SIRT6 Mediates Sterol-Dependent Feedback Regulation of Cholesterol Biosynthetic Genes in Hepatocytes

Abstract

Metabolic dysfunction-associated steatohepatitis (MASH) is characterized by lipotoxic hepatocellular injury, inflammation, and fibrosis, with excess hepatic cholesterol contributing to disease pathogenesis. While the SCAP–INSIG–SREBP2 pathway classically regulates cholesterol biosynthetic gene expression via sterol sensing at the endoplasmic reticulum, the epigenetic mechanisms coupling cellular sterol status to gene expression remain unclear. Here, we investigated the role of sirtuin 6 (SIRT6), a nuclear histone deacetylase, in sterol-induced feedback regulation of cholesterol biosynthetic genes in hepatocytes. In HepG2 and AML12 cells, 25-hydroxycholesterol (25-HC) reduced the expression of SREBP2 and downstream cholesterol biosynthetic genes, including HMGCR and HMGCS1. This repression was associated with SIRT6 activation, as evidenced by reduced acetylation of histone H3 lysine 9 and lysine 56. Pharmacological SIRT6 inhibition reversed the repression of cholesterol biosynthetic genes, whereas SIRT6 activators phenocopied the inhibitory effects of 25-HC on the SREBP2 pathway. Conversely, sterol depletion via lovastatin inhibited SIRT6 activity, leading to the compensatory upregulation of cholesterol biosynthetic genes. Notably, SIRT6 overexpression or pharmacological activation reversed lovastatin-induced upregulation of SREBP2 and its target genes. These findings establish SIRT6 as a sterol-responsive nuclear regulator that converts intracellular cholesterol status into epigenetic repression of the cholesterol biosynthetic program. This SIRT6-dependent pathway complements endoplasmic reticulum-based sterol sensing and provides a mechanistic insight into hepatic cholesterol dysregulation in MASH.

INTRODUCTION

Metabolic dysfunction-associated steatohepatitis (MASH) is an inflammatory liver disease characterized by hepatocellular injury, hepatic inflammation, and progressive fibrosis in the setting of excessive lipid accumulation (Rinella et al., 2023). Hepatocyte injury in MASH is frequently driven by lipotoxicity, a process whereby the accumulation of toxic lipid species induces cellular dysfunction and death (Marra and Svegliati-Baroni, 2018). Injured hepatocytes release damage-associated molecular patterns, chemokines, and cytokines, which recruit and activate innate immune cells, such as neutrophils and monocytes. These activated immune cells further secrete inflammatory mediators, creating a feed-forward loop that amplifies hepatic inflammation (Kostallari et al., 2025; Yang et al., 2022). In parallel, profibrotic cytokines such as transforming growth factor-β activate hepatic stellate cells and promote transformation into myofibroblast-like cells that produce extracellular matrix components and drive hepatic fibrosis (Kisseleva and Brenner, 2021).

While free fatty acids have traditionally been regarded as the primary driver of lipotoxicity in lipid-laden hepatocytes, accumulating evidence has identified cholesterol as a critical contributor to MASH pathogenesis (Ioannou, 2016). In particular, the accumulation of cholesterol crystals has been shown to trigger hepatocellular injury and inflammation (Ioannou et al., 2017). Consistent with this concept, dietary cholesterol supplementation is now widely recognized as a requirement for the robust induction of diet-induced MASH in murine models (Fang et al., 2022; Farrell et al., 2019). These observations underscore the importance of elucidating the molecular mechanisms that govern hepatic cholesterol homeostasis as a strategy to identify novel therapeutic targets for MASH.

Despite the deleterious effects of excess cholesterol, cholesterol is indispensable for cellular function, serving as a key component of lipid bilayer membranes and a precursor for steroid hormones and bile acids. Therefore, cholesterol biosynthesis is tightly regulated through feedback mechanisms that maintain intracellular sterol homeostasis (Luo et al., 2020). A central regulatory system is the SCAP–INSIG signaling axis, which controls the activation of sterol regulatory element-binding protein 2 (SREBP2), the master transcription factor governing the expression of cholesterol biosynthetic genes (Goldstein et al., 2006). Under sterol-depleted conditions, the SREBP2–SCAP complex translocates from the endoplasmic reticulum (ER) to the Golgi apparatus, where SREBP2 undergoes proteolytic cleavage to release the transcriptionally active N-terminal domain (Goldstein et al., 2006). In contrast, elevated sterol levels promote the binding of SCAP to INSIG proteins, thereby retaining the SREBP2–SCAP complex in the ER and preventing SREBP2 activation (Goldstein et al., 2006). In addition to regulating SREBP2 processing, the SCAP–INSIG pathway controls the stability of 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR), the rate-limiting enzyme in cholesterol biosynthesis (Jo and DeBose-Boyd, 2022). When sterol levels are elevated, HMGCR associates with INSIG proteins in the ER membrane, leading to the recruitment of ubiquitin ligase such as gp78, ubiquitination of HMGCR, and subsequent proteasomal degradation, which rapidly suppresses cholesterol production (Schumacher and DeBose-Boyd, 2021).

