Skip to main content
Wiley Open Access Collection logoLink to Wiley Open Access Collection
. 2026 Aug 31;40(9):e71103. doi: 10.1002/jbt.71103

Nanoplastic Particle Exposure Induces Toxicity and Amplifies Cellular Stress in THP‐1 Macrophages: Insights on Molecular Pathways and Circulating Proteome Interaction

Balamurali Mahalakshmi 1, Gobichettipalayam Balasubramaniam Maadurshni 1, Thittumpuram Manikandan Anjana 1, Jeganathan Manivannan 1,✉
PMCID: PMC13531021  PMID: 42676063

ABSTRACT

The widespread accumulation of polystyrene nanoplastic particles (NPPs) in the environment has raised significant human health concerns, specifically on immune function. However, the underlying molecular mechanisms behind NPP induced immune cell (monocyte/macrophage) toxicity and their relationship with existing pathological conditions remain largely unexplored. The current study explored the interaction of NPPs with serum proteins and composition of protein corona through proteomic analysis (LC‐HRMS/MS). Further, we investigated the immunotoxic effects on THP‐1 macrophage cells via various cellular and molecular assays, including cytotoxicity, oxidative stress, mitochondrial function, intracellular calcium homeostasis, apoptosis and stress signaling pathway assessment. This study further assessed the amplification potential of NPPs on inflammatory (TNF α and lipopolysaccharide), atherogenic (ox‐LDL) and environmental (polycyclic aromatic hydrocarbons (PAH)) stress conditions. The findings demonstrated that NPPs triggered cytotoxicity in a dose dependent manner along with excessive ROS generation, mitochondrial impairment, elevated intracellular calcium levels and apoptosis by altering BAX and BCL2 expression. We also found that NPPs activated stress signaling pathways through modulating HSP27, SAPK/JNK, p38 MAPK and c‐Jun phosphorylation. Interestingly, pathway inhibition studies confirmed the involvement of p38 MAPK, ERK and mitochondrial ROS signaling in NPP‐associated toxicity. In addition, NPPs exposure augmented inflammatory response, promoted atherogenesis (foam cell formation), amplified PAH induced toxicity. Together, these observations revealed precise adverse outcome pathways (AoP) and stress amplification effects of NPPs on macrophages and consequent toxic effects on the immune system.

Keywords: immune system, macrophages, nanoplastics, oxidative stress, THP‐1 cells


Polystyrene nanoplastic particles (NPPs) interact with serum proteins, establishing nano‐bio interactions and triggering ROS‐mediated macrophage toxicity in THP‐1 cells, characterized by oxidative stress, mitochondrial dysfunction, apoptosis and stress‐signaling. NPPs further augment inflammatory responses, promote foam cell formation and amplify PAH‐induced toxicity, collectively elucidate the mode of action underlying NPP‐induced immunotoxicity.

graphic file with name JBT-40-e71103-g007.webp

1. Introduction

Among the various emerging contaminants, plastic pollution has been a major global problem with annual plastic production increased from 1.5 million tons in 1950 [1, 2] to 413.8 million tons in 2023 [3]. In this regard, polystyrene plastics are extensively used in the manufacturing of packing foods, packing foam, toothbrushes, toys and CDs [4]. These plastics products when released into the environment gradually degraded into microplastics (MPs) (< 5 mm) and nanoplastics (NPs) (< 100 nm) [5] and are been found in soil [6], water [7], air [8], and even in human blood [9]. The nanoplastics due to its smaller size, easily enters into the cells which makes them highly toxic [10] and are exposed through ingestion, inhalation or skin contact [11].

Recent studies revealed that NPPs were found in human blood and also indicated their bioavailability and uptake into the human blood stream [9]. Also, a study carried out among workers exposed to styrene showed evidence of DNA damage [12]. Further, exposure of various cell types (KGN, GES‐1, BEAS‐2B, GC‐1) to NPPs shows oxidative damage interlinked via elevated ROS, disturbance in calcium homeostasis and impaired antioxidant enzymes [13]. Another study indicated that NPPs induce apoptosis by promoting mitochondrial ROS generation, ER stress and inflammation in HK‐2 cells by upregulating p38, Bax, cyt C, and pERK expression [14]. Furthermore, NPPs enhance lipopolysaccharide (LPS)‐induced myocardial fibrosis and autophagy by elevating fibrotic proteins and collagen levels via ROS/TGF‐β/Smad pathway [15].

While focusing on the effect on immune system, which acts as a first line of defense against foreign particles, the TEM, SEM, and live‐cell imaging studies clearly demonstrated concentration‐dependent cytoplasmic uptake of polystyrene micro‐ and nanoplastics by the macrophages [16]. In this regard, NPPs stabilized with anionic surfactant dysregulated the lipid metabolism and mediating the progression of atherosclerosis via macrophage foam cell formation in human and murine macrophages [17]. Further, NPPs promotes necroptosis by mitochondrial ROS generation in macrophages [18] and promotes apoptosis via p38 MAPK activation in zebrafish larvae [19]. Another study illustrates that NPPs induce immunotoxicity in fish by disrupting macrophages and neutrophils synthesis and function [20]. In addition, NPPs exposed to splenic lymphocytes disrupts immune function by inducing apoptosis and downregulating T cell activation [21]. Moreover, considering the ubiquitous presence of polycyclic aromatic hydrocarbon (PAH) in the environment, a previous study illustrated the high affinity nature of plastic particles toward PAHs [22]. Several studies demonstrated that co‐exposure of microplastics and PAHs resulted in oxidative stress, altered lipid metabolism and inflammatory responses in marine bivalve species [23].

Although the impacts of NPPs have been reported in various biological systems, their comprehensive effects on human macrophages and on vulnerable populations (with pathogenic stress and environmental stress conditions) remain unclear. In addition, limited information is available regarding the influence of NPPs on serum protein interaction and corona formation. Addressing these knowledge gaps will improve our understanding of the immunotoxic potential of NPPs under real exposure conditions. Therefore, the current study elucidated the impact of NPPs on serum protein corona formation and explored the cellular and molecular impacts of NPPs on THP‐1 macrophages by evaluating cellular stress and associated signaling pathways. In addition, the study examined the toxicity/pathogenicity amplification potential of NPPs on inflammatory (TNF‐α and LPS), atherogenic (ox‐LDL) and environmental (PAH) stress conditions.

2. Materials and Methods

2.1. Physical Characterization of NPPs

2.1.1. Size Characterization in Dynamic Light Scattering (DLS)

Particle size distribution measurement was performed using Anton paar lightsizer 500 instrument (Anton paar, Australia). NPPs were diluted to 100 µg/mL and measured in distilled water immediately after 30 min. Values for water properties used for measurement were as follows: refractive index = 1.330, dielectric constant = 78.5 and viscosity at 25°C = 0.89 mPa.s. Particle size was measured as a function of the light scattered by individual nanoplastics which was calculated by the Stokes‐Einstein equation (R H = kT/6πηD), where k = Boltzmann constant, T = temperature (298 K), and η = viscosity of water at 25°C [24]. All size distributions were derived from 10 individual scans.

2.1.2. Scanning Eelectron Microscopy (SEM) Imaging

The morphology of NPPs was analyzed using the Scanning Electron Microscopy (TESCAN—MIRA3 XMU Field Emission SEM) method as described previously [25]. Briefly, 1 μL of sample was placed on a sample holder and air dried. The sample was coated with a thin chromium film using sputtering before analysis.

2.2. Chemicals and Reagents

The NPPs utilized in this study (diameter: 100 nm, density: 1.05 g/cm3) were commercially procured from Sigma‐Aldrich, USA (Catalogue no: 43302) in the form of an aqueous suspension as described earlier [25, 26, 27]. Reagents including RPMI 1640 culture medium, fetal bovine serum (FBS), cell culture growth factors, caspase‐3, ‐9 substrates, protein kinase pathway inhibitors (FR180204, SP600125, 4‐Phenylbutyric acid, fasudil hydrochloride, AG490, (5Z)‐7‐Oxozeaenol, SB202190, lithium chloride, MitoTEMPO, N Acetyl cysteine (NAC) and PDTC), Phorbol‐12‐myristate‐13‐acetate (PMA), TNF‐α, lipopolysaccharide (LPS), molecular biology grade water and 16 PAHs kit were obtained from Sigma‐Aldrich, USA. Fluorophores employed in cell culture experiments were obtained from Invitrogen, Thermo Fisher, USA. All the other reagents were all commercially accessible and of the highest purity. Where necessary, the experiments used ultrapure water from the Arium pro UV ultrapure water system (Sartorius, Germany).

2.3. Cell Culture Conditions and NPPs Exposure

The human monocytic leukemia cell line THP‐1 was acquired from the National Centre for Cell Science (NCCS), Pune, India. Cell lines were grown in RPMI 1640 medium enriched with 10% FBS, penicillin (100 units/mL), streptomycin (100 µg/mL), 0.05 mM 2‐mercaptoethanol (BME) (2 µL) along with appropriate growth factors. Cells were properly maintained in a humidified atmosphere (95% air and 5% CO2) at 37°C using an incubator (Nectarnova, Symbiogen, Japan) and passaged when it reaches 80%–90% confluence. Macrophage differentiation was achieved by the addition of 25 nM phorbol 12‐myristate 13‐acetate (PMA) for 48 h and then incubated another 24 h without PMA as described previously [28] before NPPs exposure. The cells were treated with 50, 100, 200, and 400 μg/mL NPPs for assessing cytotoxic effects. Based on viability analysis, 200 μg/mL was selected as the highest concentration that did not significantly reduce cell viability. Hence, subsequent stress related assays were performed by 50, 100, and 200 μg/mL NPPs. Fluorescence based experiments were carried out using tissue culture grade clear bottom black 96 well plates (Invitrogen, USA).

2.4. Cellular Impacts of NPPs

2.4.1. Cell Viability Assessment—Resazurin Assay

Resazurin assay was performed to analyze the cell viability/cytotoxicity as described earlier [29]. Mitochondrial enzymes in viable cells reduces the resazurin to fluorescent resorufin, indicating viable cells. Following the treatment, 80 µM resazurin (Sigma‐Aldrich, USA) was added and placed in incubator at 37°C for 4 h. Fluorescence intensity was quantified at 540/590 nm using a BioTek Synergy H1MFG reader. Percentage of cell viability was calculated from fluorescence values (a.u.) relative to control.

2.4.2. Caspase‐3, ‐9 Activity Assay and Apoptosis Validation

Caspase‐3 and ‐9 activities were evaluated using Ac‐DEVD‐pNA and Ac‐LEHD‐pNA substrates, respectively. Hydrolysis of the substrates releases pNA, which was analyzed by measuring absorbance at 405 nm [30] using a BioTek Synergy H1MFG reader. Activities were presented as fold change relative to control. Apoptosis was assessed by a flow cytometry method employing an FITC Annexin‐V/Dead cell apoptosis kit (Invitrogen, USA). Annexin V selectively binds to phosphatidyl serine that is shifted from inner to outer plasma membrane surface during early apoptosis, whereas Propidium iodide (PI) detects late apoptotic, necrotic and dead cells [31]. Concisely, the treated cells were dispersed in 100 µL binding buffer, incubated with 5 µL of Annexin V/FITC and 5 µL propidium iodide at room temperature for 15 min. Cells were subsequently diluted with 400 µL binding buffer and analyzed using BD FACSVerse flow cytometer.

