Abstract
Aberrant epigenetic regulation of microRNAs and their targets contributes to colorectal cancer (CRC) progression. This study examined the methylation-dependent regulation of the miR-124–KITENIN axis and its clinical significance in CRC. Site-specific hypermethylation within the KITENIN (VANGL1) locus, particularly at cg00819310, was associated with poorer patient survival. miR-124, a direct negative regulator of KITENIN, was frequently hypermethylated and transcriptionally silenced, leading to KITENIN upregulation. Treatment with 5-aza-2′-deoxycytidine restored miR-124 expression and reduced KITENIN levels in CRC cells. These results demonstrate that miR-124 silencing enhances KITENIN activation and CRC progression, supporting miR-124 methylation as a potential prognostic and therapeutic target.
Keywords: Colorectal cancer, KITENIN, miR-124, DNA methylation, Epigenetic regulation, Promoter hypermethylation
INTRODUCTION
MicroRNAs (miRNAs) are evolutionarily conserved noncoding RNAs that regulate gene expression at both transcriptional and translational levels and play essential roles in cell cycle, differentiation, metabolism, and aging (Breving and Esquela-Kerscher, 2010; Heydarzadeh et al., 2021; Prabhakaran et al., 2024; Yang and Wang, 2011). Dysregulated miRNA expression contributes to cancer initiation and progression, functioning as either tumor suppressors or oncogenes depending on context (Maurya et al., 2025). Increasing evidence shows that miRNA expression itself is tightly controlled by epigenetic mechanisms such as promoter methylation and histone modifications, as demonstrated in glioma and other malignancies (Yang et al., 2024). Moreover, miRNAs can reciprocally regulate DNA methyltransferases and histone modifiers, forming feedback loops that shape cancer cell plasticity and therapeutic resistance (Saviana et al., 2023). These insights highlight the dual role of miRNAs as both regulators and targets of epigenetic modifications, positioning them as promising candidates for precision oncology strategies including epigenetic drugs and nanoparticle-based delivery systems (Song et al., 2025).
Our previous studies have demonstrated that miR-124 functions as a tumor suppressor in colorectal cancer (CRC) by directly targeting KITENIN (also known as VANGL1), thereby inhibiting CRC cell migration, invasion, and in vivo tumorigenesis (Park et al., 2014). In addition, miR-124 is frequently downregulated across several cancer types, including CRC, due to promoter methylation, highlighting epigenetic silencing as a central mechanism underlying its loss of function (Baharudin et al., 2022; Liao et al., 2025; Oltra et al., 2018). Beyond its tumor-suppressive role, miR-124 has been implicated in modulating drug responses by targeting epigenetic regulators such as DNMT1 and DNMT3B, linking its expression to therapeutic sensitivity (Chen et al., 2015). Meanwhile, KITENIN overexpression itself has been associated with CRC progression and metastasis, and recent studies suggest that targeting KITENIN-mediated oncogenic signaling such as disruption of the KITENIN–ErbB4 complex with small molecules like chrysophanol, emodin, hispidulin, DKC1125 and DKC-C14S may provide novel therapeutic opportunities (Varlı et al., 2024, 2025a, 2025b).
Given that miR-124 functions as a tumor suppressor in CRC and is frequently subject to epigenetic silencing, an important question remains whether promoter methylation of miR-124 contributes to the dysregulation of its downstream targets such as KITENIN. While promoter hypermethylation is generally associated with transcriptional repression, emerging evidence suggests that gene-specific and context-dependent methylation patterns may reflect broader epigenetic remodeling in cancer rather than uniform gene silencing (Moarii et al., 2015; Sproul et al., 2012; Zhu et al., 2026). In this context, it remains unclear whether epigenetic alterations at the KITENIN locus coexist with, or are functionally linked to, miR-124 methylation status. Therefore, we hypothesized that epigenetic modifications may occur at multiple levels of the miR-124–KITENIN regulatory axis, with potentially distinct biological consequences. To address this, we investigated the methylation status of both the miR-124 promoter and the KITENIN locus in CRC and examined their association with miR-124 expression and KITENIN regulation. Our analyses revealed that miR-124 promoter methylation is closely linked to reduced miR-124 expression and corresponds with higher KITENIN levels, whereas KITENIN methylation displayed a more heterogeneous, site-specific pattern.
MATERIALS AND METHODS
Cell culture
A diverse panel of human cell lines was utilized in this study, including HIEC6 (small intestine), HEK293T (embryonic kidney), and seven colorectal cancer lines: HCT116, HCT15, HT29, Caco2, DLD1, SW620, and SW480. All cell lines were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA). Cells were cultured in either Dulbecco’s Modified Eagle Medium (DMEM) or Roswell Park Memorial Institute (RPMI) 1640 medium, both supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. Cultures were maintained at 37°C in a humidified incubator with 5% CO₂.
Patient samples
Paired CRC tissues and adjacent normal tissues were obtained from 10 patients with stage II CRC through the Chonnam National University Hwasun Hospital Tissue Resource Center. All samples were anonymized, and written informed consent had been obtained by the Tissue Resource Center. The study protocol was reviewed and approved by the Institutional Review Board of Sunchon National University (IRB No. 1040173-201505-BR-005-02) and was conducted in accordance with the Declaration of Helsinki. The clinicopathological characteristics of the patients are summarized in Table 1.
Table 1.
Clinicopathological characteristics of patients included in this study
| Parameter | (N=10) | |
|---|---|---|
| Age | ≤60 | 2 |
| ≤70 | 6 | |
| ≤80 | 2 | |
| Sex | Male | 8 |
| Female | 2 | |
| Tumor stage | T3 | 9 |
| T4 | 1 | |
| Staging | stage II | 10 |
RNA isolation and quantitative real-time PCR
Total RNA was extracted from HIEC6 (human small intestine), HEK293T (human embryonic kidney), and seven colorectal cancer cell lines—HCT116, HCT15, HT29, Caco2, DLD1, SW620, and SW480—using RNAiso Plus (TaKaRa, Otsu, Japan), following the manufacturer’s protocol. For each sample, 1 µg of total RNA was reverse-transcribed into complementary DNA (cDNA) using the M-MLV Reverse Transcriptase Kit (Invitrogen, Carlsbad, USA). Quantitative real-time PCR (qRT-PCR) was conducted using SYBR Green (Enzynomics, Seoul, Korea) on a CFX system (Bio-Rad, Hercules, USA).
