Development of a Colourimetric Loop‐Mediated Isothermal Amplification Assay for Rapid Detection of Streptococcus dysgalactiae

ABSTRACT

Streptococcus dysgalactiae is an emerging fish pathogen that causes streptococcosis, resulting in significant economic losses in aquaculture. Conventional detection methods, such as polymerase chain reaction assays, rely on sophisticated, expensive instrumentation, which limits their applicability in resource‐limited or field settings. In this study, we developed a rapid, user‐friendly and closed‐tube colourimetric loop‐mediated isothermal amplification (LAMP) assay for the detection of S. dysgalactiae . Six primers targeting the sagB gene were designed and assay conditions were optimised to enable visual detection. The LAMP assay produced results within 50 min and detected target bacteria at concentrations as low as 500 pg (1.195 × 10⁸ copies/reaction), with high specificity and no cross‐reactivity observed against eight non‐target bacterial species. Overall, this LAMP assay operates under isothermal conditions and provides clear visual readouts, offering a foundation for future field‐based testing in aquaculture settings using fish and water samples.

1. Introduction

Streptococcus dysgalactiae is an important fish pathogen that causes streptococcosis and significant economic losses in the global aquaculture industry. This bacterium has been increasingly isolated from a wide range of marine and freshwater fish species across Asia, the Middle East, and South America, including kingfish, amberjack, yellowtail, tilapia, cobia, grey mullet, snapper, and pompano; golden pomfret, sturgeon, grass carp, and cyprinids (Abdelsalam et al. ^2010a, 2015; Costa et al. ²⁰¹⁴; Maekawa et al. ²⁰²⁰; Netto et al. ²⁰¹¹; Nomoto et al. ^{2004, 2006}; Pourgholam et al. ²⁰¹¹; Yang and Li ²⁰⁰⁹). The infected fish commonly exhibit skin erosions, caudal peduncle necrosis, haemorrhages, exophthalmia, and corneal opacity, which can progress to high mortality in severe cases (Abdelsalam et al. 2013, 2015).

Conventional diagnosis of S. dysgalactiae infection is typically based on biochemical characterisation and Lancefield grouping. However, these methods can be time‐consuming and may produce inconsistent results due to phenotypic variability and limited taxonomic resolution among isolates, which can lead to misidentification (Jensen and Kilian 2012; Nomoto et al. ²⁰⁰⁴; Hawke et al. ²⁰²¹). Advanced tools such as matrix‐assisted laser desorption/ionisation time‐of‐flight (MALDI‐TOF) mass spectrometry and sequence analysis of the 16S rRNA and manganese‐dependent superoxide dismutase (sodA) genes have enhanced identification accuracy (Hawke et al. 2021; Koh et al. ²⁰⁰⁹), but require comprehensive databases, skilled personnel, and specialised laboratory infrastructure, limiting their application in field or low‐resource settings.

Loop‐mediated isothermal amplification (LAMP) is a rapid and sensitive nucleic acid amplification technique performed at a constant temperature (60°C–65°C) without the need for thermal cycling (Notomi et al. 2000). The assay employs four to six primers targeting distinct regions of the gene, ensuring high specificity (Nagamine et al. 2002). LAMP is also highly sensitive, capable of detecting trace amounts of genomic DNA within 30–60 min (Nagamine et al. 2002). The amplified products can also be visualised by a simple colour change, making LAMP well‐suited for a field‐deployable diagnostic in aquaculture (Yang et al. 2024).

In this study, we developed a rapid colourimetric LAMP assay targeting the sagB gene of S. dysgalactiae , which is involved in the post‐translational modification machinery of the cytolytic toxin streptolysin S (Shannon et al. 2024) and is also present in fish‐associated S. dysgalactiae strains (Abdelsalam et al. ^2010b). The assay's sensitivity and specificity were evaluated in triplicate across two independent biological experiments.

2. Methodology

2.1. Primer Design and Optimisation of LAMP Assay

An 803 bp fragment of the sagB gene was amplified using specific primer pairs (Table 1) and subsequently cloned into a pGEM‐T easy vector (Promega, USA). A positive control plasmid was prepared using the Exprep Plasmid SV kit (GeneAll, Korea). Six LAMP primers were designed using the NEB LAMP Primer Design Tool version 1.4.1 (Table 1). The LAMP reaction was conducted in a total volume of 10 μL, consisting of 5 μL of 2× WarmStart Colourimetric LAMP Master Mix (NEB, USA), 1 μL of 10× LAMP primer mix (Table 1), 1 μL of 50 ng/μL DNA template, and 3 μL of nuclease‐free water, incubated at 65°C for 30 to 60 min. Positive results showed a colour change from pink to yellow, while the non‐template control (NTC) remained pink.