2.5. Cellular Oxidative Stress Effects of NPPs

To measure cellular superoxide (O2 −) anions, the cells were loaded with 5 µM DHE (Dihydroethidium) for 30 min at 37°C after treatment [32]. DHE reacts with O2 − produces red fluorescent products, including 2‐hydroxyethidium or ethidium [33]. Fluorescence was measured at 510/590 nm using a BioTek Synergy H1MFG multimode microplate reader and the data were presented in arbitrary unit (a.u.). To measure the intracellular ROS production level, the cells were incubated with 10 μM H2DCFDA (Invitrogen, USA) for 45 min at 37°C in CO2 incubator. This probe easily traverses the cells, deacetylated into H2DCF by esterases within the cell and gets oxidized into green fluorescent DCF by reactive oxidants [34]. Fluorescence was measured at 485/530 nm using a BioTek Synergy H1MFG multimode microplate reader and the data were presented in arbitrary unit (a.u.) [35]. To measure the lipid peroxidation in live cell membranes, cells were incubated with 1 μM BODIPY 581/591 C11 undecanoic acid lipid peroxidation probe for 30 min at 37°C after treatment. Oxidation of the polyunsaturated butadienyl portion of the probe by reactive lipid derived radicals alters the fluorescence of the probe from red to green Fluorescence was measured at both non‐oxidized (580/610 nm) and oxidized (485/510 nm) forms using a BioTek Synergy H1MFG multimode microplate reader and lipid peroxidation was quantified ratiometrically [29].

2.6. Mitochondrial Effects of NPPs

To assess the mitochondrial super oxide generation, cells were incubated with 5 μM MitoSOX Red fluorophore at 37°C for 30 min after treatment as described earlier [36]. This probe specifically accumulates in the energized mitochondria due to the presence of lipophilic methyltriphenylphosphonium cation and gets oxidized by mitochondrial ROS, which results in the generation of red fluorescence The relative signal intensity in cell was quantified at 510/580 nm using a BioTek Synergy H1MFG reader. To estimate the mitochondrial membrane potential, cells were incubated with 100 nM of a cationic and lipophilic dye tetramethylrhodamine ethyl ester (TMRE) at 37°C for 30 min after treatment. TMRE specifically accumulates within mitochondria with high membrane potential. The relative signal intensity in cell was measured at 540/580 nm using a BioTek Synergy H1MFG multimode microplate reader and the data were presented in arbitrary unit (a.u) [37].

2.7. Autophagy Evaluation in Cells—AO Staining

The cellular autophagy was quantified by incubating cells with acridine orange (AO) dye [29]. AO emits red fluorescence in the acidic vesicle organelles, while cytoplasm appears as green. The high‐resolution fluorescence microscope (12 MP) (Amscope, USA) was utilized to observe the fluorescence intensity along with cell morphology. The fluorescence quantification was performed from 10 random cell images using ImageJ software.

2.8. ER Stress and Protein Aggregation Detection by Thioflavin T

To assess the endoplasmic reticulum stress, cells were incubated with 5 µM of Thioflavin T (ThT) in each well of a 24‐well plate for 30 min at 37°C, following the treatment schedule. ThT specifically binds to protein aggregates [38]. Further, 150 µL of Triton (0.1%) was added in PBS to lyse the cells and 100 µL of the cell lysate was transferred to a 96 well plate for fluorescence analysis at 485/535 nm using a BioTek Synergy H1MFG multimode microplate reader. The fluorescence intensity was normalized to total protein levels.

2.9. Cell Imaging Experiments

The microplate‐based assays were validated using the fluorescence imaging experiments for the control and highest dose of exposure (200 µg/mL). Cells grown on glass cover slips placed in 24‐well culture plates were subjected to treatment. Further, fluorophores such as DHE, DCFDA, MitoSOX Red, TMRE, and ThioflavinT were added with appropriate concentrations as described in earlier sections. The high‐resolution fluorescence microscope (12 MP) (Amscope, USA) was utilized to visualize the stained cells by appropriate Ex/Em filters and the fluorescent images were analyzed using ImageJ software [39].

2.10. Intracellular Calcium Flux—Fura‐2 AM Assay

The intracellular calcium levels (Ca2+) were measured by incubating the cells with a calcium‐binding fluorescent dye, Fura 2‐AM (Sigma Aldrich) [39] (5 µM) at 37°C for 30 min, after treatment. The shift of fluorescence was measured using dual excitation and emission method (Excitation: 340 and 380 nm; Emission: 510 nm) by BioTek Synergy H1MFG multimode microplate reader. The unbound or calcium‐free Fura dye was examined at excitation/emission wavelengths of 380/510 nm while the calcium‐bound dye was evaluated at 340/510 nm. The 340/380 ratio was estimated to determine calcium levels between groups and presented as fold change.

2.10.1. Live‐Cell Ca2+ Imaging Using Confocal Microscope

Intracellular calcium accumulation was visualized using Fura‐2 AM dye. Cells were incubated with Fura‐2 AM as mentioned in earlier section and subjected for fluorescent imaging employing confocal laser scanning microscope (Olympus FV3000). The images were obtained using Fluoview acquisition and analysis software. Moreover, image analysis was performed through ImageJ [29].

2.11. Western Blotting

Proteins were extracted by lysing the cells in RIPA‐buffer containing protease and phosphatase inhibitors (Sigma Aldrich) and centrifuged at 10,000 × g for 20 min at 4°C. The supernatants were collected to estimate the protein concentration based on BCA protein assay method. Total protein content was separated by 10% SDS‐PAGE and the gel was transferred in PVDF‐membrane. The membranes were blocked using 3% BSA and probed with primary antibodies‐ Phospho‐HSP27, Phospho‐SAPK/JNK, Phospho‐c‐Jun, and Phospho‐p38MAPK (Cell signaling technology, USA). GAPDH antibody served as the internal loading control. After HRP‐conjugated secondary antibody incubation and washing, Enhanced Chemiluminescence (ECL)‐reagent was added onto the membrane [40] and imaged using a digital SLR system [41]. Band density was quantified using ImageJ‐software.

2.12. Impact of NPPs on Gene Expression

After the study period, THP‐1 cells were subjected to total RNA extraction using GenElute Mammalian Total RNA Miniprep Kit (Sigma‐Aldrich). AMV reverse transcriptase and random hexamers were used for synthesizing cDNA from 1 μg of RNA through reverse transcription. The KAPA‐SYBRFAST‐kit (Sigma Aldrich, USA) was used for real‐time qPCR), with ROX reference dye in a QuantStudio System (Thermo‐Fisher). Relative gene expression of TNF‐ α‐FP: 5′‐ATCAGAGGGCCTGTACCTCAT‐3′ and RP: 5′‐AGACTCGGCAAAGTCGAGATA‐3′; BCL2‐FP: 5′ GAACTGGGGGAGGATTGTGG 3′ and RP: 5′ GCCGGTTCAGGTACTCAGTC 3′; BAX‐FP: 5′ CCCCCGAGAGGTCTTTTTCC 3′ and RP: 5′ CCTTGAGCACCAGTTTGCTG 3′; and ß‐actin (internal reference gene)‐FP: 5′ TCGTGCGTGACATTAAGGAGA 3′ and RP: 5′ ATACTCCTGCTTGCTGATCCA 3′. The PCR product specificity was verified by agarose gel electrophoresis and relative expression levels were analyzed using 2ΔΔCt method [42].

2.13. Impact of Pathway Inhibitors and Antioxidants on NPPs Induced Cytotoxicity

As mentioned earlier [42], the cells were pre‐incubated for 2 h with various inhibitors at a fixed concentration as follows: 10 μM ERK1/2 inhibitor (FR180204), 10 μM p38 MAPK inhibitor (SB202190), 10 μM JNK inhibitor (SP600125), 5 mM 4‐Phenylbutyric acid, 10 μM fasudil hydrochloride, 20 mM of lithium chloride (LiCl), 10 μM JAK‐STAT inhibitor (AG490), 1 μM (5Z)‐7‐Oxozeaenol, 3 μM Pyrrolidine dithiocarbamate (PDTC), 1 mM N‐Acetyl cysteine (NAC) and 20 μM MitoTEMPO. After preincubation, the cells were exposed to NPPs (400 μg/mL) and cultured in an incubator for 24 h. Subsequent to treatment, cells were exposed to resazurin for assessing cytotoxicity.

2.14. Effect of NPPs on Inflammatory Milieu

THP‐1 cells were pre‐treated with NPPs (200 µg/mL) for 2 h. Further, TNF‐α (20 ng/mL, 12 h) was used to induce inflammation related stress in differentiated THP‐1 cells and lipopolysaccharide (LPS‐10 µg/mL, 12 h) was used to induce the inflammation related stress in undifferentiated THP‐1 cells. Cell‐viability and ROS were quantified as mentioned in earlier section.

2.15. Impact on Atherogenesis in Macrophages

2.15.1. Atherogenesis—Foam Cell Activation

THP‐1 monocytes were differentiated into macrophages by 160 nM PMA with 10% FBS for 48 h. Then the macrophages were exposed to NPPs (200 μg/mL) for 8 h and subsequently exposed to ox‐LDL (20 μg/mL) (a non‐cytotoxic dose) for 24 h. The oxidant was removed by Hanks’ balanced salt solution before analysis as described previously [43].

2.15.2. Foam Cell Lipid Accumulation—Oil Red O Staining

Oil Red O staining was used to measure the lipid accumulation characteristic of foam cells. After washing, THP‐1 derived macrophages were fixed with 4% formaldehyde for 15 min and stained with Oil Red O (0.3%) for 15 min at 37°C. After isopropanol extraction, the lipid density was measured by absorbance measurement (OD) at 540 nm using a microplate reader (Synergy H1MFG BioTek, USA) as mentioned in previous study [44] and lipid accumulation was visualized under a microscope.

2.15.3. Foam Cell Viability

THP‐1 derived macrophage cells were plated in 96‐well plates and then pretreated with 200 μg/mL NPPs for 8 h and exposed to 20 μg/mL ox‐LDL (a non‐cytotoxic dose) for 24 h. Then, the Resazurin based method was followed as mentioned in earlier section for the evaluation of cell viability [29].

2.16. Polyaromatic Hydrocarbons (PAH) Mix and NPPs Co‐Exposure

Cells were co‐treated with NPPs (200 µg/mL) and a PAH mixture (human exposure relevant blood concentration) consisting of 16 Priority PAH with individual concentration based on human blood levels: acenaphthylene (1.45 ng/mL), phenanthrene (37.95 ng/mL), acenaphthene (0.9 ng/mL), naphthalene (45.5 ng/mL), anthracene (58.1 ng/mL), pyrene (33.0 ng/mL), fluoranthene (50.5 ng/mL), fluorene (6.25 ng/mL), chrysene (5.05 ng/mL), benzo(k)fluoranthene (2.45 ng/mL), benz(a)anthracene (16.25 ng/mL), benzo(a)pyrene (1.6 ng/mL), benzo(a)fluoranthene (2.3 ng/mL), dibenzo(ah)anthracene (5.15 ng/mL), benzo(ghi)perylene (5.05 ng/mL), and indeno(1,2,3‐cd)pyrene (4.7 ng/mL), at total concentration of 276.2 ng/mL [45]. Cells were then evaluated for cell viability and cellular superoxide after 24 h of incubation period.