25-hydroxycholesterol (25-HC) is a hydroxylated cholesterol metabolite that inhibits sterol biosynthesis more potently than cholesterol itself (Goldstein et al., 2006). 25-HC suppresses cholesterol biosynthesis by blocking ER-to-Golgi transport of the SREBP2–SCAP complex, thereby preventing the proteolytic activation and nuclear translocation of SREBP2 (Sakai et al., 1996). In addition, 25-HC accelerates the degradation of HMGCR (Sever et al., 2003). However, the underlying molecular mechanisms differ between cholesterol and 25-HC. While cholesterol directly binds to the sterol sensing domain of SCAP to induce a conformation change that facilitates INSIG binding, multiple lines of evidence suggest that 25-HC does not inhibit SREBP2 processing through direct interaction with SCAP (Adams et al., 2004). This distinction raises the possibility that 25-HC engages alternative regulatory pathways to mediate feedback inhibition of cholesterol biosynthesis beyond the classical SCAP–INSIG pathway.

Sirtuin 6 (SIRT6) belongs to the sirtuin family of histone deacetylases and functions as a key regulator of cellular metabolism (Chen et al., 2025). By modulating the transcription of a wide range of target genes, SIRT6 plays a central role in metabolic homeostasis, including glucose and lipid metabolic pathways (You and Liang, 2023). In addition to these functions, accumulating evidence supports a role of SIRT6 in the regulation of cholesterol biosynthesis. Tao et al. reported that hepatic SREBP2 expression was elevated in the livers of hepatocyte-specific Sirt6-deficient mice (Tao et al., 2013). Mechanistically, forkhead box O3 (FoxO3) was shown to recruit SIRT6 to the SREBP2 promoter, where SIRT6 deacetylates histone H3 and promotes chromatin condensation, resulting in transcriptional repression of SREBP2. In a separate study, SIRT6 was shown to suppress the transcription of SCAP, site-1 protease (S1P), and site-2 protease (S2P), all of which are essential for the proteolytic activation of SREBPs (Elhanati et al., 2013). These findings support a role for SIRT6 as a negative regulator of SREBP2 expression and cholesterol biosynthetic genes. However, it remains unexplored whether SIRT6 contributes to sterol-induced feedback regulation of SREBP2 and cholesterol biosynthetic genes.

In this study, gain- and loss-of-function approaches were used to demonstrate that SIRT6 contributes to feedback regulation of cholesterol biosynthetic gene expression in response to sterol perturbation, including 25-HC-induced sterol replenishment and lovastatin-induced sterol depletion. These results identify SIRT6 as an additional regulatory layer in cholesterol homeostasis that operates in addition to the canonical sterol-sensing pathway mediated by the SCAP–INSIG complex and provide new insight into the molecular mechanisms controlling hepatic cholesterol metabolism in the context of metabolic liver disease.

MATERIALS AND METHODS

Materials

25-HC (#HY-113134), lovastatin (#HY-N0504), MDL-800 (#HY-119376), OSS-128167 (#HY-107454), and UBCS039 (#HY-115453) were obtained from MedChemExpress (Monmouth Junction, NJ, USA). The mixture of insulin, transferrin, and selenium (ITS; #41400045) was purchased from Thermo Fisher Scientific (Waltham, MA, USA). Dexamethasone (#D1961) was purchased from Tokyo Chemical Industry (Tokyo, Japan). Fetal bovine serum (FBS; #SH30919.03) was purchased from Cytiva (Marlborough, MA, USA). Penicillin-streptomycin (#LS202-02) was purchased from Welgene (Gyeongsan, Korea).

Cell culture

HepG2 human hepatoma cells (ATCC, Manassas, VA, USA) were cultured at 37°C under 5% CO₂ in Dulbecco’s modified Eagle’s medium (DMEM; #SH30243.01, Cytiva, Marlborough, MA, USA) containing 10% FBS and 1% penicillin–streptomycin. AML12 mouse hepatocytes (ATCC) were cultured at 37°C under 5% CO₂ in a 1:1 mixture of DMEM and Ham’s F12 medium (#LM002-08, Welgene, Gyeongsan, Korea) containing ITS, 40 ng/mL dexamethasone, 10% FBS, and 1% penicillin–streptomycin. T-75 flasks were used for cell propagation, and the experiments were performed in 6-, 12-, and 96-well plates. The cells were grown until they reached 80% confluence and were passaged at least twice a week.

Isolation of primary mouse hepatocytes

Primary hepatocytes were obtained from C57BL/6J mice using a standard two-step collagenase perfusion method (Cho et al., 2026a). In brief, mice were anesthetized and the liver was perfused through the portal vein with calcium- and magnesium-free Hank’s balanced salt solution (#LB003-04; Welgene, Gyeongsan, Korea) to clear residual blood, followed by perfusion with a collagenase-containing digestion buffer. Excised livers were gently dissociated to release hepatocytes, and the resulting suspension was passed through a 70-μm mesh filter. Hepatocytes were then enriched by low-speed centrifugation (50×g, 5 min) and washed twice with Dulbecco’s modified Eagle’s medium (DMEM). Cells were subsequently maintained at 37°C in a 5% CO₂ atmosphere in DMEM (#SH30243.01; Cytiva, Marlborough, MA, USA) supplemented with 10% FBS (#SH30919.03; Cytiva) and 1% penicillin–streptomycin (#LS202-02; Welgene).

