Dose-dependent effects of zinc oxide nanoparticles on pre-osteoblast cellular response

Abstract

Zinc oxide nanoparticles (ZnO-NPs) have attracted considerable interest for biomedical applications due to their favorable physicochemical and biological properties; however, their biological effects are highly concentration-dependent, and optimal conditions for osteogenic effects remain unclear. In this study, we aimed to systematically evaluate the concentration-dependent effects of ZnO-NP extracts on osteogenic responses in pre-osteoblastic cells. ZnO-NPs were first characterized by transmission electron microscopy (TEM) and X-ray diffraction (XRD), and extracts were prepared at concentrations of 0.01, 0.1, 1, and 10 mg/mL (Zn0.01, Zn0.1, Zn1, and Zn10), respectively. MC3T3 − E1 cells were then exposed to these extracts to assess cytocompatibility and osteogenic activity. Cytocompatibility was assessed using WST-1 cell viability assays and Live/Dead assays, while Zn²⁺ ion release was quantified by inductively coupled plasma mass spectrometry (ICP-MS). Osteogenic activities were performed using quantitative polymerase chain reaction (qPCR) analysis of osteogenic markers, alkaline phosphatase (ALP) activity assay at 7 and 14 days, and Alizarin Red S (ARS) staining for biomineralization up to 21 days. Among the groups, the Zn0.01 group significantly enhanced cell proliferation and viability, whereas the Zn10 group induced marked cytotoxicity. Notably, the Zn0.01 group exhibited the highest upregulation of osteogenic genes, including Runx2, Ocn, and Bsp, together with increased ALP activity and biomineralization. These findings demonstrate that ZnO-NPs exert concentration-dependent biological effects and suggest that low concentrations may support osteogenic responses while maintaining cytocompatibility. This study provides a framework for optimizing the use of ZnO-NPs in hard tissue-related regenerative applications.

Supplementary Information

The online version contains supplementary material available at https://doi.org/10.1038/s41598-026-54164-1.

Introduction

Nanotechnology presents new opportunities to develop advanced biomaterials with enhanced functionalities¹. Nanoparticles (NPs), typically ranging from 1 to 100 nm in size, exhibit unique physicochemical properties that distinguish them from their bulk counterparts². These properties have enabled their widespread application across various biomedical fields, including dental materials, drug delivery systems, tissue engineering, and regenerative medicine³. Compared with conventional materials, NPs can exhibit enhanced interactions with biological systems owing to their nanoscale features, which may be advantageous in certain biomedical contexts⁴. Moreover, advances in nanotechnology have driven the development of nano-enabled biomedical innovations, reflecting the growing interest in nanomaterials for modern healthcare applications^5,6.

Among various metal oxide nanoparticles, zinc oxide nanoparticles (ZnO-NPs) have emerged as a key material due to their excellent physical and chemical properties. ZnO-NPs are extensively used in the rubber industry to enhance the toughness and strength of polymers, and in cosmetic sunscreens owing to their strong ultraviolet (UV) absorption capability^7,8. Beyond these applications, ZnO-NPs have also been employed in diverse industrial fields, including concrete production, photocatalysis, and electrotechnology⁹.

Zinc (Zn) is an essential trace element that plays a vital role in various physiological processes, including cellular differentiation, immune function, endocrine regulation, and protein synthesis¹⁰. Zn also interacts with numerous cellular receptors and membranes, thereby contributing to the maintenance of cellular homeostasis¹¹. Importantly, Zn has been shown to promote osteogenic differentiation and enhance mineralization by regulating osteogenic markers¹². In this context, ZnO-NPs have been classified by the U.S. Food and Drug Administration (FDA) as “generally recognized as safe” (GRAS)^13,14. Owing to their high specific surface area and nanoscale dimensions, ZnO-NPs exhibit enhanced biological activity compared with bulk Zn-based materials, making them attractive candidates for biomedical applications¹⁵.

Several studies have explored the potential applications of ZnO-NPs in dental materials and hard tissue-related biomaterials. For example, Ryu et al. reported that incorporating ZnO-NPs into calcium silicate-based endodontic cement conferred antibacterial properties and reduced pro-inflammatory responses under clinically relevant conditions¹⁶. Similarly, Hia et al. demonstrated that ZnO-NPs incorporated into chitosan/gelatin-based hydrogels exerted synergistic antibacterial and osteogenic effects for hard tissue regeneration¹⁷.