2.17. Nanoparticle—Human Serum Protein Interaction (Proteomics Study)

To form the protein corona, 100 µL of NPPs suspension was sonicated and mixed with 100 µL of diluted human serum (1:100). The mixture was incubated for 2 h at 37°C with continual shaking at 200 rpm. After incubation, the samples were centrifuged at 20,000 × g for 20 min at 4°C to precipitate the protein corona and the pellets were rinsed 3 times with phosphate buffered saline (PBS) to remove the unbound proteins as detailed in an earlier protocol [39]. The proteins absorbed on NPPs were removed using a gel loading buffer and subject to enrichment through a short gel SDS‐PAGE fractionation method. The gels were cleaned of staining dye and subjected to in‐gel digestion in 50 mM ammonium bicarbonate buffer with 13 ng/µL trypsin and processed as described previously [29]. Protein corona was analyzed by high precision proteomic profiling using liquid chromatography‐mass spectrometry (LC‐MS) [46, 47] using a nano‐ACQUITY UPLC chromatographic system (Waters, Manchester, UK) coupled with a Q‐TOF mass spectrometer (SYNAPT G2 High‐Definition MS System, Waters). Proteins in complex samples were identified by proteomics v4.2 software (Non‐Linear Dynamics, Waters) through Progenesis QI. The peptide sequences were compared against the UniProt database (https://www.uniprot.org/) [39].

2.18. Statistical Analysis

GNU‐PSPP statistical analysis software (Boston, USA) was used for statistical analysis. The values were expressed as means ± SD for data interpretation. The current study employed one‐way ANOVA with Tukey‐HSD test and independent t test. A p‐value of <0.05 was stated as statistically significant.

3. Results

3.1. Physical Characterization of NPPs

The hydrodynamic size of NPPs was determined using DLS measurements. The average particle size is shown in the Figure 1a and are found to be 164 nm. Further, SEM analysis illustrates that the NPPs are homogenous and with the same size (100 nm). As shown in Figure 1b, the NPPs tend to form a homogenous tridimensional structure and sometimes, due to their physico‐chemical properties (shape, surface charge, size) they clump together.

Figure 1.

Figure 1

Physical characterization of NPPs. The size distribution analysis of NPPs by DLS (a) and its morphological analysis using SEM imaging (b).

3.2. Effect of Cell Viability and Cytotoxicity

Figure 2a illustrates the dose dependent cytotoxicity of NPPs in THP‐1 derived macrophage cells. The results showed a significant (p < 0.05) decrease in cell viability at 400 µg/mL in macrophages when compared to the control and other treated groups (50, 100, and 200 µg/mL).

Figure 2.

Figure 2

Effect of NPPs on cell viability and cell death. The dose dependent effect of NPPs on cell viability (a), caspase 3 activity (b), caspase 9 activity (c). The flow cytometry analysis of THP‐1 macrophages exposed to polystyrene nanoplastics (NPPs) control (d), cells treated with 200 µg/mL NPPs (e), and cells treated with 400 µg/mL NPPs (f). The represented data are mean ± SD of three identical experiments. Values marked with different letter represent statistically significant differences between each other (p < 0.05).

3.3. Apoptotic Cascade—Caspase 3 and 9 Activity Assay

Figure 2b,c shows the dose dependent effects on apoptotic cascade enzymes (caspase 3 and 9) activity in THP‐1 derived macrophage cells, respectively. The results indicate a significant (p < 0.05) increase of both caspase 3 and 9 activity at 400 µg/mL NPPs exposure when compared to the control and other treated groups (50, 100, and 200 µg/mL).

3.4. Validation of Apoptosis in Cells

The dose dependent cytotoxicity and apoptotic caspase activity results were further confirmed by flowcytometry observation. The flow cytometry results illustrate that NPPs exposure at 400 µg/mL notably elevates both early and late apoptotic (without necrotic) cells when compared with control and 200 µg/mL exposed cells (Figure 2d–f).

3.5. Effect of NPPs on Cellular Oxidative Stress

The dose‐dependent effect of NPPs on total ROS, cellular superoxide generation and lipid peroxidation (oxidation ratio of BODIPY C11) in THP‐1 derived macrophage cells were illustrated in Figure 3a,d,c, respectively. The results show that NPPs exposure significantly (p < 0.05) increased the total ROS generation at the dosage range of 50, 100, and 200 µg/mL relative to the control. Further, the fluorescent images exhibited increased total ROS and cellular superoxide generation at 200 µg/mL relative to the control (Figure 3b,e), respectively. Notably, cellular superoxide generation and lipid peroxidation were significantly (p < 0.05) elevated at 100 and 200 µg/mL (with significant difference between them) as compared to the control and 50 µg/mL.

Figure 3.

Figure 3

Effect of NPPs on cellular oxidative stress. The dose dependent effect of NPPs on THP‐1 cells: total ROS generation (a), lipid peroxidation (c), superoxide generation (d), mitochondrial membrane potential (f), mitochondrial superoxide generation (g) and the representative fluorescence images corresponding to ROS, superoxide, mitochondrial membrane potential and mitochondrial superoxide are shown in (b, e, i, h) respectively. The scale bar is 100 µm. The represented data are mean ± SD of three identical experiments. Values marked with different letter represent statistically significant differences between each other (p < 0.05).

3.6. Impact of NPPs on THP‐1 Cell Mitochondria

The dose dependent (50, 100, and 200 µg/mL) effect of NPPs on cellular mitochondrial superoxide generation and mitochondrial membrane potential (Δψm) in THP‐1 derived macrophage cells were illustrated in Figure 3g,f, respectively. The result indicated a significant (p < 0.05) increase of mitochondrial superoxide production and decreased membrane potential at 100 and 200 µg/mL (with significant difference between them) exposed group in relation to control and 50 µg/mL exposed groups. These findings were validated at the cellular level by fluorescence microscopy in cells exposed to 200 µg/mL compared with the control (Figure 3h,i), respectively.

3.7. Effect of NPPs on ER Stress and Autophagy

The increasing intensity of ThT fluorescence indicated the unfolded proteins accumulation due to increased ER stress. In the present investigation, a significant (p < 0.05) increase of ThT fluorescence was identified at 100 and 200 µg/mL (with significant difference between them) NPPs exposed THP‐1 derived macrophage cells when compared with control and 50 µg/mL (Figure 4b). This finding is validated at the cellular level by fluorescence microscopy in cells exposed to 200 µg/mL compared with the control (Figure 4d).

Figure 4.

Figure 4

Effect of NPPs on cellular stress, protein and gene expression. The dose dependent effect of NPPs on THP‐1 cells: Intracellular calcium (a), validated by Fura‐2 AM green fluorescence imaging (c) and ER stress (b) with representative fluorescence image (d). Representative fluorescence images showing NPP induced autophagy in THP‐1 cells (e). The scale bar is 100 µm. The represented data are mean ± SD of three identical experiments. Values labeled with different letter indicate statistically significant differences with each other (p < 0.05). Representative western blots (f) and relative expression ratios of stress signaling proteins expression (g) in THP‐1 macrophages. The relative fold change of gene expression in THP‐1 cells (h). Values marked with a distinct symbol (*) represent statistically significant differences between each other (p < 0.05), whereas, “N.S.” represent statistical non‐significant with each other (p > 0.05).

For autophagy evaluation, acridine orange staining exhibited green fluorescence in the cytoplasm and nucleolus and bright red or orange‐red fluorescence in the acidic compartments. In the present study, the formation of acidic vesicular organelles (AVOs) was evident in THP‐1 derived macrophage cells exposed to NPPs (200 µg/mL) (Figure 4e).

3.8. Intracellular Calcium Flux and Microscopic Validation

The intracellular free calcium level indicated by the ratio of calcium unbound and calcium bound signals of Fura‐2 AM dye was depicted in the Figure 4a. The results indicated that NPPs exposure at 100 and 200 μg/mL significantly (p < 0.05) elevated the intracellular calcium level (with significant difference between them) compared to control and 50 µg/mL exposed THP‐1 derived macrophage cells. The above result was validated through confocal microscopic images (Figure 4c) and revealed a noticeable elevation of fluorescence signal intensity of Fura‐2 AM dye (Ca2+ bound form) in the highest dose (200 μg/mL) of NPP exposed group.

3.9. Western Blotting

Figure 4f,g illustrates the representative western blots of phosphorylated proteins and relative expression ratios (bar chart), respectively. The findings demonstrated that phosphorylation levels (activation) of HSP27, SAPK/JNK, p‐38MAPK, and c‐Jun were significantly (p < 0.05) increased in NPPs (200 µg/mL) exposed THP‐1 derived macrophage cells in comparison with control.

3.10. Gene Expression

Figure 4h illustrate the changes of gene (mRNA) expression in THP‐1 cell during NPPs exposure. The results indicated that NPPs exposure at 400 µg/mL significantly (p < 0.05) increased the expression of BAX and decreased the expression of BCL2 against their respective control without any changes in TNF ‐α level (p > 0.05).

3.11. Effect of Pathway Inhibitors on NPPs Induced Cytotoxicity

The current results on the influence of various pathway inhibitors against of NPPs (400 μg/mL) induced cytotoxicity is illustrated in Figure 5a as relative fold change. The results clearly indicate that NPPs exposure (400 μg/mL) significantly (p < 0.05) increased the cytotoxicity. Whereas, the pre‐treatment of THP‐1 derived macrophage cells with kinase inhibitors (p38 MAPK and ERK1/2), chemical chaperone (4‐Phenyl Butyric acid (4‐PBA)) and antioxidants (Mito‐Tempo and NAC) significantly (p < 0.05) prevent the cytotoxic response provoked by NPPs exposure.

Figure 5.

Figure 5

Impact of NPPs on signaling pathways. The impact of pathway inhibitors on cell viability (a). The represented data are mean ± SD of three identical experiments. Values marked with different letter represent statistically significant differences between each other (p < 0.05).

3.12. Stress Amplification Effects of NPPs Under Inflammatory Milieu

The effect of NPPs (200 μg/mL) on cytotoxicity and oxidative stress in THP‐1 macrophage cells under simulated pathogenic/inflammatory milieu by exposing cells with TNF‐α (20 ng/mL) is shown in Figure 6a,b, respectively. In addition, the impact of NPPs (200 μg/mL) on cytotoxicity and oxidative stress in THP‐1 monocyte cells under simulated inflammatory milieu by exposing cells with LPS (10 μg/mL) is illustrated in Figure 6c,d, respectively. Results indicated that NPPs exposure aggravates TNF‐α‐induced cytotoxicity and total ROS generation in a significant (p < 0.05) manner in THP‐1 derived macrophage cells in relation to the control, NPP and TNF‐α alone treated groups. Similarly, NPPs exposure aggravates LPS‐induced cytotoxicity and total ROS generation in a significant (p < 0.05) manner in THP‐1 monocyte cells relative to the control, NPP and LPS alone treated groups.