Transient transfection

Overexpression of SIRT6 in AML12 cells was achieved by a transient transfection of the plasmid that expresses the mouse Sirt6 coding sequence or pcDNA3.1 as a negative control (Moon et al., 2019; Shi et al., 2020). Transfection was performed using Lipofectamine 3000 (#L3000015, Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s protocol.

Cell lysis, subcellular fractionation, and immunoblot analysis

To obtain whole-cell lysates, the cells were lysed in radioimmunoprecipitation assay buffer (#EBR001-500, Enzynomics, Daejeon, Korea) containing a cocktail of protease and phosphatase inhibitors (#P3300-001, GenDEPOT, Baker, TX, USA) according to the manufacturer’s instructions. Subcellular fractionation of the cells via differential centrifugation was performed as previously described (Cho et al., 2026b; Kwon et al., 2024). Protein concentration in the lysate was determined using a bicinchoninic acid assay kit (#23225, Thermo Fisher Scientific, Waltham, MA, USA). Immunoblotting was performed as previously described (Hwang et al., 2017; Kim et al., 2025). Briefly, protein extracts were loaded onto 6%, 8%, or 12% polyacrylamide gels and transferred onto nitrocellulose membranes (#10600003, Cytiva, Marlborough, MA, USA). The protein bands were visualized using SuperSignal West Pico PLUS Chemiluminescent Substrate (#34580, Thermo Fisher Scientific) and analyzed using a ChemiDocTM MP Imaging System (Bio-Rad, Hercules, CA, USA). Antibodies against SREBP2 (#sc-13552) and β-Actin (#sc-47778) were purchased from Santa Cruz Biotechnology (Dallas, TX, USA). Antibody against HMGCR (#PA5-37367) was purchased from Thermo Fisher Scientific. Antibodies against SIRT6 (#12486), acetylated histone H3K9 (Ac-H3K9, #9677), and acetylated histone H3K56 (Ac-H3K56, #4243) were obtained from Cell Signaling Technology (Danvers, MA, USA).

Total RNA isolation and RT-qPCR

Total RNA was purified from the cell cultures using the RiboEx reagent (#301-002, Geneall, Seoul, Korea) according to the manufacturer’s instructions. One microgram of RNA was reverse transcribed into complementary DNA (cDNA) using a ReverTraAce cDNA synthesis kit (#FSQ-101, Toyobo, Osaka, Japan). cDNA was amplified using a SYBR Green Kit (#RT500M, Enzynomics, Daejeon, Korea) on a CFX Connect Real-Time PCR System (Bio-Rad, Hercules, CA, USA). The 2^–ΔΔCt method was used to calculate mRNA levels. The primer sequences used for PCR are listed in Table 1.

Table 1.

Sequences for the primers used in RT-qPCR analysis

Species	Target mRNA	Forward primer	Reverse primer
Human	GAPDH	GCCCCAGCGTCA AAGGT	GGCATCCTGGGCTACACTGA
Human	HMGCR	CAAGGAGCATGCAAAGATAATCC	GCCATTACGGTCCCACACA
Human	HMGCS1	CTCTTGGGATGGACGGTATGC	GCTCCAACTCCACCTGTAGG
Human	SREBP2	CGGTAATGATCACGCCAACAT	TGGTATATCAAAGGCTGCTGGAT
Mouse	Gapdh	TGTGTCCGTCGTGGATCTGA	CCTGCTTCACCACCTTCTTGAT
Mouse	Hmgcr	CTTGTGGAATGCCTTGTGATTG	AGCCGAAGCAGCACATGAT
Mouse	Hmgcs1	AACTGGTGCAGAAATCTCTAGC	GGTTGAATAGCTCAGAACTAGCC
Mouse	Ldlr	AGGCTGTGGGCTCCATAGG	TGCGGTCCAGGGTCATCT
Mouse	Srebp2	GCGTTCTGGAGACCATGGA	ACAAAGTTGCTCTGAAAACAAATCA
Mouse	Fasn	GCTGCGGAAACTTCAGGAAAT	AGAGACGTGTCACTCCTGGACTT
Mouse	Acaca	TGGACAGACTGATCGCAGAGAAAG	TGGAGAGCCCCACACACA
Mouse	Scd	CCGGAGACCCCTTAGATCGA	TAGCCTGTAAAAGATTTCTGCAAACC

In vitro SIRT6 activity assay

Enzymatic SIRT6 activity assays were performed by using Fluorometric SIRT6 Activity Assay Kit (#ab156068, Abcam, Cambridge, UK), according to the manufacturer’s instructions. Briefly, dimethyl sulfoxide or different concentrations of 25-HC were incubated in an assay buffer including fluorosubstrate peptide, NAD, developer, and recombinant SIRT6, and the fluorescence at 495 nm and 535 nm were measured using a microplate reader (Tecan, Mannedorf, Switzerland).