Despite these promising advantages, the biological effects of ZnO-NPs are highly dependent on the local Zn²⁺ concentration. Excessive Zn²⁺ release can disrupt cellular zinc homeostasis, leading to protein dysfunction, impaired immune response, compromised osteogenic activity, and cytotoxicity^18–21. Moreover, the stage-specific effects of ZnO-NPs on osteogenic progression—particularly the differential regulation of early osteogenic commitment and late-stage matrix mineralization—remain poorly defined. A comprehensive evaluation that integrates cytocompatibility, early osteogenic markers, enzymatic activity, and extracellular matrix mineralization remains lacking.

In this study, we aimed to systemically investigate the concentration-dependent effects of ZnO-NP extracts on pre-osteoblastic MC3T3-E1 cells, with a particular focus on identifying an optimal concentration range that promotes osteogenic activity while preserving cytocompatibility. To this end, cytotoxicity, mitochondrial metabolic activity, osteogenic gene expression, alkaline phosphatase (ALP) activity, and biomineralization were evaluated to assess the biosafety and effective osteogenic differentiation of ZnO-NPs. The overall experimental design is schematically illustrated in Fig. 1.

Fig. 1.

Schematic overview of the experimental workflow used to evaluate the physicochemical and biological properties of zinc oxide nanoparticles (ZnO-NPs). ZnO-NPs were characterized by transmission electron microscopy (TEM), X-ray diffraction (XRD), and inductively coupled plasma–mass spectrometry (ICP-MS). ZnO-NPs extracts at different concentrations were then prepared and applied to pre-osteoblastic cells to assess cell viability and osteogenic differentiation.

Results

Characterization of ZnO-NPs

The morphology and particle size of zinc oxide nanoparticles (ZnO-NPs) were examined by transmission electron microscopy (TEM). As shown in Fig. 2A, the ZnO-NPs exhibited an irregular quasi-spherical morphology with noticeable aggregation, which is typical for oxide-based nanopowders due to their high surface energy. Despite partial agglomeration, individual nanoparticles were clearly distinguishable, and the particle size was estimated to be below 100 nm, confirming the nanoscale dimension of the ZnO-NPs.

Fig. 2.

Morphological and crystalline characterization of ZnO-NPs. (A) Transmission electron microscopy (TEM) image showing the morphology of ZnO-NPs. (B) X-ray diffraction (XRD) pattern of ZnO-NPs. The characteristic diffraction peaks (★) correspond to the hexagonal wurtzite ZnO crystal structure. ZnO-NPs, zinc oxide nanoparticles.

As shown in Fig. 2B, the crystalline structure of the ZnO-NPs was further analyzed by X-ray diffraction (XRD). The XRD pattern displayed distinct diffraction peaks at 2 theta values of approximately 31.7°, 34.4°, 36.2°, 47.5°, and 56.6°, which correspond to the (100), (002), (101), (102), and (110) crystal planes of the hexagonal wurtzite ZnO structure (Power Diffraction File 01-079-0207).

Zinc ion measurement from the extraction of ZnO-NPs

The concentration of released zinc ions (Zn²⁺) was quantitatively determined using inductively coupled plasma mass spectrometry (ICP–MS), and the results are summarized in Table 1. Zinc ion concentrations augmented proportionally with the nominal ZnO-NPs content, demonstrating a clear concentration-dependent release profile. The Zn0.01 group exhibited a low zinc ion concentration of 0.430 ± 0.017 µM, indicating minimal ion release at the lowest ZnO-NP loading. In the Zn0.1 group, the zinc ion concentration increased to 4.485 ± 0.210 µM, representing an approximately 10-fold increase compared with the Zn0.01 group. A further substantial increase was observed in the Zn1 group, which released 43.952 ± 2.075 µM of zinc ions, confirming a near order-of-magnitude escalation in Zn²⁺ concentration with increasing ZnO-NP content. The Zn10 group showed a markedly higher zinc ion concentration of 434.400 ± 13.695 µM, serving as a high-concentration reference. Across all groups, the relatively low standard deviations indicate high analytical reproducibility and reliable quantification.

Table 1.

Zinc ion concentrations released from ZnO-NPs measured by ICP-MS.

	Zn0.01	Zn0.1	Zn1	Zn10
Zn2+ conc.	0.430 ± 0.017c	4.485 ± 0.210c	43.952 ± 2.075b	434.400 ± 13.695a

Unit: µM. Zn, Zinc; The different lower-case letters were significantly different among the groups.

Effect of ZnO-NPs concentration on cytotoxicity and mitochondrial metabolic activity

Figure S1 and Table S1 show the cytotoxicity of each extract, as evaluated using MC3T3-E1 cells. Compared with the control group cultured in untreated growth medium, the Zn0.01 group exhibited a significant increase in cell viability of approximately 20% (p < 0.05). In addition, the Zn0.1 and Zn1 groups showed further significant increases in cell viability of approximately 36% and 40%, respectively (p < 0.001). In contrast, the Zn10 group demonstrated a marked 70% reduction in cell viability compared with the control (p < 0.001). Based on these findings, the Zn10 group was excluded from subsequent analyses of cell proliferation and osteogenic differentiation.