Figure 6.

Figure 6

Impact of NPPs on pathological risk factor conditions. The effect of NPPs (200 µg/mL) on cell viability (a) and total ROS generation (b) under TNF‐α simulation and cell viability (c) and total ROS generation (d) under LPS simulation.

3.13. Impact of NPPs on Foam Cell Formation (Atherogenesis)

The impact of NPPs on ox‐LDL induced foam cell formation, cell viability and representative oil Red O‐stained images of foam cells are shown in Figure 7a–c, respectively. The results of OD at 540 nm and oil red O images indicate that NPPs exposure (200 µg/mL) aggravates ox‐LDL (20 µg/mL) promoted foam cell formation (atherogenesis) in a significant (p < 0.05) manner in relation to control, NPP alone and ox‐LDL alone treated groups. On the other hand, NPPs exposure does not influence the viability of THP‐1 derived macrophage cells.

Figure 7.

Figure 7

Effect of NPPs on ox‐LDL induced foam cell formation. The impact of NPPs on ox‐LDL induced foam cell formation (a), cell viability (b) and representative oil red O staining images of foam cells (c). The scale bar is 100 µm. The represented data are mean ± SD of three identical experiments. Values marked with different letter represent statistically significant differences between each other (p < 0.05).

3.14. Co‐Exposure of NPPs With PAH

The stress amplification effect of NPPs on 16 PAH mixture (human relevant dose) induced oxidative stress in THP‐1 cells is illustrated in Figure 8a–d. Results shown that co‐exposure of THP‐1 cells with NPPs and PAH significantly (p < 0.05) aggravates/amplifies cytotoxicity, superoxide generation, total ROS production and lipid peroxidation when compared to the control, NPPs and PAH alone treated groups.

Figure 8.

Figure 8

Effect of NPPs co‐exposed with PAH. The impact of NPPs co‐exposed with PAH on cell viability (a), superoxide generation (b), total ROS generation (c) and lipid peroxidation (d). The represented data are mean ± SD of three identical experiments. Values marked with different letter represent statistically significant differences between each other (p < 0.05).

3.15. NPPs—Human Serum Protein Corona Composition

The list of proteins present in NPPs‐protein corona (17 unique proteins) is shown in Table 1, notably including immunoglobulin, apolipoprotein, keratin, shroom3, ZNHIT2.

Table 1.

List of proteins present in NPP‐protein corona.

S. No Accession Name
1 P04433 Immunoglobulin kappa
2 P01624 Probable non‐functional immunoglobulin kappa variable 3–7
3 A0A075B6P5 Immunoglobulin kappa variable
4 P0DOX8 Immunoglobulin lambda‐like polypeptide
5 P0DOY2 Immunoglobulin lambda constant
6 P01619 Immunoglobulin kappa variable 3–20
7 P01834 Immunoglobulin kappa constant
8 P02647 Apolipoprotein A‐I
9 P04259 Keratin_ type II
10 P04264 Keratin_ type II cytoskeletal 1
11 P05783 Keratin_ type I cytoskeletal 18
12 P08729 Keratin_ type II cytoskeletal 7
13 P13645 Keratin_ type I cytoskeletal 10
14 P35527 Keratin_ type I cytoskeletal 9
15 P35908 Keratin_ type II cytoskeletal 2 epidermal
16 Q8TF72 Protein Shroom3
17 Q9UHR6 Zinc finger HIT domain‐containing protein 2

The protein corona composition found through LC‐MS/MS.

4. Discussion

Macrophages are important cellular component in regulating immune function through phagocytosis [48]. In addition, it was documented that nanoparticles are largely found in macrophages, highlighting the immune system's role in attempting to clear the nanoparticles from the system [17]. The present study assessed the impact of NPPs on THP‐1 macrophages through extensive experimental protocols. Initially, the dose‐dependent effect of NPPs on cell viability and apoptosis were analyzed. In this regard, studies stated that nanoplastic exposure on murine preosteoblasts, osteoblasts and preosteoclasts affect the cell viability through ROS formation and apoptosis (through caspase3/7) [49]. Apoptosis can occur through intrinsic and extrinsic pathways, where extrinsic pathway is induced by external stimuli, activating caspase 3 and promoting cell death [50] whereas intrinsic pathway involves loss of mitochondrial membrane permeability, cytochrome c release, caspase 9 activation and ultimately leads to caspase 3 activation and cell death [51]. Moreover, a recent study illustrated that apoptosis initiated in zebrafish through oxidative stress mediated caspase 3 activation [52]. The results illustrate that NPPs exposure induced a dose‐dependent increase in cytotoxicity, accompanied by significant elevation of caspase 3 and caspase 9 in THP‐1 cells and flow cytometry results further verified the induction of both prominent early and late apoptosis in NPP exposed cells. Although 200 µg/mL NPPs did not cause a significant decrease in cell viability, this concentration has activated multiple stress pathways. Thus, the NPPs exposure toxicity needs consideration.

In addition, the evaluation of oxidative stress, a state of imbalance of pro‐oxidant and anti‐oxidant species [53], shows that NPPs increased the total ROS generation, superoxide anion and lipid peroxidation in THP‐1 macrophages. In this context, previous study reported that excessive oxidative stress triggers lipid membrane peroxidation, damage to DNA base and DNA and protein cross‐links, which leads to apoptosis, necrosis, inflammation and mitochondrial dysfunction [54]. Further, oxidative stress is known to cause lipidome wide changes through lipid peroxidation and consequently leads to adverse cellular effects [55]. Another study also illustrates that NPPs can induce lipid peroxidation by increased mitochondrial ROS generation in human and murine macrophages [17]. A recent study revealed that polystyrene microplastics disrupts mitochondrial structure through oxidative stress in mouse GC‐2 cells [56]. Also, imbalance in redox status of the cell leads to pathophysiology of various disease outcomes [57]. Following, another study has documented the intensifying effect of NPPs on mitochondrial ROS generation and stimulated mitochondrial dysfunction by promoting necroptosis in mice and human macrophages [18]. In this regard, the observed results indicated the NPP induced mitochondrial ROS production and depolarization of the membrane potential (mitochondrial dysfunction) in THP‐1 macrophages. Therefore, mitochondrial dysfunction and oxidative stress play a major role which may provide novel mechanistic perceptions on NPPs induced macrophage cell toxicity.

The impact of NPPs on endoplasmic reticulum (ER) stress and intracellular Ca2+ level in THP‐1 macrophages were also studied and found notable variations in these processes. As mentioned in the previous section, NPPs exposure elevates ROS generation. In this regard, there are close connections between oxidative stress and Ca2+ homeostasis where high oxidative conditions trigger dysregulation of Ca2+ homeostasis [58]. Consequently, disruption of Ca2+ homeostasis promotes ER stress [59]. In addition, a recent study reported that NPPs exposure causes lung damage through ROS‐dependent ER stress in BEAS‐2B lung epithelial cells [60]. Previous study demonstrated that polystyrene microplastics exposure triggered oxidative stress and ER stress in juvenile rats, which leads to inflammation and renal apoptosis [61]. ER stress disturbs cell homeostasis, induces apoptosis and enhances foam cell formation and pro‐inflammatory cytokine production in macrophages [62]. The M1 polarization enhancement and concurrent suppression of M2 polarization in response to targeted electric signal were mainly because of Ca2+ influx via voltage‐gated channels [63]. Acridine orange is a cell‐permeable green fluorophore that can be protonated and trapped in acidic vesicular organelles (AVO) which is a quick, accessible and reliable method to assess the volume of AVOs, which increases upon autophagy induction [64]. The observed results indicate increased ER stress and autophagy and elevated intracellular Ca2+ level (calcium accumulation) may mediate via oxidative stress, thereby increasing the attention towards its role during risk assessment of NPPs.

Notably, western blotting unveiled that NPPs elevated the phosphorylation of HSP27, SAPK/JNK, p38 MAPK and c‐Jun expression in THP‐1 macrophages. Heat shock protein 27 (HSP‐27) is a protein that has chaperone, antioxidant and anti‐apoptotic properties and is induced in response to stress [65]. Recent evidences indicate that NPPs elevated HSP‐27 expression in human neural stem cells [66]. In addition, SAPK/JNK, c‐JUN, p38 belongs to mitogen‐activated protein kinases (MAPKs) in mammals plays necessary role in regulating cell proliferation, apoptosis, oxidative stress, inflammation and autophagy [67]. Consistent with the observed results, a study reports that immune dysfunction was induced by NPPs via MAPK pathway [68]. Another study has documented the involvement of p38 and JNK pathways during Al2O3‐NPs nanoparticle induced oxidative distress [69]. c‐Jun overexpression was observed in many kinds of autoimmune diseases [70]. Therefore, the current study revealed the plausible cell stress conditions and adaptive responses by THP‐1 cells via increased phosphorylation of various cell stress signaling proteins, which in turn activate its signaling pathways during NPPs exposure.

While focusing on apoptosis and inflammation related expression of gene, the BCL2 family proteins is vital for organismal development, tissue homeostasis and precisely regulate apoptosis. Further, the BCL2 associated X protein (BAX) is a key factor in mitochondrial mediated cell death [71]. Apoptosis (programmed cell death) is determined by the BAX/BCL2 protein ratio, where a higher ratio promotes apoptosis and a lower ratio inhibits it [72]. In this connection, previous research has shown that NPPs and triclosan coexposure profoundly enhanced apoptosis by elevated cleaved caspase‐3 protein expression and reduced the BCL2/BAX ratio [73]. In addition, polystyrene nanoplastics and okadaic acid coexposure significantly increased the number of BAX/BCL2 homodimers in cells and promotes the apoptosis via the release of cytochrome c and other substances and activate caspase‐9 and 3 through the mitochondrial pathway [74]. Further, it has already been revealed that interleukin‐6 (IL‐6) and tumor necrosis factor alpha (TNF‐ α) expression is significant in cardiovascular inflammatory response [75]. Previous study revealed that microplastics exposure triggers the secretion of both inflammatory cytokines (IL‐6, TNF) and anti‐inflammatory cytokines (IL‐10) in primary human monocytes potentially as a feedback mechanism [76]. Other studies have also indicated that MPs and NPPs in vitro exposure changed the expression of other prominent inflammatory markers, including TNF‐ α, IL‐1β, and IL‐8 [77]. In this connection, the current study indicates that at 400 µg/mL dosage exposure elevates BAX expression and decreases BCL2 expression illustrates the involvement of mitochondrial pathways during apoptosis. Alternatively, the expression of TNF‐α indicates that, NPPs may not have direct effect on inflammatory response in THP‐1 macrophage cells which require further validations with other inflammatory mediators such as IL‐1β, IL‐6, IL‐8, MCP‐1, etc.