In silico analysis of publicly available ChIP-seq data

Publicly available chromatin immunoprecipitation sequencing (ChIP-seq) datasets for SIRT6 were retrieved from the ChIP-Atlas integrative database (https://chip-atlas.org). Peak call data (in BED format) mapped to the human reference genome (GRCh38/hg38) were downloaded for downstream visualization. To examine SIRT6 occupancy at the SREBP2 locus, the peak coordinates were imported into the R statistical computing environment using the GenomicRanges package. Genomic track visualizations, including gene models and target peak alignments, were generated utilizing the Gviz package. Transcript annotations and genomic structures were defined using the TxDb.Hsapiens.UCSC.hg38.knownGene database package.

Statistical analysis

Data are expressed as means ± standard errors of the mean and were analyzed using the GraphPad Prism software (v.7.0a; GraphPad Software, La Jolla, CA, USA). The Student’s t-tests were performed to compare the values obtained from the two groups. One-way analysis of variance was conducted to compare more than three groups, followed by a post hoc Tukey’s test to determine specific group differences. Significance was set at p<0.05.

RESULTS

25-HC inhibits the expression of cholesterol biosynthetic genes

The liver is the primary site of cholesterol production (Luo et al., 2020); however, in vitro feedback regulation of cholesterol biosynthesis has been characterized predominantly in non-hepatocytes, such as Chinese hamster ovary cells (e.g., CHO-K1, CHO-7, SRD-13A) and human skin fibroblasts (e.g., SV-589) (Faulkner et al., 2024; Gong et al., 2006; Hwang et al., 2017; Kober et al., 2020; Nohturfft et al., 2000; Song et al., 2005). To investigate whether 25-HC contributes to feedback regulation of cholesterol synthesis in hepatocytes, HepG2 cells were treated with increasing concentrations of 25-HC. The expression of HMGCR, the rate-limiting enzyme of the cholesterol biosynthetic pathway, was reduced by the treatment with 25-HC (Fig. 1A). In addition, the expression of the mature form of SREBP2 (~68 kDa), a transcription factor that controls multiple cholesterol biosynthetic enzymes, was reduced by 25-HC (Fig. 1A). Consistent results were observed in AML12 mouse hepatocytes and primary mouse hepatocytes, where 25-HC reduced the expression of HMGCR and mature SREBP2 (Fig. 1B, 1C). As 25-HC-dependent feedback regulation occurs at multiple levels, including transcriptional and post-translational regulation, we performed RT-qPCR analysis to assess transcriptional changes in cholesterol biosynthetic genes. 25-HC treatment reduced the mRNA levels of cholesterol biosynthetic genes, such as HMGCR and HMGCS1 (Fig. 1D) in HepG2 cells. SREBP2 mRNA levels were also decreased by 25-HC. Similarly, the transcription of Srebp2, Hmgcr, and Hmgcs1 was reduced in AML12 mouse hepatocytes (Fig. 1E). Collectively, these results demonstrate that 25-HC regulates cholesterol homeostasis in hepatocytes by suppressing the expression of cholesterol biosynthetic genes.

Fig. 1.

25-Hydroxycholesterol inhibits cholesterol biosynthetic gene expression in hepatocytes. (A) HepG2 cells were treated with increasing concentrations of 25-hydroxycholesterol (25-HC; 0, 0.3, and 1 μg/mL) for 12 h. (B) AML12 cells were treated with increasing concentrations of 25-HC (0, 1, and 3 μg/mL) for 12 h. (C) Primary mouse hepatocytes were treated with increasing concentrations of 25-HC (0, 0.3, 1, and 3 μg/mL) for 5 h. Cell lysates were subjected to immunoblot analysis for HMGCR, mature SREBP2 (~68 kDa), and β-Actin. Representative immunoblot images are shown at the top, and densitometric quantification of HMGCR and SREBP2 protein levels normalized to β-Actin is shown below. (D) HepG2 cells were treated with 25-HC (1 μg/mL) for 12 h. Transcript levels of SREBP2, HMGCR, and HMGCS1 were assessed by RT-qPCR. (E) AML12 cells were treated with 25-HC (1 μg/mL) for 12 h. Transcript levels of Srebp2, Hmgcr, and Hmgcs1 were assessed by RT-qPCR. Values represent mean ± SEM (n=3). Statistical evaluation was performed using Student’s t-tests (*p<0.05, **p<0.01). 25-HC, 25-hydroxycholesterol.