TABLE 1.

Oligonucleotide sequences used in this study.

Purpose	Primer name	Primer set	Nucleotide sequence (5′‐3′)	Concentration (μM)
Cloning	SD_sagB_F	Forward	AACGTCGGAAAAGGCAAGAC	20
	SD_sagB_R	Backward	CGCCAATATCAATGCTACCGT	20
LAMP	F3_P137L1_SD	Forward outer	CGCTTGTGGAGTAAGTGC	2
	B3_P137L1_SD	Backward outer	AGCCCTGATATTTTCCTCC	2
	FIP_P137L1_SD	Forward inner	AGAGTAATCGGGTATAAACCGCCGAAGCACCTATCAAAGATGGT	12
	BIP_P137L1_SD	Backward inner	ACTGCAAAATGGCTTTTATGAGTACGGCTAAGCTGATGACACC	12
	LF_P137L1_SD	Loop forward	CCCAGAAGCACAATTCCTTAACGT	8
	LB_P137L1_SD	Loop backward	TTGCCTTACCAGCATGCCC	8

Note: The design of primers is based on the sagB gene (GenBank accession number: AY033399.1, nucleotide position: 927‐1877).

2.2. Specificity of LAMP

The specificity of the LAMP assay was evaluated using the target bacteria— S. dysgalactiae ATCC 12394 and eight non‐target bacteria, including Streptococcus pyogenes ATCC 19615, Streptococcus agalactiae ATCC 13813, Streptococcus iniae DSM 20576, Streptococcus parauberis DSM 6631, Enterococcus faecalis ATCC 29212, Aeromonas hydrophila ATCC 7966, Vibrio harveyi DSM 19623 and Vibrio vulnificus ATCC 27562. In addition, 10 environmental isolates of Group B Streptococcus and 10 environmental isolates of Aeromonas hydrophila (Cheok et al. 2020; Khor et al. ²⁰¹⁵) were tested. Genomic DNA was extracted from 5 mL of an overnight bacterial culture using the phenol‐chloroform method. The DNA was quantified and diluted to 50 ng/μL. One microliter of the genomic DNA template was subjected to LAMP amplification at 65°C for 50 min. Colour changes were observed, and 2 μL of the LAMP products were detected on 2% agarose gel electrophoresis (AGE) (1st BASE Biochemicals, Singapore) at 120 V for 60 min. Two independent experiments were conducted in triplicate with nuclease‐free water as the NTC.

2.3. Sensitivity of LAMP

The sensitivity of colourimetric LAMP was evaluated using 10‐fold serial dilutions of the positive control plasmid pGEM‐sagB, starting at 50 ng/μL (50 ng/reaction). The subsequent concentrations were 5 ng/μL, 500 pg/μL, 50 pg/μL, 5 pg/μL, 500 fg/μL corresponding to 5 ng, 500 pg, 50 pg, 5 pg, and 500 fg of DNA per reaction, respectively. For each LAMP amplification, 1 μL of each DNA template was used. A positive reaction was indicated by a yellow or orange colour change and a ladder‐like pattern on agarose gel electrophoresis. The limit of detection (LOD) was the lowest concentration at which all three technical replicates yielded positive results. The plasmid copy number (copies/reaction) was determined according to the formula: [concentration of plasmids (ng/μL) × 6.02 × 10²³]/[10⁹ × length of plasmid [803 bp insert + 3015 bp vector] × 660 Da/bp].