Furthermore, the pathway inhibitor study indicates that p38 and ERK inhibitors, chemical chaperone (4PBA) and antioxidants (NAC and mitoTEMPO) show protective effect against NPPs induced cytotoxicity. In this regard, an earlier study documented that NPPs induce p38 MAPK activation and apoptosis by eliciting oxidative stress in macrophage cells and zebrafish [19]. Also, ERK1/2 belonging to MAPK family is known to associated with cytokine production [78]. Consistent with previous findings, ERK inhibition significantly attenuates NPP‐induced cellular toxicity [79]. As a chemical chaperone, 4‐phenyl butyric acid (4‐PBA) inhibits ER stress by promoting protein refolding [80], reducing Ca2+ levels and inhibiting the expression of the IRE1/XBP1 ERS pathway and apoptotic factors during NPPs and LPS combined exposure in HEK293 cells [81]. Further, various studies illustrate that Mito‐TEMPO, a mitochondria‐targeted antioxidant, stabilize mitochondrial membrane potential, thereby, preventing autophagy and attenuated glutamate‐induced cytotoxicity in neuroblastoma cells [82] and reduced M1 polarization mediated foam cell formation [83]. Similarly, a recent study indicate that mito‐TEMPO reduced the NPPs induced mtROS generation in RAW 264.7 cells [18]. N‐Acetylcysteine (NAC), a membrane‐permeable cysteine precursor, a potent antioxidant, a ROS scavenger [84] and anti‐inflammatory agent [85] mainly inhibiting the expression of inflammatory cytokines in macrophages [86]. Concomitantly, NAC alleviated AgNPs mediated cell apoptosis by reducing ROS generation, mitochondrial and lysosomal injury, improving autophagy flux, preventing caspase‐3 activation in HUVEC cells [87]. The exploration revealed the involvement of various kinase signaling pathways and oxidative stress mechanism in the cytotoxic effect of NPPs which was alleviated by inhibiting specific kinases and via administration of antioxidants.

The effect of nanoplastic exposure on individuals with preexisting inflammatory milieu (simulated by in vitro exposure of TNF‐α and LPS) needs further investigation. In this regard, the current results illustrate that NPPs co‐exposure aggravates cytotoxicity and increased the total ROS production in TNF‐α and LPS exposed macrophage and monocyte cells respectively. TNF‐α is a cytokine expressed by macrophages which play a vital role in regulation of inflammation and immune responses against infection and external stimuli [88]. Notably, in various cardiovascular pathogenic condition the TNF‐α level was found to be increased in expression [75]. Further, NPPs exposure aggravated LPS induced necroptosis, immune disorders and inflammatory damage to the mice [89]. Thus, the aggravation potential of NPPs on inflammatory conditions needs further attention during risk assessment in vulnerable population with systemic inflammatory stress.

While emphasizing NPPs' atherogenic aggravation potential during ox‐LDL‐induced foam cell formation, a recent study highlights that microplastics contribute to atherosclerotic risk elevation and increased vascular complexity in acute coronary syndrome patients [90]. Foam cells are formed during macrophages infiltrate into the intima of the arterial wall and uptake excessive lipids and this process is a crucial event during atherogenesis [91]. In this regard, cell absorption experiments indicated that macrophages quickly absorb NPPs of 50 and 500 nm size in a time‐dependent manner [92]. Further, a previous study established that silica nanoparticles exacerbate ox‐LDL‐induced lipid accumulation in macrophages and apoptosis through ER stress [93]. Considering this, the current study indicates the elevated lipid accumulation during NPPs’ co‐exposure with ox‐LDL without cytotoxicity. Hence, considering the enhancement effect of NPPs on atherogenesis is recommended during the risk assessment of NPPs exposure in CVD‐prone populations, especially with dyslipidemia.

Exposure to PAHs occurs through many routes, including ingestion of contaminated food and water and inhalation of contaminated air is linked with range of adverse health effects [94]. In this regard, an earlier study explored that co‐exposure to MPs and PAHs, is more toxic compared to single exposure in marine bivalve species [23]. In this connection, another study illustrates that combined exposure to PSMPs and benzo [a] pyrene (a PAH compound) enhances liver damage by inducing altered oxidative stress, inflammatory responses and lipid metabolism in liver [95]. Subsequently, the observed results revealed that NPP and PAH co‐exposure aggravates oxidative stress and lipid peroxidation mediated cytotoxicity. Hence, the vulnerable populations lived at close proximity to environmental PAH exposure (highly polluted area) may multiply the health risk which needs more consideration during NPPs exposure.

The current proteomic study reveals that NPPs interact with human serum proteins. This interaction forms a protein corona comprising 17 unique proteins, including immunoglobulins, apolipoprotein A1, keratin proteins, Shroom3 and ZNHIT2. Immunoglobulins are the essential protein components of the immune system that identify and bind antigens, which leads to the regulation of innate and adaptive immune responses. It is composed of two identical heavy chains and two identical light kappa or lambda chains. Immunoglobulin light chain is crucial for structural stability, antigen interaction and the regulation of autoantibody [96]. Besides intact immunoglobulin, B cells also release excess free light chains into the bloodstream, contributing to immune regulation [97]. Further, a previous study indicated that the changes in the expression of immunoglobulin lambda constant 1 (IGLC1) are linked with tumor progression and immune evasion [98]. Apolipoprotein AI (ApoAI), a major structural and functional protein of high‐density lipoprotein [99]. It plays a pivotal role in cholesterol reversal transport and exerts significant anti‐inflammatory response by mediating the immune cell function [100]. Structural proteins like keratins maintains mechanical stress, mechanical elasticity, cytoskeletal stability and integrity, cellular morphology, cell signaling, thereby influencing structure and mitotic activity [101]. In addition, Shroom3 is involved in maintaining renal function, cardiac development, gut tube morphogenesis [102] and regulating actomyosin organization [103]. Similarly, ZNHIT2 is a part of the zinc finger histidine triad (HIT) domain family [104], which participates in the assembly of U5 snRNP and RNA processing complex [105]. Overall, the current findings suggest that the adsorption of immune, metabolic, cytoskeletal and regulatory proteins on the surface of the nanoplastic may modulate immune responses, cellular organization and regulatory pathways, providing important insights into the biological and pathophysiological impacts of NPPs during health risk assessment.

5. Conclusion

The increasing plastic pollution and its inevitable corresponding exposure, this study emphasizes the need for understanding the underlying mechanisms of nanoplastics toxicity. The present research demonstrates that NPPs exposure triggers macrophage toxicity through ROS mediated mechanism involving oxidative stress, mitochondrial dysfunction and activation of stress signaling pathways. NPPs exposure significantly elevated intracellular and mitochondrial ROS level, lipid peroxidation, calcium signaling, ER stress, autophagy and apoptotic cell death. Pathway inhibition study confirmed the involvement of p38 MAPK, ERK, ER stress and mitochondrial ROS signaling, while activation of HSP27, SAPK/JNK, p38 MAPK and c‐Jun phosphorylation elucidated the mode of action (MoA) during NPPs induced macrophage toxicity. In addition, NPPs exposure shows aggravation potential on inflammation stress, atherogenesis and exacerbated toxic effects under co‐exposure with human exposure relevant concentration of 16 priority PAH mixture. Serum corona profiling demonstrated the initial nano‐bio interaction that may influence the downstream toxicological responses of NPPs. Collectively, these findings provide a valuable understanding on mechanistic insights on immunotoxicity and potential health risks associated during NPPs exposure.

Author Contributions

Jeganathan Manivannan conceived and designed the experiments. Balamurali Mahalakshmi performed the experiments. Balamurali Mahalakshmi, Gobichettipalayam Balasubramaniam Maadurshni and Thittumpuram Manikandan Anjana analyzed the data. Jeganathan Manivannan validated the data. Jeganathan Manivannan, Balamurali Mahalakshmi and Gobichettipalayam Balasubramaniam Maadurshni wrote the paper. All authors read and approved the manuscript.

Funding

The authors have nothing to report.

Conflicts of Interest

The authors declare no conflicts of interest.

Acknowledgments

Balamurali Mahalakshmi, Gobichettipalayam Balasubramaniam Maadurshni and Thittumpuram Manikandan Anjana would like to acknowledge Department of Science and Technology (DST) for Innovation in Science Pursuit for Inspired Research (INSPIRE) fellowship, Tamil Nadu State Council for Higher Education (TANSCHE RGP) for research fellowship and Bharathiar University for University Research Fellowship (URF), respectively.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