25-HC promotes SIRT6 activation

As SIRT6 inhibits the basal expression of cholesterol biosynthetic genes (Tao et al., 2013), we investigated whether SIRT6 also mediates the 25-HC-induced downregulation of these genes. Since SIRT6 functions as a deacetylase targeting histone H3 at lysine 9 (H3K9) and lysine 56 (H3K56) (Kawahara et al., 2009; Michishita et al., 2008, 2009; Yang et al., 2009; Zhong et al., 2010), we analyzed the acetylation status of these residues. Immunoblot analysis revealed that 25-HC treatment reduced the levels of acetylated H3K9 and H3K56 in HepG2 cells, indicating SIRT6 activation and the subsequent deacetylation of these sites (Fig. 2A). Similarly, 25-HC treatment decreased the levels of acetylated H3K9 and H3K56 in AML12 mouse hepatocytes (Fig. 2B). However, 25-HC did not directly increase SIRT6 activity, as evidenced by an in vitro assay using recombinant SIRT6 (Fig. 2C). This suggests that 25-HC does not interact directly with SIRT6 but regulates its activity through other intracellular mediators.

Fig. 2.

25-Hydroxycholesterol inhibits the levels of acetylated H3K9 and H3K56 in hepatocytes. (A, B) HepG2 (panel A) and AML12 (panel B) cells were treated with increasing concentrations of 25-hydroxycholesterol for 12 h. The cell lysates were subjected to immunoblot analysis of acetylated H3K9, acetylated H3K56, and β-Actin. (C) In vitro SIRT6 activity assay was performed with different concentrations of 25-hydroxycholesterol (0, 0.3, 1, and 3 μg/mL). Relative SIRT6 activity at each concentration was normalized with the vehicle-treated condition. Values represent mean ± SEM (n=3). Statistical evaluation was performed using one-way ANOVA with Tukey’s post hoc test for multiple comparisons. 25-HC, 25-hydroxycholesterol; acetylated H3K9, Ac-H3K9; acetylated H3K56, Ac-H3K56.

SIRT6 has also been suggested to inhibit lipogenesis through LXR acetylation (Cho et al., 2026b). Therefore, we examined whether 25-HC inhibits the expression of lipogenic genes, such as Fasn, Acaca, and Scd. 25-HC treatment reduced the mRNA levels of these lipogenic genes in AML12 hepatocytes (Supplementary Fig. 1).

SIRT6 activation contributes to the 25-HC-induced feedback inhibition of cholesterol biosynthetic gene expression

Given that 25-HC activates SIRT6, we next investigated the role of SIRT6 activation in the feedback regulation of cholesterol biosynthetic gene expression. Treatment with 25-HC reduced the protein expression of HMGCR and the mature form of SREBP2 in HepG2 cells (Fig. 3A). Furthermore, 25-HC treatment reduced the acetylation of H3K9 and H3K56, suggesting increased SIRT6 activity. Notably, the 25-HC-induced suppression of HMGCR and SREBP2 was mitigated by OSS-128167, a selective SIRT6 inhibitor (Fig. 3A) (Huang et al., 2021; Jiang et al., 2019; Kim et al., 2025). OSS-128167 also reversed the deacetylation of H3K9 and H3K56, confirming the inhibition of SIRT6 activity (Fig. 3A). Moreover, pretreatment with OSS-128167 attenuated the 25-HC-induced reduction of SREBP2, HMGCR, and HMGCS1 mRNA levels (Fig. 3B). Collectively, these results indicate that the 25-HC-induced feedback inhibition of cholesterol biosynthetic genes is dependent on SIRT6 activity.

Fig. 3.

Modulation of SIRT6 activity regulates cholesterol biosynthetic gene expression in hepatocytes. (A, B) HepG2 cells were treated with 25-hydroxycholesterol (1 μg/mL) for 12 h following a 30-min pretreatment with OSS-128167 (100 μM). (A) Cell lysates were subjected to immunoblot analysis for HMGCR, mature SREBP2 (~68 kDa), SIRT6, acetylated H3K9, acetylated H3K56, and β-Actin. Representative immunoblot images are shown on the left, and densitometric quantification of HMGCR, SREBP2, and SIRT6 protein levels normalized to β-Actin is shown on the right. (B) Transcript levels of SREBP2, HMGCR, and HMGCS1 were assessed by RT-qPCR. (C, D) AML12 cells were treated with 25-hydroxycholesterol (1 μg/mL), UBCS039 (100 μM), or MDL-800 (25 μM) for 24 h. (C) The cell lysates were analyzed by immunoblotting for HMGCR, SIRT6, acetylated H3K9, and β-Actin. (D) Transcript levels of Srebp2, Hmgcr, and Hmgcs1 were assessed by RT-qPCR. Values represent mean ± SEM (n=3). Statistical evaluation was performed using one-way ANOVA with Tukey’s post hoc test for multiple comparisons (*p<0.05 and **p<0.01 vs. vehicle-treated control). 25-HC, 25-hydroxycholesterol; acetylated H3K9, Ac-H3K9; acetylated H3K56, Ac-H3K56.