3. Results

3.1. LAMP Assay Development

Based on the typical protocol for WarmStart Colourimetric LAMP 2× Master Mix, the reaction mixture was prepared with 10× primer mix consisting of FIP and BIP at 16 μM; F3, B3 at 2 μM; LF, LB at 4 μM. The LAMP reactions were incubated at 65°C. The positive control turned orange at 50 min and became yellow at 60 min (Figure 1a). At 50 min, agarose gel electrophoresis (AGE) showed amplification in the positive control, whereas no band was observed in NTC. However, after 60 min, amplification was detected in both positive and NTC on AGE, consistent with the observations from the LAMP reaction tubes. Consequently, a 50‐min incubation at 65°C was selected for subsequent optimisation experiment. To enhance colour visualisation at 50 min, the concentration of LF and LB primers was increased to 8 μM, at which point the positive control turned bright yellow with ladder‐like patterns under the AGE, while the NTC tube remained pink with no amplification under the AGE (Figure 1b). Thus, a concentration of 8 μM for loop primers was selected.

FIGURE 1.

Optimisation of LAMP assay. (a) Optimisation of incubation time using typical protocols. (b) Optimisation of reaction colour by using increased concentration of loop primers. (c) A preliminary cross‐reactivity panel assessment. (d) Optimisation of inner‐primer concentrations to establish optimal reaction conditions for rapid visual detection.

To assess potential non‐specific amplification, the LAMP assay was pre‐screened against eight non‐target bacterial species. The reaction tube with V. vulnificus turned yellow, displaying a distinct ladder‐like pattern on AGE, while the reaction tube containing S. agalactiae remained pink; however, weak amplification products were detected on AGE (Figure 1c). This non‐specific amplification is likely attributable to the use of six primers in LAMP, particularly the long inner primers at high concentrations, which are known to increase the risk of spurious amplification. Consequently, the inner primer concentration was fine‐tuned from 16 μM to 12 μM to improve assay specificity. When the primer concentration was reduced to 12 μM, no colour changes or bands on AGE were detected for S. agalactiae , V. vulnificus , or the NTC (Figure 1d). Only the positive control produced the expected results, showing a yellow colour and distinct ladder patterns. Consequently, the final optimised conditions for the LAMP were established at 65°C for 50 min using a 10X primer mix containing 12 μM each of the FIP and BIP primers, 2 μM each of the F3 and B3 primers, and 8 μM each of the LF and LB primers. These conditions were applied to all subsequent experiments.

3.2. Specificity and Sensitivity of LAMP

Specificity analysis showed amplification solely in S. dysgalactiae ATCC 12394. All non‐ S. dysgalactiae species, Group B Streptococcus isolates, A. hydrophila isolates, and the NTC remained pink and showed no amplification bands on AGE (Figure 2). No cross‐reactivity or false‐positive amplification was detected, confirming the high specificity of the developed LAMP assay.

FIGURE 2.

Specificity of LAMP assay and corresponding agarose gel electrophoresis.

Sensitivity analysis demonstrated that positive LAMP amplification was observed using control standards of 50 ng, 5 ng, and 500 pg., as evidenced by a clear colour change and distinct banding patterns on agarose gel electrophoresis after 50 min of incubation (Figure 3). At 50 pg, the colour change was weak (pale pink) and faint ladder‐like patterns were observed on the gel. No amplification was detected at 5 pg, 500 fg, or in the NTC, indicating a limit of detection (LOD) of 500 pg/reaction, corresponding to approximately 1.195 × 10⁸ copies per reaction.

FIGURE 3.

Sensitivity of LAMP assay and corresponding agarose gel electrophoresis.

4. Discussion

This study describes the development of a closed‐tube colourimetric LAMP assay for the rapid detection of S. dysgalactiae targeting the sagB gene. The sagB gene was selected over common markers like sodA because it provides a better balance of conservation within species and divergence between species. While housekeeping genes often lack the resolution to distinguish between closely related streptococci, sagB, as a virulence‐associated component of the streptolysin S biosynthetic pathway, is sufficiently unique to ensure high specificity in assays. Streptolysin S is an oxygen‐stable cytolysin that causes the characteristic streptococcal beta‐haemolysis on blood agar and induces cytotoxic effects in macrophages, neutrophils, and keratinocytes (Shannon et al. 2024). Its prevalence across geographically distant regions, including the United States, Japan, and Singapore, as well as in various hosts like channel catfish, Nile tilapia, amberjack, confirms its reliability as a diagnostic target for fish‐origin S. dysgalactiae (Abdelsalam et al. ^2010a; Alves‐Barroco et al. ²⁰²¹; Balami et al. ²⁰²⁵; Koh et al. ²⁰²⁰).

