autumn, thereby depleting the primary follicle pool, whereas reduced developmental progression in summer and winter leads to primary follicle accumulation. These findings align precisely with the well-documented seasonal breeding peaks of striped hamsters in spring and autumn^42,44 and parallel observations in Yimeng black goats⁵⁹ and Boer goats⁶⁰. Studies in domestic sows (Sus scrofa domesticus)⁶¹ and water buffaloes (Bubalus bubalis)⁶² have demonstrated seasonal suppression of follicle developmental competence during the non-breeding season, a pattern consistent with our findings in the striped hamster (Cricetulus barabensis), wherein winter significantly inhibits the transition of primary follicles to subsequent developmental stages. The seasonal differences in follicle developmental status further support the hypothesis that variations in follicle development may represent a key driver of seasonal fluctuations in population size.

Seasonal variations in reproductive hormone concentrations

The results of this study show that serum concentrations of GnRH, FSH, and LH, as well as fecal concentrations of E2 and P4, were significantly lower in striped hamsters captured during winter than in those captured during the other three seasons. This seasonal suppression of reproductive hormones aligns with findings in dairy goats, in which serum FSH and LH levels are significantly lower during the non-breeding season compared with the breeding season⁶³, and in wild Daurian ground squirrels (Citellus dauricus), where FSH and LH concentrations were significantly higher during the breeding season than during the non-breeding season⁶⁴.

Seasonal variation in ovarian NR5A2 mRNA and its potential regulatory roles in follicle development

In this study, ovarian NR5A2 mRNA expression in the striped hamster was negatively correlated with the number of primary follicles, but positively correlated with the numbers of secondary follicles and antral follicles, suggesting that NR5A2 is a candidate transcription factor implicated in the progression of primary follicles to secondary and antral stages, as supported by significant correlations between its ovarian expression and follicle counts; however, direct causal involvement in follicle development remains to be established through functional validation, such as targeted NR5A2 knockdown or conditional knockout in vivo. This observation aligns with accumulating evidence across mammalian models: in murine, NR5A2 directly promotes proliferation and drives the transition from early to late-stage follicles⁴⁰; in cattle, NR5A2 expression is significantly higher in granulosa cells of dominant and preovulatory follicles relative to small follicles⁶⁵; in Hu sheep, ovarian NR5A2 mRNA levels correlate positively with both ovulation rate and litter size³⁷; granulosa cell–specific NR5A2 knockout results in complete sterility due to anovulation³². NR5A2 is indispensable for endometrial receptivity and embryo implantation in mice⁶⁶. NR5A2-null mice (NR5A2^−/−) die embryonically around the gastrulation period; heterozygous (NR5A2^+/−) mice exhibit significantly reduced fecundity compared with wild-type (NR5A2^+/+) controls⁶⁷. Overexpression of NR5A2 in Hu sheep granulosa cells promotes granulosa cell proliferation, thereby facilitating the follicle development process¹³. The above results are consistent with those reported in the striped hamster. In contrast, in bovine granulosa cells, high expression of NR5A2 promotes apoptosis and subsequently induces follicle atrophy³⁹, indicating a species-specific functional divergence. This interspecies difference primarily stems from structural divergence in genomic architecture. As a sequence-specific transcription factor, NR5A2 exhibits binding preferences, both in genomic loci and binding affinity, resulting in differential target gene selection and quantitative variation in transcriptional output. Consequently, these molecular differences propagate to distinct downstream biological phenotypes. In the Djungarian hamster, photoperiod regulates DNA methylation at the NR5A2 promoter and modulates testicular function³⁸, indicating that epigenetic mechanisms contribute to seasonal adaptations in reproductive timing. In this study, NR5A2 expression decreased during winter, suggesting increased methylation of the NR5A2 promoter in this season, which likely mediates transcriptional repression and impairs follicle development in the striped hamster. This inference requires experimental validation.