The proliferative response of MC3T3-E1 cells to ZnO-NPs was evaluated using a WST-1 assay after 1, 2, and 3 days of culture. As shown in Fig. 3 and Table S2, Zn0.01, Zn0.1, and Zn1 groups showed no acute cytotoxic effects, and there was no significant difference as compared with the control group on day 1. On day 2, the Zn0.01, Zn0.1, and Zn1 groups showed increases of ca. 4.3%, 2.8%, and 1.9%, respectively, compared with the control group. On day 3, the Zn0.01 and Zn0.1 groups showed no significant difference compared with the control group, whereas the Zn1 group showed a reduction of ca. 3% (p < 0.05).

Fig. 3.

Effect of ZnO-NPs on the mitochondrial metabolic activity of MC3T3-E1 cells. Cell proliferation was assessed using a WST-1 assay by measuring absorbance at 450 nm on days 1, 2, and 3 of culture. MC3T3-E1 cells were treated with ZnO-NPs at a concentration of Zn0.01, Zn0.1, and Zn1 as compared with the control group. Data were presented as mean ± standard deviation. Statistical significance was determined by comparison with the control group (n = 3, * p < 0.05, ** p < 0.01, *** p < 0.001, N.S., no significance). Control, growth medium; Zn0.01, 0.01 mg/mL ZnO-NPs extraction; Zn0.1, 0.1 mg/mL ZnO-NPs; Zn1, 1 mg/mL ZnO-NPs; ZnO-NPs, zinc oxide nanoparticles.

Effect of ZnO-NPs concentration on live/dead assay

Figure 4 illustrates the proliferation and viability of MC3T3-E1 cells after 1 and 3 days of culture with ZnO-NP extraction. These findings were further corroborated by Live/Dead staining, in which green fluorescence indicates viable cells and red fluorescence indicates non-viable (dead) cells. As shown in Fig. 4A, MC3T3-E1 cells were successfully attached to all ZnO-NPs, exhibiting morphologies comparable to those observed in the control group. The majority of cells in all groups exhibited strong green fluorescence, with negligible red fluorescence, indicating high cell viability and minimal cytotoxicity.

Fig. 4.

Live/Dead staining of each extraction of ZnO-NPs group as cultured for 3 days, showing the live cells and absence of dead cells. (A) Extraction of ZnO-NPs as cultured for 1 day. (B) Extraction of ZnO-NPs as cultured for 3 days. Control, growth medium; Zn0.01, 0.01 mg/mL ZnO-NPs extraction; Zn0.1, 0.1 mg/mL ZnO-NPs; Zn1, 1 mg/mL ZnO-NPs; ZnO-NPs, zinc oxide nanoparticles.

Moreover, cells in all experimental groups continued to proliferate over the 3 days, as evidenced by increased cell density and confluence in Live/Dead staining images (Fig. 4B). These observations indicate that ZnO-NP extraction supports cell attachment and proliferation without inducing cytotoxic effects. Taken together, the results demonstrate that all ZnO-NP-treated groups maintained comparable or even enhanced biocompatibility relative to the control group under the tested conditions.

Effect of ZnO-NPs concentration on Osteogenic gene expression

Figure 5 and Table S3 present the results of qPCR analysis evaluating osteogenic gene expression in MC3T3-E1 cells treated with different concentrations of ZnO-NPs extract. Among the experimental groups, the Zn0.01 group exhibited the most pronounced up-regulation of osteogenic markers compared with the control group, with relative increases of approximately 91%, 60%, 86%, 31%, 148%, and 127% for Runx2, Osx, Opn, Sparc, Ocn, and Bsp, respectively.

Fig. 5.

Osteogenic gene expression of pre-osteoblastic MC3T3-E1 cells cultured with ZnO-NPs extraction for 7 days. Relative mRNA expression levels of osteogenic markers, including Runx2, Osx, Opn, Sparc, Ocn, and Bsp, were quantified by quantitative PCR (qPCR) and normalized to the control group. Cells were treated with growth medium (control) or ZnO-NPs extractions at concentrations of 0.01 mg/mL (Zn0.01), 0.1 mg/mL (Zn0.1), and 1 mg/mL (Zn1). Data are presented as mean ± SD (n = 3; * p < 0.05; ** p < 0.01, *** p < 0.001). Runx2, runt-related transcription factor 2; Osx, osterix; Opn, osteopontin; Sparc, secreted protein acidic and rich in cysteine; Ocn, osteocalcin; Bsp, bone sialoprotein; ZnO - NPs, zinc oxide nanoparticles.