In silico multiple sequence alignment of the sagB gene across fish‐derived S. dysgalactiae and closely related Streptococcus species confirmed high intraspecific conservation (97%–99% identity) across eight diverse fish isolates. Conversely, sagB exhibited significant interspecific divergence, sharing less than 80% similarity with representative isolates of S. iniae , S. pyogenes , and S. canis (Figure S1). These BLASTN results, supported by the accession numbers provided (Table S1), validate sagB as a robust diagnostic marker capable of discriminating S. dysgalactiae from co‐occurring streptococcal pathogens.

Our optimisation demonstrated that careful control of incubation time and primer concentrations is essential for reliable LAMP performance. Specificity was addressed prior to sensitivity evaluation, as minimising non‐specific amplification is a prerequisite for meaningful sensitivity thresholds. By limiting the reaction to 50 min at 65°C and adjusting both loop and inner primers, we effectively minimised non‐specific amplification. As demonstrated by our results, adjustment of the inner primer concentration led to clear colour differentiation, effectively eliminating false‐positive signals from non‐target bacteria. These findings underscore the importance of parameter optimisation to ensure both specificity and interpretability in field‐deployable LAMP assays.

Furthermore, using a phenol red‐based colourimetric master mix, the closed‐tube LAMP assay allows direct visual detection without opening tubes, reducing contamination and operator error. Unlike endpoint methods that require post‐amplification dyes such as hydroxynaphthol blue, calcein, SYBR Green I, or SYTO dyes, which require opening tubes and consequently increase the risk of contamination and false‐positive results (Yang et al. 2024), the colourimetric LAMP assay allows direct visual detection without opening the reaction tubes. Overall, this built‐in colourimetric format is safer and particularly suited for routine screening and on‐site applications where laboratory containment is limited.

Our developed LAMP assay demonstrated high analytical specificity, with no cross‐reactivity observed with non‐target organisms. It achieved a detection limit of 500 pg/reaction (1.195 × 10⁸ copies/reaction). Notably, previous studies using different targets and molecular platforms have reported higher sensitivities, including fluorescent LAMP targeting the 16S‐23S rRNA intergenic spacer (0.1 pg), ISP gene‐based RAA‐LFD (1.002 × 10² pg/reaction), duplex droplet digital PCR targeting a hypothetical gene (0.04 pg/reaction), and a commercial qPCR kit (YouSeq Ltd ²⁰²⁶) targeting the streptokinase gene (fewer than 100 copies per reaction) (Wang and Liu 2015; Wang et al. ²⁰²⁴; Diana et al. ²⁰²⁴). Although the analytical sensitivity is lower than some fluorescent LAMP, qPCR, or droplet digital PCR methods, those techniques require specialised equipment, trained personnel, and incur higher operational costs. In contrast, our assay offers a rapid (50 min), cost‐effective, and minimal‐equipment alternative, relying solely on isothermal incubation and visual readout.

In this study, the colour changes of all samples were assessed and cross‐validated by gel electrophoresis. In a field‐use context where gel electrophoresis is unavailable, samples that transitioned completely from pink to yellow are considered positive, whereas those that remained pink are considered negative. However, intermediate colours, such as orange or pale pink, should be classified as borderline/inconclusive. These ambiguous samples should be retested to maintain high diagnostic specificity and avoid false‐positive interpretations, or verified on an alternative platform in laboratory settings.

While further optimisation is warranted to enhance analytical sensitivity, particularly for direct testing of low‐biomass samples, the assay provides a practical foundation for the rapid screening of S. dysgalactiae from cultured isolates. With additional validation using fish tissues and environmental water samples, this colourimetric LAMP assay has potential utility for early detection, surveillance, and disease management in aquaculture settings.

Author Contributions

Suat‐Moi Puah: conceptualization, writing – review and editing, supervision. Kek‐Heng Chua: conceptualization, writing – review and editing, supervision, funding acquisition. Tien‐Tien Vicky Lau: conceptualization, investigation, data curation, visualization, writing – original draft.

Funding

The study was supported by Tabung Makmal Molekul Biologi & Mikrobiologi.

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Figure S1: Interspecific divergence of sagB among representative Streptococcus species.

Table S1: BLASTN analysis and corresponding accession numbers validating sagB for differentiation of Streptococcus dysgalactiae from related streptococci.

Data Availability Statement

Data will be made available on request.