We next examined whether pharmacological activation of SIRT6 mimics the inhibitory effect of 25-HC on cholesterol biosynthetic gene expression. Treatment with UBCS039, a selective SIRT6 activator (Cho et al., 2026b; Iachettini et al., 2018; Jiao et al., 2022), reduced the expression of HMGCR and SREBP2 (Fig. 3C). We further performed RT-qPCR to assess the transcription of downstream cholesterol biosynthetic genes. UBCS039 inhibited the transcription of Hmgcr and Hmgcs1, as well as Srebp2, in AML12 cells (Fig. 3D). Consistently, treatment with MDL-800, another SIRT6 activator, also attenuated the transcript levels of Hmgcr, Hmgcs1, and Srebp2.

To further investigate the chromatin-level mechanism of SIRT6-mediated regulation, we performed an in silico analysis using publicly available SIRT6 ChIP-seq datasets. Visualization of the genomic tracks revealed significant SIRT6 occupancy sites located within the early intronic regions of the SREBP2 gene (Supplementary Fig. 2). This direct physical association provides genomic evidence supporting our model that SIRT6 functions as an epigenetic repressor of cholesterol biosynthesis by interacting with intragenic regulatory elements.

Sterol depletion by lovastatin inhibits SIRT6

In addition to the sterol-replete conditions mimicked by 25-HC supplementation, feedback regulation of cholesterol biosynthesis also occurs under sterol-deficient conditions. To investigate the role of SIRT6 in this context, we treated AML12 cells with lovastatin, which depletes cellular sterol levels through competitive inhibition of HMGCR (Frishman and Rapier, 1989). Lovastatin treatment increased the protein levels of HMGCR and SREBP2 in a dose-dependent manner (Fig. 4A). Furthermore, lovastatin elevated the levels of acetylated H3K9 and H3K56, indicating the inhibition of SIRT6 (Fig. 4A). Consistent with these findings, the transcript levels of Hmgcr, Hmgcs1, and Srebp2 were also upregulated by lovastatin treatment (Fig. 4B).

Fig. 4.

Lovastatin induces cholesterol biosynthetic gene expression in hepatocytes. (A) AML12 cells were treated with different concentrations of lovastatin (0, 1, 2.5, and 5 μM) for 24 h. The cell lysates were subjected to immunoblot analysis of HMGCR, mature SREBP2 (~68 kDa), acetylated H3K9, acetylated H3K56, and β-Actin. Representative immunoblot images are shown on the left, and densitometric quantification of HMGCR and SREBP2 protein levels normalized to β-Actin is shown on the right. (B) AML12 cells were treated with different concentrations of lovastatin (0, 1, 2.5, and 5 μM) for 24 h. Transcript levels of Srebp2, Hmgcr, and Hmgcs1 were assessed by RT-qPCR. Values represent mean ± SEM (n=3). Statistical evaluation was performed using one-way ANOVA with Tukey’s post hoc test for multiple comparisons (*p<0.05 and **p<0.01 vs. vehicle-treated control). Acetylated H3K9, Ac-H3K9; acetylated H3K56, Ac-H3K56.

SIRT6 inhibition contributes to the lovastatin-induced feedback activation of cholesterol biosynthetic genes

To confirm the role of SIRT6 in the lovastatin-induced upregulation of SREBP2, we transfected AML12 cells with a vector overexpressing Sirt6 or a control vector. The lovastatin-dependent elevation of the mature form of SREBP2 was attenuated by Sirt6 overexpression (Fig. 5A). In line with the SREBP2 protein levels, lovastatin-induced increase in the mRNA levels of Hmgcr, Hmgcs1, and Ldlr was reversed by Sirt6 overexpression (Fig. 5B).

Fig. 5.

SIRT6 activation reverses lovastatin-induced compensatory increase of cholesterol biosynthetic gene expression. (A, B) AML12 cells were transfected with Sirt6-overexpressing plasmid (Sirt6-OE) or pcDNA3.1 as a control for 24 h. Concomitantly, the cells were treated with lovastatin (5 μM) or dimethyl sulfoxide as a vehicle. (A) The cell lysates were subjected to immunoblot analysis of mature SREBP2 (~68 kDa), SIRT6, and β-Actin. (B) Transcript levels of Srebp2, Hmgcr, Hmgcs1, and Ldlr were assessed by RT-qPCR. (C) AML12 cells were treated with lovastatin (2.5 μM) for 12 h following a 30-min pretreatment with UBCS039 (100 μM). Transcript levels of Srebp2, Hmgcr, and Hmgcs1 were assessed by RT-qPCR. (D) HepG2 cells were treated with lovastatin (2.5 μM) for 12 h following a 30-min pretreatment with UBCS039 (100 μM). Transcript levels of SREBP2, HMGCR, and HMGCS1 were assessed by RT-qPCR. Values represent mean ± SEM (n=3). Statistical evaluation was performed using one-way ANOVA with Tukey’s post hoc test for multiple comparisons (*p<0.05, **p<0.01).