The Zn0.1 group also showed upregulation of several osteogenic markers, particularly Runx2 (ca. 30%), Osx (ca. 39%), Ocn (ca. 56%), and Bsp (ca. 58%), compared with the control group. In contrast, the Zn1 group demonstrated augmentation of early osteogenic markers, including Runx2 (ca. 48%), Osx (ca. 60%), Opn (ca. 68%), and Sparc (ca. 13%), whereas the expression levels of late-stage osteogenic markers, Ocn and Bsp, were reduced by approximately 13% and 10%, respectively, as compared with the control groups.

Effect of ZnO-NPs concentration on alkaline phosphatase activity

Alkaline phosphatase activity was performed to assess the osteogenic differentiation of MC3T3-E1 cells following exposure to ZnO-NPs extraction. As shown in Fig. 6 and Table S4, ALP activity was significantly augmented in the Zn0.01 group compared with the control group at both 7 and 14 days (p < 0.001). On day 7, the Zn0.01 group exhibited an approximately 66% in ALP activity relative to the control, whereas the Zn0.1 and Zn1 groups showed more modest increases of ca. 44% and 22%, respectively.

Fig. 6.

Alkaline phosphatase activity of MC3T3-E1 cells treated with ZnO-NPs extraction for 7 and 14 days (n = 3; *** p < 0.001). Data are presented as mean ± SD. Control, osteogenic medium; Zn0.01, 0.01 mg/mL ZnO-NPs osteogenic extraction medium; Zn0.1, 0.1 mg/mL ZnO-NPs osteogenic extraction medium; Zn1, 1 mg/mL ZnO-NPs osteogenic extraction medium; ZnO-NPs; zinc oxide nanoparticles.

On day 14, a pronounced increase in ALP activity was observed in the Zn0.01 group, reaching approximately 298% higher than that of the control groups (p < 0.001). In contrast, ALP activity in the Zn0.1 and Zn1 groups decreased by approximately 5% and 15%, respectively. These results indicate a concentration-dependent effect of ZnO-NPs extraction on ALP activity, with the lowest concentration eliciting the strongest osteogenic response.

Effect of ZnO-NPs concentration on biomineralization

Biomineralization of MC3T3-E1 cells treated with ZnO-NPs extraction was conducted using Alizarin Red S (ARS) staining. As shown in Fig. 7A, the Zn0.01 group exhibited more intense and homogeneous calcium deposition compared with the control group, whereas the Zn0.1 and Zn1 groups displayed visibly reduced mineralized areas.

Fig. 7.

Effect of ZnO-NPs extraction on biomineralization of MC3T3-E1 cells for 21 days. (A) Representative Alizarin Red S (ARS) staining images showing calcium deposition in MC3T3-E1 cells treated with ZnO-NPs extraction at different concentrations. (B) Quantitative analysis of ARS staining expressed as a percentage of the control group (n = 6; *** p < 0.001). Data are presented as mean ± SD. Control, osteogenic medium; Zn0.01, 0.01 mg/mL ZnO-NPs osteogenic extraction medium; Zn0.1, 0.1 mg/mL ZnO-NPs osteogenic extraction medium; Zn1, 1 mg/mL ZnO-NPs osteogenic extraction medium; ZnO-NPs; zinc oxide nanoparticles.

As shown in Fig. 7B and Table S5, qualitative analysis of ARS staining revealed that mineralization in the Zn0.01 group was significantly augmented to approximately 130% as compared with the control group. In contrast, the Zn0.1 group showed a modest reduction of ca. 15% in mineralization relative to the control group, while the Zn1 group exhibited a pronounced reduction of ca. 70% as compared with the control group. These results demonstrate a concentration-dependent effect of ZnO-NPs extraction on biomineralization, with the lowest concentration promoting calcium deposition most effectively.

Discussion

Previous studies have highlighted the potential of nanoparticles (NPs) as modulators of bone regeneration, demonstrating their ability to stimulate cellular activity and enhance osteogenic differentiation of mesenchymal stem cells^22,23. Among these, ZnO-NPs have gained particular attention due to their intrinsic bioactivity, which promotes cellular uptake and regulates osteogenic signaling pathways. Nevertheless, increasing evidence indicates that their biological effects are highly dose-dependent. While appropriate concentrations can enhance osteogenic differentiation and mineralization, excessive exposure may induce oxidative stress, impair mitochondrial function, and trigger cell death^20,24,25. These findings underscore the importance of establishing optimal dosing strategies for ZnO-NPs in regenerative medicine applications.