References

  • 1. Chen E. Y., Lin K. T., Jung C. C., Chang C. L., and Chen C. Y., “Characteristics and Influencing Factors of Airborne Microplastics in Nail Salons,” Science of the Total Environment 806, no. Pt 4 (2022): 151472, 10.1016/j.scitotenv.2021.151472. [DOI] [PubMed] [Google Scholar]
  • 2. Lai W., Xu D., Li J., et al., “Dietary Polystyrene Nanoplastics Exposure Alters Liver Lipid Metabolism and Muscle Nutritional Quality in Carnivorous Marine Fish Large Yellow Croaker (Larimichthys crocea),” Journal of Hazardous Materials 419 (2021): 126454, 10.1016/j.jhazmat.2021.126454. [DOI] [PubMed] [Google Scholar]
  • 3. https://plasticseurope.org/knowledge‐hub/plastics‐the‐fast‐facts‐2024/ Accesssed 2024.
  • 4. Kik K., Bukowska B., and Sicińska P., “Polystyrene Nanoparticles: Sources, Occurrence in the Environment, Distribution in Tissues, Accumulation and Toxicity to Various Organisms,” Environmental Pollution 262 (2020): 114297, 10.1016/j.envpol.2020.114297. [DOI] [PubMed] [Google Scholar]
  • 5. Lv S., Cui K., Zhao S., et al., “Continuous Generation and Release of Microplastics and Nanoplastics From Polystyrene by Plastic‐Degrading Marine Bacteria,” Journal of Hazardous Materials 465 (2024): 133339, 10.1016/j.jhazmat.2023.133339. [DOI] [PubMed] [Google Scholar]
  • 6. Wahl A., Le Juge C., Davranche M., et al., “Nanoplastic Occurrence in a Soil Amended With Plastic Debris,” Chemosphere 262 (2021): 127784, 10.1016/j.chemosphere.2020.127784. [DOI] [PubMed] [Google Scholar]
  • 7. Zhang K., Shi H., Peng J., et al., “Microplastic Pollution in China's Inland Water Systems: A Review of Findings, Methods, Characteristics, Effects, and Management,” Science of the Total Environment 630 (2018): 1641–1653, 10.1016/j.scitotenv.2018.02.300. [DOI] [PubMed] [Google Scholar]
  • 8. Kirchsteiger B., Materić D., Happenhofer F., Holzinger R., and Kasper‐Giebl A., “Fine Micro‐And Nanoplastics Particles (PM2.5) in Urban Air and Their Relation to Polycyclic Aromatic Hydrocarbons,” Atmospheric Environment 301 (2023): 119670, 10.1016/j.atmosenv.2023.119670. [DOI] [Google Scholar]
  • 9. Leslie H. A., van Velzen M. J. M., Brandsma S. H., Vethaak A. D., Garcia‐Vallejo J. J., and Lamoree M. H., “Discovery and Quantification of Plastic Particle Pollution in Human Blood,” Environment International 163 (2022): 107199, 10.1016/j.envint.2022.107199. [DOI] [PubMed] [Google Scholar]
  • 10. Du B., Li T., He H., et al., “Analysis of Biodistribution and In Vivo Toxicity of Varying Sized Polystyrene Micro and Nanoplastics in Mice,” International Journal of Nanomedicine 19 (2024): 7617–7630, 10.2147/IJN.S466258. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Fontes B. L. M., de Souza E Souza L. C., da Silva de Oliveira A. P. S., da Fonseca R. N., Neto M. P. C., and Pinheiro C. R., “The Possible Impacts of Nano and Microplastics on Human Health: Lessons From Experimental Models Across Multiple Organs,” Journal of Toxicology and Environmental Health, Part B 27, no. 4 (2024): 153–187, 10.1080/10937404.2024.2330962. [DOI] [PubMed] [Google Scholar]
  • 12. Winiarska E., Jutel M., and Zemelka‐Wiacek M., “The Potential Impact of Nano‐ and Microplastics on Human Health: Understanding Human Health Risks,” Environmental Research 251, no. Pt 2 (2024): 118535, 10.1016/j.envres.2024.118535. [DOI] [PubMed] [Google Scholar]
  • 13. Bu W., Cui Y., Jin Y., et al., “Unmasking the Invisible Threat: Biological Impacts and Mechanisms of Polystyrene Nanoplastics on Cells,” Toxics 12, no. 12 (2024): 908, 10.3390/toxics12120908. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Zhu Z., Liao R., Shi Y., et al., “Polystyrene Nanoplastics Induce Apoptosis of Human Kidney Proximal Tubular Epithelial Cells via Oxidative Stress and MAPK Signaling Pathways,” Environmental Science and Pollution Research 30, no. 51 (2023): 110579–110589, 10.1007/s11356-023-30155-x. [DOI] [PubMed] [Google Scholar]
  • 15. Lin P., Tong X., Xue F., et al., “Polystyrene Nanoplastics Exacerbate Lipopolysaccharide‐Induced Myocardial Fibrosis and Autophagy in Mice via ROS/TGF‐β1/Smad,” Toxicology 480 (2022): 153338, 10.1016/j.tox.2022.153338. [DOI] [PubMed] [Google Scholar]
  • 16. Adler M. Y., Issoual I., Rückert M., et al., “Effect of Micro‐ and Nanoplastic Particles on Human Macrophages,” Journal of Hazardous Materials 471 (2024): 134253, 10.1016/j.jhazmat.2024.134253. [DOI] [PubMed] [Google Scholar]
  • 17. Florance I., Chandrasekaran N., Gopinath P. M., and Mukherjee A., “Exposure to Polystyrene Nanoplastics Impairs Lipid Metabolism in Human and Murine Macrophages In Vitro,” Ecotoxicology and Environmental Safety 238 (2022): 113612, 10.1016/j.ecoenv.2022.113612. [DOI] [PubMed] [Google Scholar]
  • 18. Fan J., Liu L., Lu Y., et al., “Acute Exposure to Polystyrene Nanoparticles Promotes Liver Injury by Inducing Mitochondrial ROS‐Dependent Necroptosis and Augmenting Macrophage‐Hepatocyte Crosstalk,” Particle and Fibre Toxicology 21, no. 1 (2024): 20, 10.1186/s12989-024-00578-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Hu Q., Wang H., He C., Jin Y., and Fu Z., “Polystyrene Nanoparticles Trigger the Activation of p38 MAPK and Apoptosis via Inducing Oxidative Stress in Zebrafish and Macrophage Cells,” Environmental Pollution 269 (2021): 116075, 10.1016/j.envpol.2020.116075. [DOI] [PubMed] [Google Scholar]
  • 20. Elizalde‐Velázquez A., Crago J., Zhao X., Green M. J., and Cañas‐Carrell J. E., “In Vivo Effects on the Immune Function of Fathead Minnow (Pimephales promelas) Following Ingestion and Intraperitoneal Injection of Polystyrene Nanoplastics,” Science of the Total Environment 735 (2020): 139461, 10.1016/j.scitotenv.2020.139461. [DOI] [PubMed] [Google Scholar]
  • 21. Li Y., Xu M., Zhang Z., et al., “In Vitro Study on the Toxicity of Nanoplastics With Different Charges to Murine Splenic Lymphocytes,” Journal of Hazardous Materials 424, no. Pt B (2022): 127508, 10.1016/j.jhazmat.2021.127508. [DOI] [PubMed] [Google Scholar]
  • 22. Trevisan R., Uzochukwu D., and Di Giulio R. T., “PAH Sorption to Nanoplastics and the Trojan Horse Effect as Drivers of Mitochondrial Toxicity and PAH Localization in Zebrafish,” Frontiers in Environmental Science 8 (2020): 78, 10.3389/fenvs.2020.00078. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Sun S., Shi W., Tang Y., et al., “The Toxic Impacts of Microplastics (MPs) and Polycyclic Aromatic Hydrocarbons (PAHs) on Haematic Parameters in a Marine Bivalve Species and Their Potential Mechanisms of Action,” Science of the Total Environment 783 (2021): 147003, 10.1016/j.scitotenv.2021.147003. [DOI] [PubMed] [Google Scholar]
  • 24. Maadurshni G. B., Mahalakshmi B., and Manivannan J., “Aluminium Oxide (Al2O3‐NPs) and Titanium Dioxide (TiO2‐NPs) Nanoparticles Induce Immunotoxicity Through Oxidative Stress‐Associated Molecular Pathways in PMA‐Differentiated THP‐1 Macrophage Cells,” Journal of Biochemical and Molecular Toxicology 40, no. 2 (2026): e70737, 10.1002/jbt.70737. [DOI] [PubMed] [Google Scholar]
  • 25. Vecchiotti G., Colafarina S., Aloisi M., Zarivi O., Di Carlo P., and Poma A., “Genotoxicity and Oxidative Stress Induction by Polystyrene Nanoparticles in the Colorectal Cancer Cell Line HCT116,” PLoS One 16, no. 7 (2021): e0255120, 10.1371/journal.pone.0255120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Basini G., Bussolati S., Andriani L., et al., “The Effects of Nanoplastics on Adipose Stromal Cells From Swine Tissues,” Domestic Animal Endocrinology 81 (2022): 106747, 10.1016/j.domaniend.2022.106747. [DOI] [PubMed] [Google Scholar]
  • 27. Huang T., Zhang W., Lin T., et al., “Maternal Exposure to Polystyrene Nanoplastics During Gestation and Lactation Induces Hepatic and Testicular Toxicity in Male Mouse Offspring,” Food and Chemical Toxicology 160 (2022): 112803, 10.1016/j.fct.2021.112803. [DOI] [PubMed] [Google Scholar]
  • 28. Lund M. E., To J., O'Brien B. A., and Donnelly S., “The Choice of Phorbol 12‐Myristate 13‐acetate Differentiation Protocol Influences the Response of THP‐1 Macrophages to a Pro‐Inflammatory Stimulus,” Journal of Immunological Methods 430 (2016): 64–70, 10.1016/j.jim.2016.01.012. [DOI] [PubMed] [Google Scholar]
  • 29. Maadurshni G. B., Mahalakshmi B., Nagarajan M., and Manivannan J., “Aluminium Oxide Nanoparticles (Al2O3‐NPs) Exposure Impairs Cardiovascular Physiology and Elevates Health Risk—Proteomic and Molecular Mechanistic Insights,” Science of the Total Environment 980 (2025a): 179576, 10.1016/j.scitotenv.2025.179576. [DOI] [PubMed] [Google Scholar]
  • 30. Coelho V. R., Viau C. M., Staub R. B., et al., “Rosmarinic Acid Attenuates the Activation of Murine Microglial N9 Cells Through the Downregulation of Inflammatory Cytokines and Cleaved Caspase‐3,” Neuroimmunomodulation 24, no. 3 (2017): 171–181, 10.1159/000481095. [DOI] [PubMed] [Google Scholar]
  • 31. Kari S., Subramanian K., Altomonte I. A., Murugesan A., Yli‐Harja O., and Kandhavelu M., “Programmed Cell Death Detection Methods: A Systematic Review and a Categorical Comparison,” Apoptosis 27, no. 7–8 (2022): 482–508, 10.1007/s10495-022-01735-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Chen J., Rogers S. C., and Kavdia M., “Analysis of Kinetics of Dihydroethidium Fluorescence With Superoxide Using Xanthine Oxidase and Hypoxanthine Assay,” Annals of Biomedical Engineering 41, no. 2 (2013): 327–337, 10.1007/s10439-012-0653-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Pestana C. R., Oishi J. C., Salistre‐Araújo H. S., and Rodrigues G. J., “Inhibition of Autophagy by Chloroquine Stimulates Nitric Oxide Production and Protects Endothelial Function During Serum Deprivation,” Cellular Physiology and Biochemistry 37, no. 3 (2015): 1168–1177, 10.1159/000430240. [DOI] [PubMed] [Google Scholar]