Immunoblotting
Western blot analysis was performed using cell lysates prepared in lysis buffer containing 50 mM Tris–HCl (pH 7.4), 150 mM NaCl, 1% Nonidet P-40, 0.1% SDS, 0.1% deoxycholic acid, 10 mM NaF, 10 mM Na₄P₂O₇, 1 mM Na₃VO₄, and protease inhibitors. Cells were lysed for 30 min on ice. Protein concentrations were determined using the bicinchoninic acid assay (Pierce Biotechnology, Rockford, IL, USA), and samples were standardized to the middle protein concentration. Media were concentrated by precipitation with 10% trichloroacetic acid and dissolved in buffer containing 62.5 mM Tris-HCl (pH 6.8), 10% glycerol, 2% SDS, and 0.005% bromophenol blue. Thirty micrograms of protein were separated by electrophoresis on 10% polyacrylamide gels containing 0.1% SDS and transferred to nitrocellulose membranes. Membranes were blocked with buffer containing 20 mM Tris-HCl (pH 8.0), 137 mM NaCl, 0.1% Tween, and 3% nonfat dry milk, and incubated with primary antibodies against VANGL1 (KITENIN) and actin. Peroxidase-conjugated secondary antibodies were used for detection, and signals were visualized using electrochemiluminescence (ECL).
Methylation assay and pyrosequencing analysis
Genomic DNA was isolated from CRC cell lines using genomic DNA extraction (Bioneer, Daejeon, Korea). Bisulfite modification of DNA (1.0 µg) was carried out by using an EZ DNA methylation-direct kit (Zymo Research, Irvine, CA). For the CRC cell lines, the methylation of 5′ CpG island regions was detected by MSP using the primers specific for either methylated or unmethylated DNA (Table 2). The methylated CpG dinucleotides were validated using bisulfite DNA sequencing (Table 3). Amplified CpG islands were separately cloned into pCR 2.1 vector using TOPO TA Cloning Kit (Invitrogen) and at least three clones per PCR product were picked up for DNA sequencing.
Table 2.
The nucleotide sequences used for MSP
| Gene | Primer sequence | |
|---|---|---|
| miR-124-1 | M | 5’-AGAGGATTGTAGTAGGCGAGTTTC |
| 5’-AACGAAAAACAAAAAAAACAACG | ||
| U | 5’-GAGGATTGTAGTAGGTGAGTTTTGG | |
| 5’-ACAAAAAACAAAAAAAACAACAAA | ||
| miR-124-2 | M | 5’-TTTGTAGTTAGATTAGATGGGTCGT |
| 5’-CCTAAACTCTATATCCTTTAATAACGTT | ||
| U | 5’-TTTGTAGTTAGATTAGATGGGTTGT | |
| 5’-CCTAAACTCTATATCCTTTAATAACATT | ||
| miR-124-3 | M | 5’-TATCGAGTTGGTAGTGATTGTAGTC |
| 5’-CAATAAAATAAAAATTAAAAATCGTC | ||
| U | 5’-TTGAGTTGGTAGTGATTGTAGTTGG | |
| 5’-CAATAAAATAAAAATTAAAAATCATC | ||
Table 3.
The nucleotide sequences used for pyrosequencing analysis
| Gene | Primer sequence | |
|---|---|---|
| miR-124-1 | F | 5’- GATTTGAGAGAGAGGATTGTAGTAGG -3’ |
| R | 5’biotin- CCACCCATATCCCCCTCTACTTC -3’ | |
| S | 5’- TTTATTTAGAGATGGAGGTAAAGAG -3’ | |
| miR-124-2 | F | 5’- TGTGGTTATTGGTTGAGGAGTG -3’ |
| R | 5’biotin- TACTCACTAAAACTTCCCCACTACCC -3’ | |
| S | 5’- ATTTTTTTTTAGGGTTTAGAT -3’ | |
| miR-124-3 | F | 5’- TGAGGTTTGGGGAAGTTA -3’ |
| R | 5’biotin- ACCTCCTACCAATAACCCTACTAAACTC -3’ | |
| S | 5’- GTTGGTAGTGATTGTAGT -3’ | |
Bioinformatics
Promoter methylation level in normal and tumor specimens of COAD was comparatively analyzed using the UALCAN web tool (http://ualcan.path.uab.edu/index.html) (Chandrashekar et al., 2022). Wanderer (http://maplab.imppc.org/wanderer/) is an interactive web-based platform that enables exploration of gene expression and DNA methylation data derived from The Cancer Genome Atlas (TCGA). Methylation differences in KITENIN (also known as VANGL1) were assessed using the TCGA colon adenocarcinoma (COAD) dataset (Díez-Villanueva et al., 2015). Survival analysis and CpG site-specific methylation heatmaps were generated using MethSurv (https://biit.cs.ut.ee/methsurv/), a web-based tool for exploring prognostic relevance of DNA methylation in TCGA cancer cohorts (Modhukur et al., 2018). CpG-aggregated methylation profiles across multiple cancer types were retrieved using SMARTApp (http://www.bioinfo-zs.com/smartapp/), an online platform for pan-cancer epigenetic analysis based on TCGA datasets (Li et al., 2019).
RESULTS
KITENIN CpG methylation patterns and clinical implications
The CpG methylation profiles of the KITENIN gene were systematically analyzed across multiple tumor types and corresponding normal tissues. Our findings indicate that VANGL1 methylation plays a critical role in tumor development and prognosis. Comparative analysis between tumor and normal samples revealed that VANGL1 methylation levels were significantly altered in several cancer types, including BLCA, BRCA, KIRC, LIHC, and LUAD (p<0.0001). In contrast, no significant differences were observed in certain other tumor types, suggesting that alterations in KITENIN methylation may exhibit tumor-type specificity. Notably, in COAD, KITENIN methylation levels showed significant deviation between tumor and normal tissues, further highlighting the tissue-specific nature of these epigenetic alterations (Fig. 1A). To further explore clinical relevance, a Kaplan-Meier survival analysis was performed. The results demonstrated that hypermethylation of the cg00819310 CpG site located in the 5’UTR region of KITENIN was significantly associated with poor overall survival (HR=1.70, p=0.018) (Fig. 1B). Patients with higher methylation levels exhibited approximately a 70% increased risk of mortality compared to those with lower methylation. Optimal cut-off analysis using the maxstat method identified a beta value of 0.588 as the threshold for stratifying patients into high- and low-risk groups (Fig. 1C). Heatmap clustering of multiple KITENIN CpG sites (e.g., cg17318344, cg02659568, cg08157638) further highlighted the prevalence of hypermethylation patterns in tumor tissues. When integrated with clinical characteristics (including age, sex, ethnicity, survival outcome, and tumor subtypes), the analysis suggested strong correlations between KITENIN methylation profiles and specific clinical features. Overall, these findings demonstrate that alterations in KITENIN CpG methylation are prevalent across multiple cancers and may influence tumor biology. Notably, hypermethylation of the cg00819310 locus emerged as a potential prognostic biomarker, underscoring its clinical utility for both early detection and survival prediction in cancer patients (Fig. 1D).
Fig. 1.