In this study, we investigated the concentration-dependent effects of ZnO − NP extracts on the viability and osteogenic differentiation of pre-osteoblast MC3T3-E1 cells. Cells treated with low concentrations of ZnO-NPs (0.01 and 0.1 mg/mL) showed significantly higher proliferation than the control group. These findings were supported by cell proliferation assays and Live/Dead staining, which showed high cell viability with minimal cytotoxicity. In contrast, the Zn10 group exhibited a substantial (~ 70%) reduction in cell viability, indicating cytotoxicity likely due to excessive Zn²⁺ release. The excessive Zn²⁺ from concentrations of ZnO-NPs can trigger the overproduction of reactive oxygen species (ROS), leading to mitochondrial damage, oxidative DNA damage, and nuclear disintegration, consistent with previous studies^26–28.

Importantly, low concentrations of ZnO-NPs not only promoted cell proliferation but also maintained biocompatibility over a 3-day culture period. Live/Dead fluorescence imaging confirmed widespread green fluorescence (indicating viable cells) and negligible red fluorescence in the Zn0.01 to Zn1 groups, further validating their cytocompatibility. The absence of detectable dead cells in the Live/Dead staining images should be interpreted in the context of both the intrinsic characteristics of MC3T3-E1 cells and the qualitative nature of fluorescence-based viability assays. MC3T3-E1 pre-osteoblastic cells are known to exhibit robust survival under optimized culture conditions, and sporadic cell death occurring under normal in vitro conditions may fall below the visual detection threshold of Live/Dead assays. This observation is consistent with the quantitative WST-1 results, which confirmed the absence of cytotoxic effects in the Zn0.01, Zn0.1, and Zn1 groups compared with the control group. This finding aligns with previous studies, such as Rezaei et al., who reported that ZnO-NPs at concentrations up to 1 mg/mL maintained biocompatibility, depending on particle size and surface characteristics²⁹. Nevertheless, many studies have observed reductions in cellular activity when ZnO-NPs exceed 100 µg/mL, primarily due to oxidative damage induced by excessive Zn²⁺ ions^30–32.

To further assess the osteogenic potential of ZnO-NPs, qPCR analysis was conducted after 7 days of exposure. Notably, the Zn0.01 group exhibited the most pronounced upregulation of key osteogenic markers, including Runx2, Osx, Opn, Sparc, Ocn, and Bsp, indicating a strong pro-osteogenic effect, consistent with a previous study³³. Although the Zn0.1 and Zn1 groups also showed elevated expression of several osteogenic genes, the Zn1 group exhibited reduced expression of late-stage markers, including Ocn and Bsp. These transcriptional findings were supported by ALP activity and biomineralization assays. The Zn0.01 group at both 7 and 14 days significantly enhanced by ALP activity, while the Zn0.1 and Zn1 groups failed to sustain ALP activity at 14 days. Similarly, Alizarin Red S staining demonstrated markedly increased calcium deposition in the Zn0.01 group, while mineralization was significantly reduced in the Zn0.1 and Zn1 groups. These findings indicate that higher Zn²⁺ concentrations impair late-stage osteoblast maturation and mineralization, suggesting that the osteogenic process is stage-specifically sensitive to zinc availability during osteoblast maturation^34,35.

Taken together, the low concentration of Zn²⁺ appears to promote osteogenesis through multiple synergistic mechanisms. The observed enhancement of osteogenic differentiation at low Zn²⁺ concentrations may be attributed to zinc’s role as a cofactor for enzymes and transcriptional regulators involved in skeletal metabolism. Previous studies have shown that the relevant Zn²⁺ physiologically enhanced osteogenic differentiation by activating BMP/Smad signaling and stimulating the MAPK pathway, including ERK and p38 phosphorylation, leading to upregulation of osteogenic transcription factors (e.g., Runx2 and Osx) and promoting matrix mineralization^36–38. Conversely, excessive Zn^2 + exposure may disrupt intracellular zinc homeostasis and impair osteoblast maturation, despite partial preservation of early osteogenic gene expression. Intracellular zinc is tightly regulated by zinc transporters (ZIP and ZnT families) and the metallothionein-mediated buffering system^39,40. Excess extracellular Zn²⁺ ions may overwhelm these regulatory mechanisms, leading to cytosolic zinc accumulation and oxidative stress. This disruption of intracellular zinc homeostasis has been associated with mitochondrial dysfunction, increased reactive oxygen species (ROS) production, and impaired extracellular matrix maturation, which may preferentially compromise late-stage mineralization^39–41. ZnO-NPs extracts at low concentrations likely maintain Zn²⁺ levels within a favorable biological range that supports osteogenic differentiation while preserving zinc homeostasis and cellular viability. This coordinated response may promote both early osteogenic differentiation and late-stage matrix mineralization⁴².