Although statins directly inhibit HMGCR activity, the compensatory upregulation of HMGCR and other cholesterol biosynthetic genes has been suggested to limit the therapeutic efficacy of statins (Hwang et al., 2016; Schumacher and DeBose-Boyd, 2021). Therefore, we investigated whether pharmacological activation of SIRT6 could serve as a strategy to overcome this limitation. Lovastatin treatment increased the transcript levels of Srebp2, Hmgcr, and Hmgcs1 in AML12 cells, which was prevented by pretreatment with UBCS039, a SIRT6 activator (Fig. 5C). Similarly, in HepG2 cells, the lovastatin-induced compensatory upregulation of cholesterol biosynthetic genes was attenuated by pretreatment with UBCS039 (Fig. 5D). Collectively, these results indicate lovastatin-induced SIRT6 inhibition contributes to the feedback regulation of cholesterol biosynthetic gene expression, and pharmacological activation of SIRT6 reverses the compensatory upregulation of cholesterol biosynthetic genes triggered by lovastatin.

DISCUSSION

In the present study, we identified SIRT6 as a critical epigenetic regulator of feedback control in cholesterol biosynthesis that operates in parallel with the canonical SCAP–INSIG signaling axis. We demonstrated that SIRT6 activity is dynamically regulated by intracellular sterol status. Specifically, 25-HC induces SIRT6 activation to suppress cholesterol biosynthetic gene expression, whereas sterol depletion induced by lovastatin inhibits SIRT6 activity, leading to the transcriptional upregulation of these genes (Fig. 6). Furthermore, we provided evidence that pharmacological activation of SIRT6 effectively attenuated the compensatory induction of cholesterol biosynthesis that limits statin efficacy. These findings establish SIRT6 as a pivotal negative regulator in the nucleus that cooperates with ER membrane-based sterol-sensing mechanisms to maintain hepatic lipid homeostasis.

Fig. 6.

Schematic representation of the regulatory role of SIRT6 in the feedback regulation of cholesterol biosynthetic gene expression. 25-hydroxycholesterol activates SIRT6, leading to the deacetylation of histone H3K9 and H3K56 and suppression of SREBP2 transcription. Reduced SREBP2 expression decreases the transcription of cholesterol biosynthetic genes, including HMGCR and HMGCS1, thereby contributing to the feedback inhibition of cholesterol synthesis.

Cellular cholesterol homeostasis has classically been attributed to the SREBP2–SCAP–INSIG pathway, which governs the proteolytic activation of SREBP2 through ER–to–Golgi trafficking. Our findings suggest that hepatocytes employ a dual-layer regulatory mechanism to ensure robust cholesterol homeostasis. While the SCAP–INSIG axis mediates a rapid post-translational response to acute fluctuations in ER sterol levels, SIRT6 functions in the nucleus to impose transcriptional repression through deacetylation of H3K9 and H3K56 at the promoter of SREBP2. This epigenetic mechanism likely serves as a stabilizing layer of regulation. Accordingly, further investigation is warranted to determine whether 25-HC treatment alters the acetylation status of promoters of cholesterol biosynthetic genes, for example through chromatin immunoprecipitation–based analyses. By promoting chromatin compaction at cholesterol biosynthetic loci, SIRT6 may suppress aberrant transcriptional activation during prolonged cholesterol excess, thereby providing a more sustained inhibitory effect than proteolytic regulation alone. This distinction is particularly relevant in the liver, which requires precise regulation of cholesterol metabolism due to its central role in whole-body lipid balance.

A key mechanistic insight from this study is the distinct mode of activation for SIRT6 compared to SCAP. Cholesterol directly binds to the sterol-sensing domain of SCAP to induce conformational changes. In contrast, our cell-free assays demonstrated that 25-HC does not directly stimulate the enzymatic activity of recombinant SIRT6. This discrepancy implies that the 25-HC-mediated activation of SIRT6 in hepatocytes occurs indirectly through intracellular signaling pathways. One possibility is that metabolites derived from 25-HC may participate in the signaling cascade leading to SIRT6 activation. For example, 25-HC is a substrate for the enzyme CYP7B1, which converts it into 7α,25-dihydroxycholesterol. Further investigation is required to determine whether 7α,25-dihydroxycholesterol or other downstream metabolites act as the proximal signals that trigger SIRT6 activation or facilitate its recruitment to the SREBP2 promoter. It is also plausible that 25-HC accumulation alters the intracellular metabolic state, potentially modulating the NAD⁺/NADH ratio or activating upstream kinases such as AMPK, both of which are known to regulate sirtuin activity. This suggests that SIRT6 acts as a broader metabolic sensor that integrates sterol-derived signals with cellular energy status, in contrast to the highly specific sterol-sensing mechanism of SCAP.

Emerging evidence supports a functional link between cellular NAD⁺ levels and SREBP2 regulation. Inhibition of NAMPT, a key enzyme in NAD⁺ biosynthesis, has been shown to induce SREBP2 expression, whereas supplementation with NAD⁺ or NMN attenuates this effect, indicating that NAD⁺ availability influences SREBP2 activity (Wang et al., 2017). In addition, SIRT6, an NAD⁺-dependent deacetylase, has been reported to be recruited by FoxO3 to the proximal promoter region of the SREBP2 gene, suggesting a chromatin-level mechanism of transcriptional repression (Tao et al., 2013). These findings are consistent with our proposed model in which 25-HC suppresses SREBP2 expression, potentially through activation of SIRT6. Collectively, this highlights a plausible link between metabolic state and epigenetic regulation of cholesterol biosynthesis.