Comprehensive DNA methylation profiling and its prognostic relevance in colorectal cancer. (A) Boxplots show CpG-aggregated methylation values across all samples. Each box represents a CpG site, with red dots indicating tumor samples and black dots indicating normal tissues. Tumor samples exhibit consistently higher methylation levels across multiple CpG loci. Aggregated CpG DNA methylation profiles spanning multiple cancer types were utilized by using SMARTApp (http://www.bioinfo-zs.com/smartapp/). (B) Kaplan-Meier survival analysis based on methylation status at the cg00819310 CpG site. COAD patients with high methylation (red curve) show significantly reduced survival compared to those with low methylation (blue curve), as indicated by the log-rank p-value. (C) Density plot illustrating the distribution of methylation values, stratified into high and low groups based on the mean beta value. (D) Heatmap displaying methylation levels across samples for selected CpG sites. Rows represent CpG loci, columns represent individual samples. Red indicates high methylation, blue indicates low methylation. Sample annotations are shown on the right. Panels B, C, D utilized the MethSurv (accessible at https://biit.cs.ut.ee/methsurv/) by using COAD samples.
Promoter hypermethylation of KITENIN and its association with gene expression in colon adenocarcinoma
Furthermore, we investigated the methylation status of KITENIN in colon adenocarcinoma (COAD) by comparing tumor and matched normal tissues. Line plot analyses revealed distinct methylation patterns between normal and tumor tissues across multiple CpG sites within the VANGL1 locus. In normal tissues, the methylation levels were relatively stable, whereas tumor samples exhibited marked hypermethylation at several CpG sites (Fig. 2A, 2B). When averaged across several CpG loci, tumor tissues showed a mild increase at specific CpG sites values compared to normal counterparts (Fig. 2C). The functional relevance of KITENIN methylation was then assessed by correlation with mRNA expression. In normal tissues, methylation levels showed only a weak negative correlation with KITENIN expression (Spearman’s rho=–0.193, n=19). However, in tumor tissues, this relationship was more pronounced, with higher methylation levels correlating with reduced VANGL1 mRNA expression (Spearman’s rho=–0.252, n=249) (Fig. 2D, 2E). A detailed comparison of promoter methylation levels further confirmed this observation. Analysis of TCGA samples showed modest but overlapping distributions with only a slight upward shift of KITENIN in primary tumor samples (n=313) compared to normal tissues (n=37) (Fig. 2F). Collectively, these findings suggest that KITENIN may experience site-specific methylation changes rather than broad promoter hypermethylation in colon adenocarcinoma, which shows a weak-modest association with reduced gene expression. These results suggest that KITENIN methylation may contribute to tumor-specific epigenetic regulation and could serve as a biomarker candidate for COAD.
Fig. 2.

KITENIN methylation and expression patterns in colon adenocarcinoma (COAD). (A) Line plots showing CpG methylation levels of KITENIN in normal colon tissues (n=38). (B) Line plots showing CpG methylation levels of VANGL1 in tumor tissues (n=302). Tumor samples display higher methylation at several CpG sites compared to normal controls. (C) Mean methylation levels of VANGL1 across normal (n=38) and tumor (n=302) samples, with consistently higher methylation in tumors (adjusted p<0.05). (D) Correlation between CpG methylation (cg08157638) and VANGL1 mRNA expression in normal tissues (n=19, Spearman’s rho= -0.193). (E) Correlation between CpG methylation (cg08157638) and VANGL1 mRNA expression in tumor tissues (n=249, Spearman’s rho= -0.252), indicating stronger negative regulation in tumors. DNA methylation levels of KITENIN (VANGL1) were analyzed using the TCGA colon adenocarcinoma (TCGA-COAD) dataset through the Wanderer (http://maplab.imppc.org/wanderer/) web platform. (F) Boxplot comparing promoter methylation levels of VANGL1 in TCGA-COAD samples, in primary tumors (n=313) compared to normal tissues (n=37), data utilized the UALCAN database (accessible at http://ualcan.path.uab.edu/).
miR-124 promoter hypermethylation in colorectal cancer cells
Methylation-specific PCR (MSP) and bisulfite sequencing analyses revealed the promoter methylation status of the miR-124 gene family in colorectal cancer (CRC) and normal cell lines. MSP results showed that normal cell lines (HIEC6, 293T) predominantly exhibited unmethylated (U) bands, whereas CRC cell lines (HCT15, HCT116, HT29, Caco2, DLD1, SW480, SW620) displayed prominent methylated (M) bands for miR-124-1, miR-124-2, and miR-124-3, suggesting epigenetic silencing in cancer cells (Fig. 3A). Bisulfite sequencing further quantified these patterns: miR-124-1 and miR-124-3 were highly methylated in both normal and cancer cells (approximately 90-100%), while miR-124-2 showed low methylation in normal cells (~37.5%) but was markedly hypermethylated in CRC cell lines (87.5-100%) (Fig. 3B). These results indicate that, although miR-124-1 and miR-124-3 are generally highly methylated, miR-124-2 undergoes cancer-specific hypermethylation, highlighting its potential as an epigenetic biomarker in colorectal cancer. Next, we examined the methylation status of miR-124 in two normal cell lines (HIEC6, 293T) and seven CRC cell lines (HCT15, HCT116, HT29, Caco2, DLD1, SW480, SW620) using pyrosequencing assay. miR-124 has three promoters, which are located at the miR-124-1 at 8p23.1 and the miR-124-3 at 20q13.33 and miR-124-2 at 8q12.3. Pyrosequencing analysis was performed using a primer specific to each promoter. As a result, miR-124-2 promoters were highly methylated in all CRC cells but low in normal cells, and methylation of 124-1 promoter and 124-3 promoter was able to revealed hypomethylation in normal cells (HIEC6), while high methylation was observed in CRC cells (Fig. 3C). These results confirmed that the miR-124 promoter was hypermethylated in CRC cells.
Fig. 3.

Promoter methylation analysis of the miR-124 gene family in normal and colorectal cancer (CRC) cell lines. (A) Methylation-specific PCR (MSP) showing unmethylated (U) and methylated (M) bands for miR-124-1, miR-124-2, and miR-124-3 in normal (HIEC6, 293T) and colorectal cancer (HCT15, HCT116, HT29, Caco2, DLD1, SW480, SW620) cell lines. (B) Bisulfite sequencing analysis depicting the percentage of CpG methylation in the promoters of miR-124-1, miR-124-2, and miR-124-3 across the same cell lines. (C) Methylation levels of miR-124 promoter in CRC cells. Pyrosequencing analysis of the miR-124-1, miR-124-2, miR-124-3 promoter in normal cells (HIEC6, 293T) and CRC cell lines (HCT15, HCT116, SW480, SW620, Caco2, DLD1, HT29).