This study provides insights into the concentration-dependent osteogenic effects of ZnO-NPs; however, several limitations should be acknowledged. First, the detailed physicochemical properties of ZnO-NPs under biological conditions were not studied. Specifically, the hydrodynamic size distribution and zeta potential of the nanoparticles in cell culture medium (e.g., α-MEM + FBS) were not measured. The absence of these measurements limits the ability to accurately interpret nanoparticle-cell interactions under the experimental conditions, as nanoparticle behavior in the biological environment can be influenced by protein adsorption and aggregation. Further studies incorporating dynamic light scattering and zeta potential measurement in physiologically relevant media will be essential to better define these effects. Second, the biological properties were studied using a single pre-osteoblastic cell line. Although this model is commonly used, it does not fully represent the cellular heterogeneity and complexity of human-derived cell populations (e.g., mesenchymal stem cells or dental pulp stem cells). As a result, the observed pro-osteogenic effects might be cell type-specific, limiting the generalizability of the findings to other osteogenic models and clinical environments. Third, Zn²⁺ ion release from ZnO-NPs extracts was quantified using ICP − MS, but the intracellular fate of Zn²⁺ ions and their uptake dynamics were not investigated. In particular, zinc transporter-mediated regulation (ZIP and ZnT families) and intracellular zinc distribution were not assessed. Consequently, the role of zinc homeostasis in mediating the observed concentration-dependent effects remains to be clarified. Further investigation of intracellular zinc handling will be necessary to better define the mechanistic basis of ZnO-NPs-induced osteogenic response. In addition, the detailed mechanistic analyses (e.g., ROS generation, apoptosis, necrosis) were not performed. Thus, the link between high Zn²⁺ concentrations and impaired late-stage mineralization cannot be definitively attributed to oxidative stress or mitochondrial dysfunction. Moreover, protein-level validation of osteogenic markers (e.g., Runx2, Ocn, and Bsp) was not conducted. While osteogenic differentiation was functionally supported by ALP activity and biomineralization assays, the absence of protein-level validation limits confirmation of transcriptional findings. Finally, the long-term effects of ZnO-NP exposure on matrix maturation, mineral quality, and tissue remodeling were not assessed. This limits the interpretation of ZnO-NPs in the context of sustained hard tissue formation and functional tissue integration. Further studies incorporating human stem/progenitor cell models, in vivo validation, and comprehensive mechanistic analyses at both protein and signaling pathway levels (e.g., BMP- and MAPK-related cascades) will be essential to establish the translational relevance of ZnO-NPs for hard tissue regeneration.

Conclusion

This study demonstrates the concentration-dependent effects of ZnO-NP extracts on pre-osteoblastic cells. At low concentration, particularly 0.01 mg/mL, ZnO-NPs significantly enhanced cell proliferation and osteogenic differentiation, while higher concentrations induced cytotoxicity. These findings highlight an optimal concentration range of Zn²⁺ ions in regulating osteogenesis. Importantly, this study suggests that the design of ZnO-NP-containing biomaterials should prioritize controlled, sustained Zn^2 + release over increasing nanoparticle content. Maintaining Zn²⁺ levels within a biologically favorable range may enhance osteogenic outcomes while preserving cellular viability, thereby providing a practical design strategy for composite biomaterials, such as bone tissue-engineering scaffolds and dental cements.

Methods

Characterization of ZnO-NPs

Zinc oxide nanoparticles (ZnO-NPs; < 100 nm particle size) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Transmission electron microscopy (TEM) was performed to examine the morphology and size of zinc oxide nanoparticles (ZnO-NPs). ZnO-NPs were dispersed in absolute ethanol (Sigma-Aldrich, St. Louis, MO, USA) and sonicated to obtain a homogeneous suspension. A 4 µL of the suspension was deposited onto Formvar/carbon-coated copper grids that had been glow-discharged using an ACE600 system (Leica Microsystems, Wetzlar, Germany). After allowing the sample to absorb for 15 s, excess liquid was removed using filter paper, and the grids were air-dried before imaging. TEM observations were conducted using a JEM-HT7800 (Hitachi, Tokyo, Japan) operated at an accelerating voltage of 90 kV. In addition, X-ray diffraction (XRD, Rigaku, Tokyo, Japan) was performed to determine the crystalline phase and structural characteristics of the ZnO-NPs. The powdered samples were analyzed using an X-ray diffractometer equipped with Cu Kα radiation (λ = 1.5406 Å) operated at 40 kV and 30 mA. XRD patterns were recorded over a 2θ range of 20° to 60° at a consistent scanning speed of 2 °/min.