Our findings have clinical implications for the pathogenesis and treatment of MASH. Excessive accumulation of free cholesterol is a major contributor to hepatocyte injury and disease progression in MASH (Ioannou, 2016). Under physiological conditions, cholesterol and cholesterol-derived oxysterols are expected to induce feedback inhibition to restrain further cholesterol synthesis. However, previous studies have reported reduced hepatic SIRT6 expression in patients with steatosis (Kim et al., 2010; Zang and Gao, 2022), a change that would be predicted to impair epigenetic feedback repression of cholesterol biosynthetic genes. In the absence of SIRT6-mediated transcriptional repression, hepatocytes may be unable to adequately suppress cholesterol biosynthesis despite lipotoxic overload, thereby sustaining a pathogenic cycle of inflammation and fibrosis. Accordingly, therapeutic strategies aimed at restoring or enhancing SIRT6 activity may interrupt this cycle by re-establishing the epigenetic suppression of cholesterol production.

This study further addresses a major pharmacological challenge in the management of hypercholesterolemia, namely the compensatory response elicited by statin therapy. Statins are the first-line pharmacological agents for cardiovascular risk reduction, and their therapeutic utility is also being actively explored in the context of MASH (Torres-Peña et al., 2021). However, inhibition of HMGCR by statins triggers a potent induction of SREBP2 and downstream cholesterol biosynthetic enzymes, which may attenuate net cholesterol-lowering efficacy of statins. We observed that lovastatin treatment reduced the deacetylation of H3K9 and H3K56, indicating that statin-induced sterol depletion inhibits SIRT6 activity. These findings identify SIRT6 inactivation as a potential driver of the compensatory transcriptional response. We demonstrated that the concomitant treatment with SIRT6 activator UBCS039 prevented feedback upregulation of cholesterol biosynthetic genes in hepatocytes. This supports a novel combination therapy paradigm in which SIRT6 activators function as combination therapy partners with statins. By targeting the epigenetic regulatory mechanisms, such an approach may overcome hepatic homeostatic resistance to statins, enabling improved cholesterol control or reduced statin dosing to mitigate adverse effects, including rhabdomyolysis.

It is noteworthy that SIRT6 overexpression or pharmacological activation significantly attenuated, but did not completely abolish, the lovastatin-induced upregulation of SREBP2 and its target genes. This partial reversal is likely due to the dominant role of the classical SCAP–INSIG–SREBP2 signaling axis at the ER membrane. Under sterol-depleted conditions induced by lovastatin, the SREBP2–SCAP complex rapidly translocates from the ER to the Golgi apparatus for proteolytic processing. This canonical post-translational mechanism represents the primary cellular response to acute sterol fluctuations. Our findings suggest that hepatocytes employ a dual-layer regulatory system to maintain cholesterol homeostasis. While the SCAP–INSIG axis facilitates a rapid response to changes in ER sterol levels, SIRT6 functions in the nucleus as a complementary epigenetic layer that imposes sustained transcriptional repression. By operating in parallel with the ER-based sensing machinery, the SIRT6-dependent pathway ensures a more stringent and stable control of the cholesterol biosynthetic program.

Several limitations of this study merit further investigation. First, it remains to be determined whether the findings from the current study are recapitulated in vivo. Hepatocyte-specific gain- and loss-of-function approaches targeting SIRT6 in mice fed a cholesterol-rich, MASH-inducing diet will be required to delineate the contribution of SIRT6 to (1) cholesterol biosynthetic gene expression, (2) hepatic and systemic cholesterol homeostasis, and (3) MASH severity. In addition, although this study demonstrates that 25-HC activates SIRT6 indirectly, further investigation is needed to identify the precise molecular intermediaries that link 25-HC sensing to nuclear SIRT6 activation. Finally, it will be important to determine whether other oxysterols elevated in MASH, such as 7α-hydroxycholesterol and 7β-hydroxycholesterol (Raselli et al., 2019), similarly engage SIRT6-medated feedback control of cholesterol homeostasis. Addressing this question will clarify the generalizability of SIRT6-dependent epigenetic regulation in cholesterol homeostasis under lipotoxic conditions.

In summary, this study demonstrates a mechanism by which SIRT6 converts intracellular sterol signals into epigenetic modifications that regulate transcriptional output of the cholesterol biosynthetic program. By functioning in parallel with the SCAP–INSIG pathway, SIRT6 contributes to stringent regulation of sterol production. Therapeutic targeting of this epigenetic axis represents a promising strategy for the treatment of disorders characterized by dysregulated cholesterol metabolism, including MASH and statin-resistant hyperlipidemia.