Frequent hypermethylation of miR-124 in colorectal cancer tumors
To investigate the correlation between miR-124 expression and its target genes via promoter methylation, we assessed the DNA methylation status of the miR-124 promoter in colorectal cancer patient tissues. A total of 10 matched pairs of tumor and adjacent normal tissues were collected from colorectal cancer patients. Bisulfite-modified genomic DNA was analyzed using pyrosequencing to quantify methylation levels at CpG islands within the miR-124 promoter regions. Our analysis revealed that the miR-124-1 and miR-124-3 promoters were methylated in 90% (9 out of 10) of tumor samples, whereas the miR-124-2 promoter exhibited hypermethylation in all tumor tissues (100%, 10 out of 10). These findings are illustrated in Fig. 4, which display the comparative methylation profiles between cancerous and adjacent normal tissues for each miR-124 promoter variant. The consistent hypermethylation observed, particularly in the miR-124-2 promoter, suggests a potential epigenetic mechanism contributing to miR-124 downregulation in colorectal cancer. This supports the hypothesis that promoter methylation may play a critical role in modulating miR-124 expression and its downstream effects in tumorigenesis.
Fig. 4.

Methylation levels of the miR-124 promoter in colorectal cancer tissues. Bisulfite-modified genomic DNA was extracted from matched pairs of colorectal cancer tissues and adjacent normal tissues (n=10 each). DNA methylation levels at CpG island regions were quantified using pyrosequencing. Panels show methylation profiles for the promoter regions of miR-124-1, miR-124-2, and miR-124-3. Comparative analysis highlights differential methylation patterns between tumor and normal samples, methylation levels were significantly elevated in cancer samples (p<0.001), indicating consistent hypermethylation of miR-124 promoter regions in colorectal cancer.
miR-124 promoter methylation regulates KITENIN expression in CRC cells
To investigate whether DNA methylation contributes to the downregulation of miR-124 in colorectal cancer (CRC) cells, we treated both CRC cell lines (SW480, SW620, HCT15, HCT116) and normal cell lines (HIEC6, 293T) with 50 μM 5-aza-2’-deoxycytidine (Aza) for four days. Quantitative PCR analysis revealed that Aza treatment significantly increased miR-124 expression by 1.5 to 3-fold in CRC cells, while no change was observed in normal colon cells (HIEC6). Concurrently, KITENIN mRNA levels were reduced by approximately 20% to 60% in CRC cells following Aza treatment, and Western blot analysis confirmed a corresponding decrease in KITENIN protein levels. In contrast, human intestinal epithelial cell line (HIEC6) showed no significant changes in KITENIN expression at either the mRNA or protein level. These findings strongly suggest that hypermethylation of the miR-124 promoter is a key mechanism suppressing its expression in CRC cells. Furthermore, the inverse correlation between miR-124 upregulation and KITENIN downregulation supports the notion that KITENIN is a direct target of miR-124. Taken together, our data indicate that epigenetic silencing of miR-124 via promoter methylation contributes to the aberrant expression of oncogenic targets such as KITENIN in colorectal cancer (Fig. 5A-5C). To further evaluate the clinical relevance of miR-124 expression, we performed a Kaplan-Meier survival analysis comparing patients with high versus low levels of hsa-miR-124. The results demonstrated that patients with high miR-124 expression had significantly better overall survival compared to those with low expression. Specifically, the hazard ratio (HR) was 0.69 (95% CI: 0.50-0.95), indicating a 31% reduction in the risk of death for the high-expression group. The log-rank test yielded a p-value of 0.023, confirming that the survival difference between the two groups was statistically significant. These findings suggest that miR-124 not only plays a functional role in suppressing oncogenic targets such as KITENIN through epigenetic regulation but also serves as a potential prognostic biomarker. The improved survival associated with higher miR-124 expression supports its tumor-suppressive role and highlights the clinical importance of restoring its expression (Fig. 5D).
Fig. 5.

Hypermethylation of miR-124 promoter in CRC correlates with expression of miR-124 and KITENIN. (A) Western blot analysis of the KITENIN expression in CRC cell lines (SW480, SW620, HCT15, HCT116) and normal cells (HIEC6, 293T) treated with 50 μM of 5-aza-2’-deoxycytidine (Aza). (B) Expression levels of miR-124 in CRC cells (SW480, SW620, HCT15, HCT116) and normal cells (HIEC6, 293T) treatment with 50 μM of Aza. Quantitative data were obtained from at least three independent experiments. Data represents standard error of the mean. *p<0.05; **p<0.01; ***p<0.001 compared to no treatment. (C) Expression levels of KITENIN mRNA in CRC cell lines (SW480, SW620, HCT15, HCT116) and normal cells (HIEC6, 293T) treatment with 50 μM of Aza. Data represents standard error of the mean. *p<0.05; **p<0.01; ***p<0.001 compared to no treatment. (D) Kaplan-Meier (https://kmplot.com/analysis/) survival analysis based on hsa-miR-124 expression levels. (E-H) The miR-124 and KITENIN expression levels were analyzed in RNA extracted from matched pairs of cancer adjacent normal tissues (n=10) and cancer tissue (n=10) samples obtained from colorectal cancer patients. (E, F) miR-124 expression levels were detected by qRT-PCR assays in colorectal cancer tissues, the U6 snRNA expression was used as the internal control. (G, H) KITENIN expression levels were detected by qRT-PCR assays in colorectal cancer tissues, GAPDH expression was used as the internal control.
To validate the experimental findings in clinical samples, the expression levels of miR-124 and its target gene KITENIN were analyzed by qRT-PCR in colorectal cancer tissues and matched adjacent normal tissues. The results revealed that miR-124 expression showed a decreasing trend, and KITENIN levels exhibited a modest upward trend in CRC tissues compared with adjacent normal tissues, although these differences did not reach statistical significance. Furthermore, methylation analysis indicated that the miR-124 promoter region was highly methylated in cancer tissues, consistent with the observed downregulation of miR-124. The inverse expression pattern between miR-124 and KITENIN supports the hypothesis that KITENIN is negatively regulated by miR-124, and that promoter hypermethylation is a key mechanism driving miR-124 silencing in colorectal cancer. These clinical data reinforce the functional link between epigenetic regulation of miR-124 and aberrant KITENIN expression, highlighting their potential roles in colorectal tumorigenesis (Fig. 5E-5H).
Promoter hypermethylation of miR-124 is inversely correlated with its expression in colorectal cancer tissues
To elucidate the epigenetic regulation of miR-124 in colorectal cancer (CRC), we performed correlation analyses between promoter methylation levels and miR-124 expression in colorectal cancer tissues and adjacent normal tissues (n=10). Specifically, we examined three distinct promoter regions corresponding to miR-124-1, miR-124-2, and miR-124-3. A weak, nonsignificant trend of inverse association between promoter methylation and expression was observed for all three miR-124 loci. The linear regressions showed that the slopes in all three cases were negative; however, p-values failed to attain significance, and the coefficients of determination (R²) indicated poor explanatory value of the model. Nevertheless, the numerical values of the slopes were highest for miR-124 locus 1, which still failed to be statistically significant (Fig. 6A-6C). In parallel, KITENIN expression exhibited non significant positive correlations with methylation at the miR-124-1 and miR-124-3 loci (miR-124-1: r=0.3258, R²=0.1062, p=0.0805; miR-124-3: r=0.3115, R²=0.0970, p=0.0906), whereas the association at miR-124-2 was minimal and non significant (r=–0.06694, R²=0.0045, p=0.3896) (Fig. 6D-6F). These results suggest that epigenetic repression of miR-124 is a possible mechanism, but the biological effects of this relationship in CRC need to be confirmed in larger cohorts.