Cell cultures

MC3T3-E1 cells (Pre-osteoblast cell line from C57BL/6 mouse calvaria) were purchased from American Type Culture Collection (ATCC, CRL − 2593; Manassas, VA, USA). The cells were cultured at 37 °C in a 5% CO₂ atmosphere in alpha-modified essential medium (α-MEM, Cytiva, Marlborough, MA, USA). The growth medium was supplemented with 10% fetal bovine serum (FBS; Gibco, Thermo Fisher Scientific, Waltham, MA, USA) and 1% penicillin-streptomycin (Cytiva).

Preparation of the extraction

Table 2 shows the extraction ratios of ZnO-NPs that were extracted in a growth medium at 37 ˚C for 24 h. After incubation, the supernatant was collected without centrifugation and passed through a 0.2 μm sterile syringe filter. The resulting filtrate was used as the ZnO-NPs extract for the subsequent biological experiment. Particles larger than the filter pore size were removed during filtration. The growth medium served as the control group. The osteogenic medium was prepared by supplementing the growth medium with 50 µg/mL ascorbic acid (Sigma-Aldrich) and 10 mM β-glycerophosphate (Sigma-Aldrich). In addition, the osteogenic extraction medium was prepared by supplementing the extraction medium with 50 µg/mL ascorbic acid (Sigma-Aldrich) and 10 mM β-glycerophosphate (Sigma-Aldrich).

Table 2.

The extraction ratio of ZnO-NPs from the growth medium.

Group	ZnO-NPs (mg)	Growth medium (mL)	Extraction ratio (mg/mL)
Zn0.01	0.1	10	0.01
Zn0.1	1	10	0.1
Zn1	10	10	1
Zn10	100	10	10

ZnO-NPs, Zinc oxide nanoparticles.

Zinc ion concentration measurement

Each extraction was diluted 100-fold in sterile distilled water (Joongwae Pharmaceuticals Co., Ltd., Seoul, Republic of Korea). Zinc ion concentrations from the diluted extraction were measured by Inductively Coupled Plasma Mass Spectrometer (ICP-MS, NexION2000, PerkinElmer, Waltham, MA, USA).

Mitochondrial metabolic activity

MC3T3-E1 cells were seeded at 2 × 10⁴ cells per well in 24-well plates and cultured for 24 h. After confirming cell attachment, the old medium was replaced, and the cells were gently rinsed twice with Dulbecco’s phosphate-buffered saline without Ca²⁺ and Mg²⁺ (DPBS, Cytiva). Then, each extraction was changed and cultured for 1, 2, and 3 days. At each time point, each well was treated with a 10% (w/v) WST-1 solution and subsequently incubated at 37 °C for 1 h. Then, the supernatant from each well was moved to 96-well plates. Optical density was measured at 450 nm by a microplate reader (Biotek, Winooski, VT, USA).

Live/dead assay

MC3T3-E1 cells were seeded at 2 × 10⁴ cells per well in 24-well plates and cultured for 1 day and 3 days. The qualitative analysis of live and dead cells was evaluated using the LIVE/DEAD^® Viability/Cytotoxicity Kit for mammalian cells (Thermo Fisher Scientific Inc.) according to the manufacturer’s instructions. Briefly, 2 µM calcein AM and 4 µM ethidium homodimer-1 (EthD-1) were injected into 10 mL Dulbecco’s phosphate buffer saline (DPBS; Cytiva). At each time point, this solution was replaced and incubated for 30 min at 25 °C. Images were captured using fluorescence microscopy (EVOS FL, Thermo Fisher Scientific Inc).

Quantitative polymerase chain reaction

To confirm osteogenic differentiation by quantitative polymerase chain reaction (qPCR), MC3T3-E1 cells were seeded at a density of 1 × 10⁵ cells per well in 12-well plates. After confirming cell adhesion on the plates, the old medium was removed, and each well was replaced with fresh medium. After 7 days of culture, total RNA was isolated using Trizol (Qiazol; Qiagen, Hilden, Germany) according to the manufacturer’s instructions. cDNA was synthesized from 1 µg total RNA using the PrimeScript RT reagent kit (Takara Biotechnology Co., Ltd., Tokyo, Japan). Quantitative polymerase chain reaction (qPCR) was performed with SYBR Green Reagent (Takara Biotechnology Co. Ltd.) on the QuantStudio 3 Real-Time PCR system (Applied Biosystems, Waltham, MA, USA). qPCR amplification conditions were: 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 30 s. The primer sequences were used in Table 3. Glyceraldehyde-3-phosphate dehydrogenase (Gapdh) was used as an internal control, and relative expression was calculated using the　　method.