The striped hamsters used in this study were captured from natural habitats across distinct seasons. Seasonal variations in key environmental factors, including photoperiod, ambient temperature, nutritional availability, and precipitation, collectively modulate physiological and behavioral adaptations in these animals. Winter-captured individuals exhibited significantly reduced ovarian NR5A2 expression and impaired follicle development, consistent with the integrated influence of these seasonal cues; however, the relative contribution of each factor remains unclear. To disentangle their individual roles in regulating seasonal follicle development, future experiments should employ controlled laboratory settings, systematically varying one environmental parameter while holding all others constant. Prior work has established photoperiod as a dominant regulator of follicle development in striped hamsters⁵⁶, long-days promote follicle development, whereas short-days suppress it. Building on this foundation, subsequent studies should isolate and quantitatively characterize the specific effects of other seasonally variable factors, including ambient temperature, dietary composition, and precipitation, on ovarian follicle dynamics.

In this study, interindividual variability in estrous cycle timing may introduce bias into the results. To mitigate this confounding factor, estrous staging was performed daily between 5:00 and 6:00 PM for five consecutive days prior to sampling, as described in the Sample Preparation section; samples were collected exclusively from animals confirmed to be in estrus, with the exception of individuals from winter when estrous cyclicity is suppressed in the striped hamster. To further improve estrous synchrony across subjects, future studies could employ progestogen-releasing vaginal sponges, thereby enhancing estrous phase alignment and the precision of experimental outcomes.

Collectively, these data indicate that NR5A2 is a potential transcription factor involved in regulating ovarian follicle development in the striped hamster, a species exhibiting seasonal reproductive patterns, supported by statistically significant correlation analyses. Future studies employing specific inhibitors to target NR5A2 in an in vitro follicle culture system will be necessary to establish the direct causal effect of NR5A2 on follicle development, and the precise molecular mechanisms underlying NR5A2’s regulation of follicle development requires further investigation.

Conclusions

Seasonal profiling revealed significant fluctuations in follicle counts, reproductive hormone concentrations, and ovarian NR5A2 mRNA abundance. Moreover, NR5A2 mRNA levels were strongly correlated with both reproductive hormone concentrations and the numbers of primary, secondary, and antral follicles. Collectively, these associations position NR5A2 as a seasonally regulated molecular determinant of follicle development in the striped hamster, providing a mechanistic link between intrinsic ovarian gene regulation and seasonal population dynamics. A key limitation is the absence of direct functional validation; thus, future studies should employ targeted perturbation strategies, including NR5A2 overexpression and siRNA-mediated knockdown, in a well-established in vitro follicle culture system to causally define its roles in follicle growth, granulosa cell differentiation, and oocyte maturation.

Supplementary Information

Below is the link to the electronic supplementary material.

Supplementary Material 1 ^{(10.2KB, xlsx)}

Supplementary Material 2 ^{(11.6MB, docx)}

Supplementary Material 3 ^{(4.6MB, docx)}

Supplementary Material 4 ^{(36.5KB, xls)}

Supplementary Material 5 ^{(11.1KB, xlsx)}

Supplementary Material 6 ^{(9.5KB, xlsx)}

Author contributions

Huiliang Xue: designed the research study, performed the research, analyzed the data, drew the graphs, wrote the manuscript. Fanli Bu: analyzed the data, drew the graphs. Guangyu Li: performed the research, drew the graphs. Yunjiao Zheng: performed the research, analyzed the data, drew the graphs. Chao Fan: participated in the conception process, guided and revised the manuscript. Jinhui Xu: designed the research study, and revised the manuscript. Lei Chen: analyzed the data, revised the manuscript. Ming Wu: participated in the conception process, revised the manuscript. Laixiang Xu: designed the research study, guided and revised the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China, grant numbers 31972283.

Data availability

The datasets presented in this study can be found in the article/Supplementary Files.

Declarations

Competing interests

The authors declare no competing interests.

Ethics approval and consent to participate

All experimental procedures were reviewed and approved by the Biomedical Ethics Committee of Qufu Normal University and carried out in strict accordance with the guidelines issued by the Chinese Experimental Animal Ethics Committee.

Consent for publication

All authors give consent for publication.