Fig. 6.

Linear regression analyses evaluating the relationship between promoter methylation of miR-124 loci and the expression levels of miR-124 and KITENIN in colorectal cancer tissues. (A) Linear regression between miR-124 expression and miR-124-1 promoter methylation (slope=−1.478, 95% CI: −3.956 to 0.999, one tailed p=0.1130, R²=0.0803, Pearson r=−0.2834). (B) Linear regression between miR-124 expression and miR-124-2 promoter methylation (slope=−1.438, 95% CI: −4.296 to 1.421, one tailed p=0.1523, R²=0.0584, Pearson r=−0.2417). (C) Linear regression between miR-124 expression and miR-124-3 promoter methylation (slope=−1.495, 95% CI: −4.531 to 1.540, one tailed p=0.1572, R²=0.0562, Pearson r=−0.2370). (D) Linear regression between KITENIN expression and miR-124-1 promoter methylation (slope=3.264, 95% CI: −1.426 to 7.954, one tailed p=0.0805, R²=0.1062, Pearson r=0.3258). (E) Linear regression between KITENIN expression and miR-124-3 promoter methylation (slope=−0.8110, 95% CI: −6.797 to 5.175, one tailed p=0.3896, R²=0.0045, Pearson r=−0.06694). (F) Linear regression between KITENIN expression and miR-124-2 promoter methylation (slope=3.558, 95% CI: −1.816 to 8.932, one tailed p=0.0906, R²=0.0970, Pearson r=0.3115).
DISCUSSION
In this study, we elucidated a crucial epigenetic regulatory axis in colorectal cancer (CRC), characterized by promoter hypermethylation of miR-124, leading to its transcriptional silencing, and consequent activation of its oncogenic target, KITENIN (VANGL1). We further demonstrated that certain CpG sites within the KITENIN locus are hypermethylated in tumor tissues, and this modification strongly correlates with poor overall survival. These findings support that both miR-124 silencing and KITENIN methylation contribute to CRC progression and patient prognosis (Fig. 7).
Fig. 7.

miR-124 expression inversely correlates with KITENIN levels in colorectal cancer. Schematic representation of miR-124 expression and DNA methylation status in normal colon epithelial cells, colorectal cancer cells, and following epigenetic therapy. In normal cells, miR-124 is actively transcribed due to unmethylated promoter regions, leading to suppression of KITENIN. In colorectal cancer cells, hypermethylation at miR-124 promoter sites silences its expression, resulting in upregulated KITENIN. Treatment with 5-aza-2’-deoxycytidine (5-aza-dC) induces DNA demethylation, restoring miR-124 expression and repressing KITENIN. Schematic representation created with BioRender.com (https://biorender.com).
KITENIN plays a critical role in the progression, invasion, metastasis, and prognosis of cancer (Lee et al., 2005, 2009). KITENIN is markedly overexpressed in CRC tissues and is spread to the lymph nodes or liver, where it enhances the migration, invasion, aerobic glycolysis and metastatic potential of cancer cells (Kho et al., 2009; Lee et al., 2009; Varlı et al., 2023). KITENIN exerts its oncogenic role in colorectal cancer by forming a multiprotein complex that stabilizes and amplifies pro-metastatic signaling. KITENIN interacts with Dishevelled (Dvl) and other scaffolding proteins, thereby enhancing Wnt/PCP pathway activity and promoting cytoskeletal reorganization required for cell motility. Moreover, KITENIN cooperates with ErbB4–c-jun axis, KITENIN also associates with Myo10, which stabilizes its homodimer, and with KSRP in a complex that includes RACK1 (Bae et al., 2014, 2021; Dreyer et al., 2022, 2023; Kho et al., 2009; Kim et al., 2022; Mentink et al., 2018). In this study, Kaplan-Meier analyses indicate that hypermethylation at the cg00819310 CpG site of KITENIN is associated with poor prognosis. This suggests that methylation of KITENIN may be associated with different regulatory mechanisms in the tumor microenvironment rather than suppressing gene expression. This finding supports the potential use of KITENIN methylation as a prognostic biomarker. Beyond genetic silencing, various approaches can be envisioned to inhibit KITENIN function, including small-molecule inhibitors that interfere with its protein–protein interactions or downstream signaling pathways, siRNA- or shRNA-based strategies that selectively reduce KITENIN expression at the transcript level, and peptide-based inhibitors that competitively block its interaction domains. Such multimodal targeting strategies may provide novel therapeutic avenues for suppressing KITENIN-driven tumorigenesis, invasion, metabolic activity and metastasis in colorectal cancer (Bae et al., 2021; Gamage et al., 2025; Kim et al., 2022; Lee et al., 2005; Varlı et al., 2023, 2024, 2025a, 2025b). In addition, miRNA-based therapeutic approaches, such as the use of tumor-suppressive miRNAs (e.g., miR-124) or other RNA interference strategies, may further expand the potential of RNA-based interventions to effectively target KITENIN and its oncogenic network.
miR-124 is widely recognized as a potent tumor suppressor microRNA that effectively inhibits stage progression and metastasis in many cancer types (Feng et al., 2024; Friedman et al., 2009; Gao et al., 2023; Li et al., 2009; Liao et al., 2025; Song et al., 2023; Sun et al., 2012; Wang et al., 2016; Wei et al., 2025; Wilting et al., 2010). For example, amplification of miR-124 has been shown to inhibit K-ras-dependent tumorigenesis and downregulate Akt signaling in lung cancer (NSCLC) (Jin et al., 2017). Similarly, low expression of miR-124 has been identified as a poor prognostic marker in many tumor types, including gastrointestinal, medulloblastoma, cervical, breast, hepatocellular, pancreatic, and colorectal cancers. Meta-analyses indicate that low miR-124 levels have a negative impact on both overall survival (OS) and disease-free survival (DFS/RFS) (Sun et al., 2018). In breast cancer, low miR-124 levels have been identified as a statistically independent negative prognostic factor (Dong et al., 2015). Subsequent studies confirmed that miR-124 downregulates DNMT3B and DNMT1, leading to re-activation of tumor suppressors such as E-cadherin, MGMT, and p16 (Chen et al., 2015; Liu et al., 2023). The association between low expression of miR-124 and poor survival suggests that this miRNA may be used as a prognostic biomarker. Moreover, our previous study has shown that miR-124 inhibited the migration and invasion of multiple CRC cell lines through the modulation of KITENIN expression. miR-124 targets KITENIN to inhibit CRC in vivo and miR-124 among the KITENIN target miRNAs is a therapeutically useful against CRC (Park et al., 2014).