Table 3.

Primer sequences used for qPCR gene expression assays.

Molecules	Primer sequence (5′→3’)	Product size (bp)	Accession No.
Runx2	Forward: GGGAACCAAGAAGGCACAGA Reverse: ACTTGGTGCAGAGTTCAGGG	152	NM_001271627.1
Osx	Forward: GTCCTCTCTGCTTGAGGAAGAA Reverse: TCTTTGTGCCTCCTTTCCCC	131	NM_130458.4
Opn	Forward: GAGGAAACCAGCCAAGGACTAA Reverse: TCTGGGTGCAGGCTGTAAA	140	NM_009263.3
Sparc	Forward: GGCGAGTTTGAGAAGGTATGC Reverse: TGGTCCGATGTAGTCCAGGT	129	NM_001290817.1
Ocn	Forward: TTGGCCCAGACCTAGCAGA Reverse: CTGGGCTTGGCATCTGTGA	100	NM_007541.3
Bsp	Forward: CGGTTTCCAGTCCAGGGAGG Reverse: CGAGAGTGTGGAAAGTGTGGA	174	NM_008318.3
Gapdh	Forward: CCCACTCTTCCACCTTCGATG Reverse: CGAGTTGGGATAGGGCCTCT	201	NM_001289726.1

Alkaline phosphatase activity

To confirm the differentiation for osteogenic activity using alkaline phosphatase (ALP) activity. Briefly, MC3T3-E1 cells were seeded at a density of 1 × 10⁵ cells per 6-well plate and cultured in osteogenic extraction medium for 7 and 14 days. The cell lysates were obtained for ALP measurement using a SensoLyte pNPP alkaline phosphatase assay kit (AnaSpec, An Jose, CA, USA) according to the manufacturer’s instructions. To normalize ALP activity, the total protein content of each sample was quantified using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific).

Biomineralization assay

To evaluate the biomineralization assay, Alizarin Red S (ARS) staining was performed. Briefly, MC3T3-E1 cells were seeded at a density of 1 × 10⁵ cells per 6-well plate and cultured in osteogenic medium or osteogenic extraction medium for 21 days. The cells were fixed with 4% paraformaldehyde (PFA, Biosesang, Seongnam, Republic of Korea) for 10 min. The 4% PFA was discarded, and the container was rinsed twice with sterile distilled water (Joongwae Pharmaceuticals Co., Ltd.). ARS staining solution (A5533, Sigma-Aldrich) was added to each well at 25 °C in the dark for 1 h. Thereafter, the cells were carefully removed in ARS staining solution and rinsed five times with sterile distilled water (Joongwae Pharmaceuticals Co., Ltd.). Mineralization nodules (red) were observed under a light microscope at ×10 magnification. Quantification was performed by dissolving mineralization nodules in 10 mM sodium phosphate (pH 7.0) with 10% cetylpyrimidium chloride (Sigma-Aldrich) at 25 °C for 30 min. The supernatants were moved to 96-well plates, and optical density was measured at 562 nm using a microplate reader.

Statistical analysis

Statistical analyses were performed using SPSS v26 (IBM, Armonk, NY, USA). All quantitative results are presented as mean ± standard deviation. Experiments were conducted using independent biological replicates, each measured in technical triplicate, and the number of biological replicates (n) for each assay is indicated in the corresponding figure legends. Data were assessed by one-way analysis of variance (ANOVA) followed by Tukey’s post hoc analysis. Statistical significance was defined at p < 0.05.

Supplementary Information

Below is the link to the electronic supplementary material.

Supplementary Material 1 ^{(157.8KB, docx)}

Author contributions

J.H.R. Data curation, Formal analysis, Methodology, Writing – original draft, Review & Editing, Funding acquisition. U.M. Data curation, Formal analysis, Visualization. J.H.K.: Investigation and Methodology. J.S.K.: Supervision and Resource. K.W.K: Supervision and Resource. S.H.C: Conceptualization, Methodology, Supervision, Writing - Review & Editing, Project administration, Funding acquisition.

Funding

This work was supported by a National Research Foundation of Korea (NRF) grant, funded by the Korea government (MSIT) (RS-2024-00357334). This research was also supported　by　the Regional Innovation System & Education (RISE) program through the Gangwon RISE Center, funded by the Ministry of Education (MOE) and Gangwon State (G.S.), Republic of Korea (2026 − RISE − 10 − 101) (P0028969, Regional Anchor company-Academia Partnership Innovation Development).

Data availability

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Declarations

Competing interests

The authors declare no competing interests.