  • 34. Ng N. and Ooi L., “A Simple Microplate Assay for Reactive Oxygen Species Generation and Rapid Cellular Protein Normalization,” BIO‐PROTOCOL 11, no. 1 (2021): e3877, 10.21769/BioProtoc.3877. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Asensio‐López M. C., Soler F., Pascual‐Figal D., Fernández‐Belda F., and Lax A., “Doxorubicin‐Induced Oxidative Stress: The Protective Effect of Nicorandil on HL‐1 Cardiomyocytes,” PLoS One 12, no. 2 (2017): e0172803, 10.1371/journal.pone.0172803. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Li A., Gao M., Liu B., et al., “Inhibition of Mitochondrial Superoxide Promotes the Development of hiPS‐CMs During Differentiation,” Free Radical Biology and Medicine 190 (2022): 94–104, 10.1016/j.freeradbiomed.2022.08.005. [DOI] [PubMed] [Google Scholar]
  • 37. Roy S. S. and Hajnóczky G., “Fluorometric Methods for Detection of Mitochondrial Membrane Permeabilization in Apoptosis,” Methods in Molecular Biology 559 (2009): 173–190, 10.1007/978-1-60327-017-5_13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Yuvaraj S., Ajeeth A. K., Puhari S. S. M., et al., “Chrysin Protects Cardiac H9c2 Cells Against H2O2‐Induced Endoplasmic Reticulum Stress by Up‐Regulating the Nrf2/PERK Pathway,” Molecular and Cellular Biochemistry 478, no. 3 (2023): 539–553, 10.1007/s11010-022-04531-z. [DOI] [PubMed] [Google Scholar]
  • 39. Maadurshni G. B., Mahalakshmi B., Nagarajan M., and Manivannan J., “Human Circulatory Proteome Interaction, Oxidative Stress‐Associated Signalling and Cardiovascular Implications During Titanium Dioxide Nanoparticle (TiO2‐NP) Exposure,” Molecular Omics 21, no. 4 (2025b): 282–302, 10.1039/d4mo00205a [DOI] [PubMed] [Google Scholar]
  • 40. Mruk D. D. and Cheng C. Y., “Enhanced Chemiluminescence (ECL) for Routine Immunoblotting: An Inexpensive Alternative to Commercially Available Kits,” Spermatogenesis 1, no. 2 (2011): 121–122, 10.4161/spmg.1.2.16606. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Khoury M. K., Parker I., and Aswad D. W., “Acquisition of Chemiluminescent Signals From Immunoblots With a Digital Single‐Lens Reflex Camera,” Analytical Biochemistry 397, no. 1 (2010): 129–131, 10.1016/j.ab.2009.09.041. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Nagarajan M., Maadurshni G. B., and Manivannan J., “Bisphenol A (BPA) Exposure Aggravates Hepatic Oxidative Stress and Inflammatory Response Under Hypertensive Milieu—Impact of Low Dose on Hepatocytes and Influence of MAPK and ER Stress Pathways,” Food and Chemical Toxicology 183 (2024): 114197, 10.1016/j.fct.2023.114197. [DOI] [PubMed] [Google Scholar]
  • 43. Luo Y., Sun G., Dong X., et al., “Isorhamnetin Attenuates Atherosclerosis by Inhibiting Macrophage Apoptosis via PI3K/AKT Activation and HO‐1 Induction,” PLoS One 10, no. 3 (2015): e0120259, 10.1371/journal.pone.0120259. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Shi H., Mao X., Zhong Y., et al., “Lanatoside C Promotes Foam Cell Formation and Atherosclerosis,” Scientific Reports 6 (2016): 20154, 10.1038/srep20154. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Zajda K. and Gregoraszczuk E., “Environmental Polycyclic Aromatic Hydrocarbons Mixture, in Human Blood Levels, Decreased Oestradiol Secretion by Granulosa Cells via ESR1 and GPER1 but Not ESR2 Receptor,” Human & Experimental Toxicology 39, no. 3 (2020): 276–289, 10.1177/0960327119886027. [DOI] [PubMed] [Google Scholar]
  • 46. Aneesh Kumar A., Ajith Kumar G. S., Satheesh G., et al., “Proteomics Analysis Reveals Diverse Molecular Characteristics Between Endocardial and Aortic‐Valvular Endothelium,” Genes 12, no. 7 (2021): 1005, 10.3390/genes12071005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Tamhane V. A., Sant S. S., Jadhav A. R., et al., “Label‐Free Quantitative Proteomics of Sorghum Bicolor Reveals the Proteins Strengthening Plant Defense Against Insect Pest Chilo Partellus,” Proteome Science 19, no. 1 (2021): 6, 10.1186/s12953-021-00173-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Wang X., Ji Q., Hu W., et al., “Isobavachalcone Prevents Osteoporosis by Suppressing Activation of ERK and NF‐κB Pathways and M1 Polarization of Macrophages,” International Immunopharmacology 94 (2021): 107370, 10.1016/j.intimp.2021.107370. [DOI] [PubMed] [Google Scholar]
  • 49. Giannandrea D., Parolini M., Citro V., et al., “Nanoplastic Impact on Bone Microenvironment: A Snapshot From Murine Bone Cells,” Journal of Hazardous Materials 462 (2024): 132717, 10.1016/j.jhazmat.2023.132717. [DOI] [PubMed] [Google Scholar]
  • 50. Emre A. S., Mehtap S., Cem D., et al., “Cannabidiol Protects Lung Against Inflammation and Apoptosis in a Rat Model of Blunt Chest Trauma via Bax/Bcl‐2/Cas‐9 Signaling Pathway,” European Journal of Trauma and Emergency Surgery 51, no. 1 (2025): 95, 10.1007/s00068-025-02767-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Wang B., Wang Y., Zhang J., et al., “ROS‐Induced Lipid Peroxidation Modulates Cell Death Outcome: Mechanisms Behind Apoptosis, Autophagy, and Ferroptosis,” Archives of Toxicology 97, no. 6 (2023): 1439–1451, 10.1007/s00204-023-03476-6. [DOI] [PubMed] [Google Scholar]
  • 52. Liu W., Zeng M., Li Y., Chen G., and Wang J., “Polystyrene Nanoplastics Mediate Skeletal Toxicity Through Oxidative Stress and the BMP Pathway in Zebrafish (Danio rerio),” Ecotoxicology and Environmental Safety 285 (2024): 117096, 10.1016/j.ecoenv.2024.117096. [DOI] [PubMed] [Google Scholar]
  • 53. Shadfar S., Parakh S., Jamali M. S., and Atkin J. D., “Redox Dysregulation as a Driver for DNA Damage and Its Relationship to Neurodegenerative Diseases,” Translational Neurodegeneration 12, no. 1 (2023): 18, 10.1186/s40035-023-00350-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54. Kıran T. R., Otlu O., and Karabulut A. B., “Oxidative Stress and Antioxidants in Health and Disease,” Journal of Laboratory Medicine 47, no. 1 (2023): 1–11, 10.1515/labmed-2022-0108. [DOI] [Google Scholar]
  • 55. Manickaraj S., Thirumalai D., Manjunath P., et al., “Oxidative Environment Causes Molecular Remodeling in Embryonic Heart‐A Metabolomic and Lipidomic Fingerprinting Analysis,” Environmental Science and Pollution Research 24, no. 30 (2017): 23825–23833, 10.1007/s11356-017-9997-y. [DOI] [PubMed] [Google Scholar]
  • 56. Liu T., Hou B., Wang Z., and Yang Y., “Polystyrene Microplastics Induce Mitochondrial Damage in Mouse GC‐2 Cells,” Ecotoxicology and Environmental Safety 237 (2022): 113520, 10.1016/j.ecoenv.2022.113520. [DOI] [PubMed] [Google Scholar]
  • 57. Manivannan J., Silambarasan T., Shanthakumar J., Suganya N., and Kanchana S., “Role of Antioxidants in Human Health,” in Omega‐3 Fatty Acids: Keys to Nutritional Health. Springer, 2016, 501–512. [Google Scholar]
  • 58. Ly L. D., Xu S., Choi S. K., et al., “Oxidative Stress and Calcium Dysregulation by Palmitate in Type 2 Diabetes,” Experimental & Molecular Medicine 49, no. 2 (2017): e291, 10.1038/emm.2016.157. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59. Groenendyk J. and Michalak M., “Interplay Between Calcium and Endoplasmic Reticulum Stress,” Cell Calcium 113 (2023): 102753, 10.1016/j.ceca.2023.102753. [DOI] [PubMed] [Google Scholar]
  • 60. Wu Q., Liu C., Liu D., et al., “Polystyrene Nanoplastics‐Induced Lung Apoptosis and Ferroptosis via ROS‐Dependent Endoplasmic Reticulum Stress,” Science of the Total Environment 912 (2024): 169260, 10.1016/j.scitotenv.2023.169260. [DOI] [PubMed] [Google Scholar]
  • 61. Wang W., Guan J., Feng Y., et al., “Polystyrene Microplastics Induced Nephrotoxicity Associated With Oxidative Stress, Inflammation, and Endoplasmic Reticulum Stress in Juvenile Rats,” Frontiers in Nutrition 9 (2023): 1059660, 10.3389/fnut.2022.1059660. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62. Sukhorukov V. N., Khotina V. A., Bagheri Ekta M., Ivanova E. A., Sobenin I. A., and Orekhov A. N., “Endoplasmic Reticulum Stress in Macrophages: The Vicious Circle of Lipid Accumulation and Pro‐Inflammatory Response,” Biomedicines 8, no. 7 (2020): 210, 10.3390/biomedicines8070210. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63. Kong Y., Liu F., Ma B., et al., “Wireless Localized Electrical Stimulation Generated by an Ultrasound‐Driven Piezoelectric Discharge Regulates Proinflammatory Macrophage Polarization,” Advanced Science (Weinheim, Baden‐Wurttemberg, Germany) 8, no. 13 (2021): 2100962, 10.1002/advs.202100962. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64. Thomé M. P., Filippi‐Chiela E. C., Villodre E. S., et al., “Ratiometric Analysis of Acridine Orange Staining in the Study of Acidic Organelles and Autophagy,” Journal of Cell Science 129, no. 24 (2016): 4622–4632, 10.1242/jcs.195057. [DOI] [PubMed] [Google Scholar]
  • 65. Umar H. I., Ajayi A. T., Mukerjee N., et al., “Discovery of Novel HSP27 Inhibitors as Prospective Anti‐Cancer Agents Utilizing Computer‐Assisted Therapeutic Discovery Approaches,” Cells 11, no. 15 (2022): 2412, 10.3390/cells11152412. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66. Martin‐Folgar R., González‐Caballero C., Torres‐Ruiz M., et al., “Molecular Effects of Polystyrene Nanoplastics on Human Neural Stem Cells,” PLoS One 19, no. 1 (2024): e0295816, 10.1371/journal.pone.0295816. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67. Chen J., Ye C., Wan C., et al., “The Roles of c‐Jun N‐Terminal Kinase (JNK) in Infectious Diseases,” International Journal of Molecular Sciences 22, no. 17 (2021): 9640, 10.3390/ijms22179640. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68. Ma J., Wan Y., Song L., et al., “Polystyrene Nanobeads Exacerbate Chronic Colitis in Mice Involving in Oxidative Stress and Hepatic Lipid Metabolism,” Particle and Fibre Toxicology 20, no. 1 (2023): 49, 10.1186/s12989-023-00560-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69. Maadurshni G. B., Tharani G. K., Udayakumar I., Nagarajan M., and Manivannan J., “Al2O3 Nanoparticles Trigger the Embryonic Hepatotoxic Response and Potentiate TNF‐α‐induced Apoptosis‐Modulatory Effect of p38 MAPK and JNK Inhibitors,” Environmental Science and Pollution Research 29, no. 36 (2022): 54250–54263, 10.1007/s11356-022-19243-6. [DOI] [PubMed] [Google Scholar]