Lujambio et al. originally described epigenetic silencing of miR-124 in colorectal and other human cancers (Lujambio et al., 2007; Suzuki et al., 2012). Moreover, hypermethylation of miR-124 promoter regions suppresses the expression of this miRNA, leading to its loss of tumor suppressor function in various cancer types. In the colorectal cancer cell line HCT-116, methylation of miR-124-a promotes proliferation by increasing CDK6 expression (Lopez-Serra and Esteller, 2012; Lujambio et al., 2007). Promoter hypermethylation of miR-124-2 and miR-124-3 is notably enriched in AR-negative prostate cancer cells, suggesting their utility as epigenetic biomarkers for this subtype. Moreover, RNA-mediated reintroduction of miR-124 has demonstrated tumor-suppressive effects in preclinical models (Chu et al., 2015). Promoter hypermethylation of miR-124-1 and miR-124-2 has been closely linked to the downregulation of miR-124 in cervical cancer. This epigenetic signature is under investigation as a candidate screening biomarker for high-grade cervical intraepithelial neoplasia (CIN3) and invasive carcinoma (Wilting et al., 2010). These findings corroborate our functional data where pharmacological demethylation with 5-aza-2′-deoxycytidine restored miR-124 expression and suppressed KITENIN levels, suggesting a feedback mechanism between miR-124 and epigenetic regulators. Harnessing nanoparticle-mediated delivery platforms to restore miR-124 expression in tumor tissues may offer a novel avenue for epigenetic therapy, particularly by disrupting KITENIN-driven metastatic pathways. Moreover, future studies employing locus-specific perturbation strategies, such as miR-124 mimic/inhibitor assays or targeted promoter demethylation, will be essential to definitively establish the causal contribution of miR-124 methylation to KITENIN regulation.
The functional consequences of the miR-124–KITENIN axis on CRC cell behavior have been previously established, showing that miR-124 directly targets KITENIN to inhibit migration, invasion, and tumor growth (Park et al., 2014). Our current study complements these functional insights by revealing the upstream epigenetic mechanism—promoter hypermethylation—that leads to the silencing of this tumor-suppressive miRNA. While tissue-level protein imaging was limited in the current cohort, the strong correlation between miR-124 silencing, KITENIN upregulation, and poor clinical outcomes provides clear evidence for the biological significance of this regulatory axis in CRC progression.
Our findings highlight that colorectal cancer progression is shaped by a dual epigenetic mechanism: loss of the tumor suppressor miR-124 through promoter hypermethylation and the prognostic impact of KITENIN methylation at specific CpG sites. Rather than a simple on–off regulation, this axis reveals a layered epigenetic control that integrates miRNA silencing with oncogenic signaling. By demonstrating that demethylation restores miR-124 and represses KITENIN, we provide a rationale for targeting this circuitry through epigenetic therapy or RNA-based interventions.
In conclusion, the miR-124–KITENIN axis emerges as a compelling target for both basic and translational research. These results position the miR-124–KITENIN axis as both a mechanistic driver and a clinically actionable vulnerability in CRC. Future investigations into how this regulatory axis behaves across distinct tumor subtypes and within the immune microenvironment may pave the way for the development of personalized therapeutic strategies for patients with colorectal cancer.
ACKNOWLEDGMENTS
This work was supported by the Sunchon National University Glocal University Project Fund in 2025 (Grant number: 2025-0023).
Footnotes
CONFLICT OF INTEREST
The authors declare that they have no competing interests.
AUTHOR CONTRIBUTIONS
So-Yeon Park: Investigation, Data curation, Visualization, Writing – original draft. Mücahit Varlı: Data curation, Visualization, Writing – review & editing, Writing – original draft. Hangun Kim: Conceptualization, Writing – review & editing, Funding acquisition, Project Administration, Methodology, Supervision.
REFERENCES
- Bae J. A., Bae W. K., Kim S. J., Ko Y. S., Kim K. Y., Park S. Y., Yu Y. H., Kim E. A., Chung I. J., Kim H., Ha H. H., Kim K. K. A new KSRP-binding compound suppresses distant metastasis of colorectal cancer by targeting the oncogenic KITENIN complex. Mol. Cancer. 2021;20:78. doi: 10.1186/s12943-021-01368-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bae J. A., Yoon S., Park S. Y., Lee J. H., Hwang J. E., Kim H., Seo Y. W., Cha Y. J., Hong S. P., Kim H., Chung I. J., Kim K. K. An unconventional KITENIN/ErbB4-mediated downstream signal of EGF upregulates c-Jun and the invasiveness of colorectal cancer cells. Clin. Cancer Res. 2014;20:4115–4128. doi: 10.1158/1078-0432.CCR-13-2863. [DOI] [PubMed] [Google Scholar]
- Baharudin R., Rus Bakarurraini N. Q., Ismail I., Lee L. H., Ab Mutalib N. S. MicroRNA methylome signature and their functional roles in colorectal cancer diagnosis, prognosis, and chemoresistance. Int. J. Mol. Sci. 2022;23:7281. doi: 10.3390/ijms23137281. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Breving K., Esquela-Kerscher A. The complexities of microRNA regulation: Mirandering around the rules. Int. J. Biochem. Cell Biol. 2010;42:1316–1329. doi: 10.1016/j.biocel.2009.09.016. [DOI] [PubMed] [Google Scholar]
- Chandrashekar D. S., Karthikeyan S. K., Korla P. K., Patel H., Shovon A. R., Athar M., Netto G. J., Qin Z. S., Kumar S., Manne U., Crieghton C. J., Varambally S. UALCAN: An update to the integrated cancer data analysis platform. Neoplasia. 2022;25:18–27. doi: 10.1016/j.neo.2022.01.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chen Z., Liu S., Tian L., Wu M., Ai F., Tang W., Zhao L., Ding J., Zhang L., Tang A. miR-124 and miR-506 inhibit colorectal cancer progression by targeting DNMT3B and DNMT1. Oncotarget. 2015;6:38139–38150. doi: 10.18632/oncotarget.5709. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chu M., Chang Y., Guo Y., Wang N., Cui J., Gao W. Q. Regulation and methylation of tumor suppressor miR-124 by androgen receptor in prostate cancer cells. PLoS One. 2015;10:e0116197. doi: 10.1371/journal.pone.0116197. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Díez-Villanueva A., Mallona I., Peinado M. A. Wanderer, an interactive viewer to explore DNA methylation and gene expression data in human cancer. Epigenetics Chromatin. 2015;8:22. doi: 10.1186/s13072-015-0014-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dong L. L., Chen L. M., Wang W. M., Zhang L. M. Decreased expression of microRNA-124 is an independent unfavorable prognostic factor for patients with breast cancer. Diagn. Pathol. 2015;10:45. doi: 10.1186/s13000-015-0257-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dreyer C. A., VanderVorst K., Carraway K. L. Vangl as a master scaffold for Wnt/Planar cell polarity signaling in development and disease. Front. Cell Dev. Biol. 2022;10:887100. doi: 10.3389/fcell.2022.887100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dreyer C. A., VanderVorst K., Natwick D., Bell G., Sood P., Hernandez M., Angelastro J. M., Collins S. R., Carraway K. L. A complex of Wnt/planar cell polarity signaling components Vangl1 and Fzd7 drives glioblastoma multiforme malignant properties. Cancer Lett. 2023;567:216280. doi: 10.1016/j.canlet.2023.216280. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Feng H., Hu X., Yan R., Jia X., Feng H., Zhang N., Chen X. MicroRNA-124 plays an inhibitory role in cutaneous squamous cell carcinoma cells via targeting SNAI2, an immunotherapy determinant. Heliyon. 2024;10:e24671. doi: 10.1016/j.heliyon.2024.e24671. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Friedman J. M., Liang G., Liu C. C., Wolff E. M., Tsai Y. C., Ye W., Zhou X., Jones P. A. The putative tumor suppressor microRNA-101 modulates the cancer epigenome by repressing the polycomb group protein EZH2. Cancer Res. 2009;69:2623–2629. doi: 10.1158/0008-5472.CAN-08-3114. [DOI] [PubMed] [Google Scholar]
- Gamage C. D. B., Kim J. H., Zhou R., Park S. Y., Pulat S., Varlı M., Nam S. J., Kim H. Plectalibertellenone A suppresses colorectal cancer cell motility and glucose metabolism by targeting TGF-β/Smad and Wnt pathways. BioFactors. 2025;51:e2120. doi: 10.1002/biof.2120. [DOI] [PubMed] [Google Scholar]
- Gao T., Lin Y. Q., Ye H. Y., Lin W. M. miR-124 delivered by BM-MSCs-derived exosomes targets MCT1 of tumor-infiltrating Treg cells and improves ovarian cancer immunotherapy. Neoplasma. 2023;70:713–721. doi: 10.4149/neo_2023_230711N362. [DOI] [PubMed] [Google Scholar]
- Heydarzadeh S., Ranjbar M., Karimi F., Seif F., Alivand M. R. Overview of host miRNA properties and their association with epigenetics, long non-coding RNAs, and Xeno-infectious factors. Cell Biosci. 2021;11:43. doi: 10.1186/s13578-021-00552-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jin H., Li Q., Cao F., Wang S. N., Wang R. T., Wang Y., Tan Q. Y., Li C. R., Zou H., Wang D., Xu C. X. miR-124 inhibits lung tumorigenesis induced by K-ras mutation and NNK. Mol. Ther. Nucleic Acids. 2017;9:145–154. doi: 10.1016/j.omtn.2017.09.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kho D. H., Bae J. A., Lee J. H., Cho H. J., Cho S. H., Lee J. H., Seo Y. W., Ahn K. Y., Chung I. J., Kim K. K. KITENIN recruits Dishevelled/PKCδ to form a functional complex and controls the migration and invasiveness of colorectal cancer cells. Gut. 2009;58:509–519. doi: 10.1136/gut.2008.150938. [DOI] [PubMed] [Google Scholar]
- Kim S. J., Sun E. G., Bae J. A., Park S., Hong C.-S., Park Z.-Y., Kim H., Kim K. K. A peptide interfering with the dimerization of oncogenic KITENIN protein and its stability suppresses colorectal tumour progression. Clin. Transl. Med. 2022;12:e871. doi: 10.1002/ctm2.871. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lee J. H., Cho E. S., Kim M. Y., Seo Y. W., Kho D. H., Chung I. J., Kook H., Kim N. S., Ahn K. Y., Kim K. K. Suppression of progression and metastasis of established colon tumors in mice by intravenous delivery of short interfering RNA targeting KITENIN, a metastasis-enhancing protein. Cancer Res. 2005;65:8993–9003. doi: 10.1158/0008-5472.CAN-05-0590. [DOI] [PubMed] [Google Scholar]
- Lee J. K., Bae J. A., Sun E. G., Kim H. D., Yoon T. M., Kim K., Lee J. H., Lim S. C., Kim K. K. KITENIN increases invasion and migration of mouse squamous cancer cells and promotes pulmonary metastasis in a mouse squamous tumor model. FEBS Lett. 2009;583:711–717. doi: 10.1016/j.febslet.2009.01.014. [DOI] [PubMed] [Google Scholar]
- Li K. K., Pang J. C., Ching A. K., Wong C. K., Kong X., Wang Y., Zhou L., Chen Z., Ng H. K. miR-124 is frequently down-regulated in medulloblastoma and is a negative regulator of SLC16A1. Hum. Pathol. 2009;40:1234–1243. doi: 10.1016/j.humpath.2009.02.003. [DOI] [PubMed] [Google Scholar]
- Li Y., Ge D., Lu C. The SMART App: An interactive web application for comprehensive DNA methylation analysis and visualization. Epigenetics Chromatin. 2019;12:71. doi: 10.1186/s13072-019-0316-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liao S. W., Liao X. H., Wu S. H., Li Y. F., Chen P. Y., Wang Y. L., Lu Y. C., Tai C. K. Methylation-mediated silencing of miR-124-3 regulates LRRC1 expression and promotes oral cancer progression. Cancers. 2025;17:1136. doi: 10.3390/cancers17071136. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liu Y., Yang Y., Wang X., Yin S., Liang B., Zhang Y., Fan M., Fu Z., Shen C., Han Y., Chen B., Zhang Q. Function of microRNA-124 in the pathogenesis of cancer (Review) Int. J. Oncol. 2023;64:6. doi: 10.3892/ijo.2023.5594. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lopez-Serra P., Esteller M. DNA methylation-associated silencing of tumor-suppressor microRNAs in cancer. Oncogene. 2012;31:1609–1622. doi: 10.1038/onc.2011.354. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lujambio A., Ropero S., Ballestar E., Fraga M. F., Cerrato C., Setién F., Casado S., Suarez-Gauthier A., Sanchez-Cespedes M., Gitt A., Spiteri I., Das P. P., Caldas C., Miska E., Esteller M. Genetic unmasking of an epigenetically silenced microRNA in human cancer cells. Cancer Res. 2007;67:1424–1429. doi: 10.1158/0008-5472.CAN-06-4218. [DOI] [PubMed] [Google Scholar]
- Maurya N., Meena A., Luqman S. Harnessing the therapeutic potential of MicroRNAs and phytochemicals in modulating miRNA regulation during carcinogenesis. Biochem. Biophys. Res. Commun. 2025;778:152381. doi: 10.1016/j.bbrc.2025.152381. [DOI] [PubMed] [Google Scholar]