  • 70. Ye F., Li J., Xu P., et al., “RETRACTED ARTICLE: Osteogenic Differentiation of Mesenchymal Stem Cells Promotes C‐Jun‐Dependent Secretion of Interleukin 8 and Mediates the Migration and Differentiation of CD4+ T Cells,” Stem Cell Research & Therapy 13, no. 1 (2022): 58, 10.1186/s13287-022-02735-0. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 71. Zhang Z., Hou L., Liu D., Luan S., Huang M., and Zhao L., “Directly Targeting BAX for Drug Discovery: Therapeutic Opportunities and Challenges,” Acta Pharmaceutica Sinica B 14, no. 6 (2024): 2378–2401, 10.1016/j.apsb.2024.02.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72. Wang Q., Zhang L., Yuan X., et al., “The Relationship Between the Bcl‐2/Bax Proteins and the Mitochondria‐Mediated Apoptosis Pathway in the Differentiation of Adipose‐Derived Stromal Cells Into Neurons,” PLoS One 11, no. 10 (2016): e0163327, 10.1371/journal.pone.0163327. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73. Wang W., Zhou C., Ma Z., et al., “Co‐Exposure to Polystyrene Nanoplastics and Triclosan Induces Synergistic Cytotoxicity in Human KGN Granulosa Cells by Promoting Reactive Oxygen Species Accumulation,” Ecotoxicology and Environmental Safety 273 (2024): 116121, 10.1016/j.ecoenv.2024.116121hat. [DOI] [PubMed] [Google Scholar]
  • 74. Yan L., Yu Z., Lin P., et al., “Polystyrene Nanoplastics Promote the Apoptosis in Caco‐2 Cells Induced by Okadaic Acid More Than Microplastics,” Ecotoxicology and Environmental Safety 249 (2023): 114375, 10.1016/j.ecoenv.2022.114375. [DOI] [PubMed] [Google Scholar]
  • 75. Manivannan J., Shanthakumar J., Rajeshwaran K., Arunagiri P., and Balamurugan E., “Effect of Diosgenin on Cardiac Tissue Lipids, Trace Elements, Molecular Changes, TNF‐α and IL‐6 Expression in CRF Rats,” Biomedicine & Preventive Nutrition 3, no. 4 (2013): 389–392, 10.1016/j.bionut.2013.08.005. [DOI] [Google Scholar]
  • 76. Weber A., Schwiebs A., Solhaug H., et al., “Nanoplastics Affect the Inflammatory Cytokine Release by Primary Human Monocytes and Dendritic Cells,” Environment International 163 (2022): 107173, 10.1016/j.envint.2022.107173. [DOI] [PubMed] [Google Scholar]
  • 77. Mahmud F., Sarker D. B., Jocelyn J. A., and Sang Q. X. A., “Molecular and Cellular Effects of Microplastics and Nanoplastics: Focus on Inflammation and Senescence,” Cells 13, no. 21 (2024): 1788, 10.3390/cells13211788. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78. Weng X., Luo X., Dai X., et al., “Apigenin Inhibits Macrophage Pyroptosis Through Regulation of Oxidative Stress and the NF‐κB Pathway and Ameliorates Atherosclerosis,” Phytotherapy Research 37, no. 11 (2023): 5300–5314, 10.1002/ptr.7962. [DOI] [PubMed] [Google Scholar]
  • 79. Chen Y., Nan Y., Xu L., et al., “Polystyrene Nanoplastics Exposure Induces Cognitive Impairment in Mice via Induction of Oxidative Stress and ERK/MAPK‐Mediated Neuronal Cuproptosis,” Particle and Fibre Toxicology 22, no. 1 (2025): 13, 10.1186/s12989-025-00633-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80. Delmotte P., Yap J. Q., Dasgupta D., and Sieck G. C., “Chemical Chaperone 4‐PBA Mitigates Tumor Necrosis Factor Alpha‐Induced Endoplasmic Reticulum Stress in Human Airway Smooth Muscle,” International Journal of Molecular Sciences 24, no. 21 (2023): 15816, 10.3390/ijms242115816. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81. Li Z., Xu T., Peng L., et al., “Polystyrene Nanoplastics Aggravates Lipopolysaccharide‐Induced Apoptosis in Mouse Kidney Cells by Regulating IRE1/XBP1 Endoplasmic Reticulum Stress Pathway via Oxidative Stress,” Journal of Cellular Physiology 238, no. 1 (2023): 151–164, 10.1002/jcp.30913. [DOI] [PubMed] [Google Scholar]
  • 82. Mukem S., Thongbuakaew T., and Khornchatri K., “Mito‐Tempo Suppresses Autophagic Flux via the PI3K/Akt/mTOR Signaling Pathway in Neuroblastoma SH‐SY5Y Cells,” Heliyon 7, no. 6 (2021): e07310, 10.1016/j.heliyon.2021.e07310. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 83. Su Z., Li C., Wang H., Zheng M., and Chen Q., “Inhibition of DRP1‐dependent Mitochondrial Fission by Mdivi‐1 Alleviates Atherosclerosis Through the Modulation of M1 Polarization,” Journal of Translational Medicine 21, no. 1 (2023): 427, 10.1186/s12967-023-04270-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 84. Kalyanaraman B., “NAC, NAC, Knockin’ on Heaven's Door: Interpreting the Mechanism of Action of N‐Acetylcysteine in Tumor and Immune Cells,” Redox Biology 57 (2022): 102497, 10.1016/j.redox.2022.102497. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 85. Liu N., Li G., Guan Y., et al., “N‐Acetylcysteine Alleviates Pulmonary Alveolar Proteinosis Induced by Indium‐Tin Oxide Nanoparticles in Male Rats: Involvement of the NF‐κB Signaling Pathway,” Ecotoxicology and Environmental Safety 241 (2022): 113812, 10.1016/j.ecoenv.2022.113812. [DOI] [PubMed] [Google Scholar]
  • 86. Sun D., Zhang G., Xie M., et al., “Softness Enhanced Macrophage‐Mediated Therapy of Inhaled Apoptotic‐Cell‐Inspired Nanosystems for Acute Lung Injury,” Journal of Nanobiotechnology 21, no. 1 (2023): 172, 10.1186/s12951-023-01930-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 87. He J., Ma Y., Niu X., et al., “Silver Nanoparticles Induce Endothelial Cytotoxicity Through ROS‐Mediated Mitochondria‐Lysosome Damage and Autophagy Perturbation: The Protective Role of N‐Acetylcysteine,” Toxicology 502 (2024): 153734, 10.1016/j.tox.2024.153734. [DOI] [PubMed] [Google Scholar]
  • 88. Tian J., Hong Y., Li Z., et al., “Immunometabolism‐Modulation and Immunotoxicity Evaluation of Perfluorooctanoic Acid in Macrophage,” Ecotoxicology and Environmental Safety 215 (2021): 112128, 10.1016/j.ecoenv.2021.112128. [DOI] [PubMed] [Google Scholar]
  • 89. Tang X., Fan X., Xu T., et al., “Polystyrene Nanoplastics Exacerbated Lipopolysaccharide‐Induced Necroptosis and Inflammation via the ROS/MAPK Pathway in Mice Spleen,” Environmental Toxicology 37, no. 10 (2022): 2552–2565, 10.1002/tox.23618. [DOI] [PubMed] [Google Scholar]
  • 90. Yang Y., Zhang F., Jiang Z., et al., “Microplastics Are Associated With Elevated Atherosclerotic Risk and Increased Vascular Complexity in Acute Coronary Syndrome Patients,” Particle and Fibre Toxicology 21, no. 1 (2024): 34, 10.1186/s12989-024-00596-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 91. Gui Y., Zheng H., and Cao R. Y., “Foam Cells in Atherosclerosis: Novel Insights Into Its Origins, Consequences, and Molecular Mechanisms,” Frontiers in Cardiovascular Medicine 9 (2022): 845942, 10.3389/fcvm.2022.845942. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 92. Jiang W., Liu Y., Wu Y., et al., “Polystyrene Nanoplastics of Different Particle Sizes Regulate the Polarization of Pro‐Inflammatory Macrophages,” Scientific Reports 14, no. 1 (2024): 16329, 10.1038/s41598-024-67289-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 93. Guo C., Ma R., Liu X., et al., “Silica Nanoparticles Promote oxLDL‐Induced Macrophage Lipid Accumulation and Apoptosis via Endoplasmic Reticulum Stress Signaling,” Science of the Total Environment 631–632 (2018): 570–579, 10.1016/j.scitotenv.2018.02.312. [DOI] [PubMed] [Google Scholar]
  • 94. Gao P., da Silva E., Hou L., Denslow N. D., Xiang P., and Ma L. Q., “Human Exposure to Polycyclic Aromatic Hydrocarbons: Metabolomics Perspective,” Environment International 119 (2018): 466–477, 10.1016/j.envint.2018.07.017. [DOI] [PubMed] [Google Scholar]
  • 95. Li S., Qiao Z., Huang M., et al., “Combined Exposure of Polystyrene Microplastics and Benzo [A] Pyrene in Rat: Study of the Oxidative Stress Effects in the Liver,” Ecotoxicology and Environmental Safety 278 (2024): 116390, 10.1016/j.ecoenv.2024.116390. [DOI] [PubMed] [Google Scholar]
  • 96. Gibson W. S., Rodriguez O. L., Shields K., et al., “Characterization of the Immunoglobulin Lambda Chain Locus From Diverse Populations Reveals Extensive Genetic Variation,” Genes & Immunity 24, no. 1 (2023): 21–31, 10.1038/s41435-022-00188-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 97. Hegen H., Berek K., and Deisenhammer F., “Cerebrospinal Fluid Kappa Free Light Chains as Biomarker in Multiple Sclerosis‐From Diagnosis to Prediction of Disease Activity,” Wiener Medizinische Wochenschrift (1946) 172, no. 15–16 (2022): 337–345, 10.1007/s10354-022-00912-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 98. Wu Z., Xie X., Shi G., Ning K., and Zhao J., “IGLC1 Is an Independent Prognostic Marker and Potent Therapeutic Target in Osteosarcoma,” Discover Oncology 16, no. 1 (2025): 931, 10.1007/s12672-025-02653-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 99. Guo K., Hu C., Li L., et al., “ApoA1/HDL and Sepsis‐Associated Vascular Endothelial Injury: A Narrative Review,” Critical Care 29, no. 1 (2025): 426, 10.1186/s13054-025-05668-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 100. Tao X., Tao R., Wang K., and Wu L., “Anti‐Inflammatory Mechanism of Apolipoprotein AI,” Frontiers in Immunology 15 (2024): 1417270. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 101. Pondeljak N., Lugović‐Mihić L., Tomić L., Parać E., Pedić L., and Lazić‐Mosler E., “Key Factors in the Complex and Coordinated Network of Skin Keratinization: Their Significance and Involvement in Common Skin Conditions,” International Journal of Molecular Sciences 25, no. 1 (2023): 236, 10.3390/ijms25010236. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 102. Liu W., Xiu L., Zhou M., et al., “The Critical Role of the Shroom Family Proteins in Morphogenesis, Organogenesis and Disease,” Phenomics 4, no. 2 (2024): 187–202, 10.1007/s43657-023-00119-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 103. Li A., Cunanan J., Khalili H., et al., “Shroom3, a Gene Associated With Ckd, Modulates Epithelial Recovery After AKI,” Kidney360 3, no. 1 (2022): 51–62, 10.34067/KID.0003802021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 104. Rodríguez C. F. and Llorca O., “RPAP3 C‐Terminal Domain: A Conserved Domain for the Assembly of R2TP Co‐Chaperone Complexes,” Cells 9, no. 5 (2020): 1139, 10.3390/cells9051139. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 105. Serna M., González‐Corpas A., Cabezudo S., et al., “CryoEM of RUVBL1–RUVBL2–ZNHIT2, a Complex That Interacts With Pre‐mRNA‐Processing‐Splicing Factor 8,” Nucleic Acids Research 50, no. 2 (2022): 1128–1146. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.


Articles from Journal of Biochemical and Molecular Toxicology are provided here courtesy of Wiley

RESOURCES