- Mentink R. A., Rella L., Radaszkiewicz T. W., Gybel T., Betist M. C., Bryja V., Korswagen H. C. The planar cell polarity protein VANG-1/Vangl negatively regulates Wnt/β-catenin signaling through a Dvl dependent mechanism. PLoS Genet. 2018;14:e1007840. doi: 10.1371/journal.pgen.1007840. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Moarii M., Boeva V., Vert J. P., Reyal F. Changes in correlation between promoter methylation and gene expression in cancer. BMC Genomics. 2015;16:873. doi: 10.1186/s12864-015-1994-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Modhukur V., Iljasenko T., Metsalu T., Lokk K., Laisk-Podar T., Vilo J. MethSurv: A web tool to perform multivariable survival analysis using DNA methylation data. Epigenomics. 2018;10:277–288. doi: 10.2217/epi-2017-0118. [DOI] [PubMed] [Google Scholar]
- Oltra S. S., Peña-Chilet M., Vidal-Tomas V., Flower K., Martinez M. T., Alonso E., Burgues O., Lluch A., Flanagan J. M., Ribas G. Methylation deregulation of miRNA promoters identifies miR124-2 as a survival biomarker in Breast Cancer in very young women. Sci. Rep. 2018;8:14373. doi: 10.1038/s41598-018-32393-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Park S. Y., Kim H., Yoon S., Bae J. A., Choi S. Y., Jung Y. D., Kim K. K. KITENIN-targeting microRNA-124 suppresses colorectal cancer cell motility and tumorigenesis. Mol. Ther. 2014;22:1653–1664. doi: 10.1038/mt.2014.105. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Prabhakaran R., Thamarai R., Sivasamy S., Dhandayuthapani S., Batra J., Kamaraj C., Karthik K., Shah M. A., Mallik S. Epigenetic frontiers: miRNAs, long non-coding RNAs and nanomaterials are pioneering to cancer therapy. Epigenetics Chromatin. 2024;17:31. doi: 10.1186/s13072-024-00554-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Saviana M., Le P., Micalo L., Del Valle-Morales D., Romano G., Acunzo M., Li H., Nana-Sinkam P. Crosstalk between miRNAs and DNA methylation in cancer. Genes. 2023;14:1075. doi: 10.3390/genes14051075. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Song B. F., Xu L. Z., Jiang K., Cheng F. MiR-124-3p inhibits tumor progression in prostate cancer by targeting EZH2. Funct. Integr. Genomics. 2023;23:80. doi: 10.1007/s10142-023-00991-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Song J., Yang P., Chen C., Ding W., Tillement O., Bai H., Zhang S. Targeting epigenetic regulators as a promising avenue to overcome cancer therapy resistance. Signal Transduct. Target. Ther. 2025;10:216. doi: 10.1038/s41392-025-02266-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sproul D., Kitchen R. R., Nestor C. E., Dixon J. M., Sims A. H., Harrison D. J., Ramsahoye B. H., Meehan R. R. Tissue of origin determines cancer-associated CpG island promoter hypermethylation patterns. Genome Biol. 2012;13:R84. doi: 10.1186/gb-2012-13-10-r84. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sun Y., Duan F., Liu W., Peng Z., Dai L., Feng Y., Yang Z., Shang J., Wang K. Comprehensive assessment of the relationship between microRNA-124 and the prognostic significance of cancer. Front. Oncol. 2018;8:252. doi: 10.3389/fonc.2018.00252. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sun Y., Zhao X., Zhou Y., Hu Y. MiR-124, miR-137 and miR-340 regulate colorectal cancer growth via inhibition of the Warburg effect. Oncol. Rep. 2012;28:1346–1352. doi: 10.3892/or.2012.1958. [DOI] [PubMed] [Google Scholar]
- Suzuki H., Maruyama R., Yamamoto E., Kai M. DNA methylation and microRNA dysregulation in cancer. Mol. Oncol. 2012;6:567–578. doi: 10.1016/j.molonc.2012.07.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Varlı M., Kim S. J., Noh M. G., Kim Y. G., Ha H. H., Kim K. K., Kim H. KITENIN promotes aerobic glycolysis through PKM2 induction by upregulating the c-Myc/hnRNPs axis in colorectal cancer. Cell Biosci. 2023;13:146. doi: 10.1186/s13578-023-01089-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Varlı M., Kim E., Oh S., Pulat S., Zhou R., Gamage C. D. B., Gökalsın B., Sesal N. C., Kim K. K., Paik M. J., Kim H. Chrysophanol inhibits of colorectal cancer cell motility and energy metabolism by targeting the KITENIN/ErbB4 oncogenic complex. Cancer Cell Int. 2024;24:253. doi: 10.1186/s12935-024-03434-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Varlı M., Ji M., Kim E., Kim S. J., Choi B., Ha H. H., Kim K. K., Paik M. J., Kim H. Emodin disrupts the KITENIN oncogenic complex by binding ErbB4 and suppresses colorectal cancer progression in dual blockade with KSRP-binding compound. Phytomedicine. 2025a;136:156247. doi: 10.1016/j.phymed.2024.156247. [DOI] [PubMed] [Google Scholar]
- Varlı M., Oh S., Kim E., Gökalsın B., Sesal N. C., Kim K. K., Paik M. J., Kim H. Disintegration of the KITENIN/ErbB4 functional complex by the flavonoid hispidulin suppresses colorectal cancer progression. Adv. Ther. 2025b;8:e00227. doi: 10.1002/adtp.202400227. [DOI] [Google Scholar]
- Wang Y., Chen L., Wu Z., Wang M., Jin F., Wang N., Hu X., Liu Z., Zhang C. Y., Zen K., Chen J., Liang H., Zhang Y., Chen X. miR-124-3p functions as a tumor suppressor in breast cancer by targeting CBL. BMC Cancer. 2016;16:826. doi: 10.1186/s12885-016-2862-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wei Y., Wang P., Zhao J., Fan X., Jiang J., Mu X., Wang Y., Yang A., Zhang R., Hu S., Guo Z. Overexpression of miR-124 enhances the therapeutic benefit of TMZ treatment in the orthotopic GBM mice model by inhibition of DNA damage repair. Cell Death Dis. 2025;16:47. doi: 10.1038/s41419-025-07363-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wilting S. M., van Boerdonk R. A. A., Henken F. E., Meijer C. J. L. M., Diosdado B., Meijer G. A., le Sage C., Agami R., Snijders P. J. F., Steenbergen R. D. M. Methylation-mediated silencing and tumour suppressive function of hsa-miR-124 in cervical cancer. Mol. Cancer. 2010;9:167. doi: 10.1186/1476-4598-9-167. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yang Z., Liu X., Xu H., Teschendorff A. E., Xu L., Li J., Fu M., Liu J., Zhou H., Wang Y., Zhang L., He Y., Lv K., Yang H. Integrative analysis of genomic and epigenomic regulation reveals miRNA mediated tumor heterogeneity and immune evasion in lower grade glioma. Commun. Biol. 2024;7:824. doi: 10.1038/s42003-024-06488-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yang Z., Wang L. Regulation of microRNA expression and function by nuclear receptor signaling. Cell Biosci. 2011;1:31. doi: 10.1186/2045-3701-1-31. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhu Y., Liu K., Zhu H. Targeting epigenetic methylation: Emerging diagnosis and therapeutic strategies in cancer. Exp. Hematol. Oncol. 2026;15:27. doi: 10.1186/s40164-026-00760-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
