Abstract
Background:
Various studies have reported aberrant function of the immune system in endometriosis. This highly prevalent disease can initiate and progress by numerous genetic and epigenetic alterations that affect immune system functions. Regulatory T cells (Treg) play an important role in controlling and prevention of endometriosis through regulating immune responses. Treg cells are regulated by the forkhead box P3 (FOXP3) gene. The aim of this study is to monitor any changes in gene expression and epigenetic profile of FOXP3 in endometriosis.
Materials and Methods:
In the current case-control study, endometriotic tissues of women diagnosed with endometriosis (n=20) were compared with non-endometriotic women (n=20). Parallel to expression of this gene, chromatin immunoprecipitation (ChIP) coupled with real-time polymerase chain reaction (PCR) was used to quantify the incorporated levels of the epigenetic activating/repressing markers of H3K9ac/me2 into the FOXP3 promoter (n=6 in each group).
Results:
There was a significant reduction of FOXP3 in endometriotic tissues compared to the control group (P=0.001). Additionally, changes in the incorporated H3K9ac/me2 epigenetic markers were consistent with the expression results and supported the findings of this study.
Conclusion:
Downregulation of FOXP3 expression may be involved in the pathogenesis of endometriosis beyond its critical role in Treg responses. In addition, histone modifications of H3K9ac/me2 in the FOXP3 promoter may regulate gene expression in endometriosis.
Keywords: Endometriosis, Epigenetic, FOXP3, Histone Modification
Introduction
Endometriosis is an inflammatory and oestrogen-dependent disease with a prevalence of 6% to 10% in reproductive age women. It refers to the presence of endometrial tissue outside the uterine cavity (1). Although endometriosis is not an autoimmune disease, its inflammatory nature causes disorders in immune responses and can reduce fertility in affected patients (2). One of the accepted theories of endometriosis is Sampson’s theory of retrograde menstruation (3). Although most women experience retrograde menstruation, only 1 in 10 women develop endometriosis and the role of the immune factors in this disease is undeniable.
The immune system is believed to play an important role in the aetiology, pathophysiology, pain, infertility, and poor outcomes of pregnancy in women with endometriosis (2). In particular, immune cells in the form of innate and acquired immunity seem to play a key role in rejection or implantation of endometriotic cells in the peritoneal cavity (4). Under normal conditions, the immune system focuses on targeting endometrial cells that have been shed, even those coming from retrograde menstruation, to prevent these cells from implanting and causing endometriosis. Regulatory T cells (Tregs) are the main regulators responsible for managing this immune response (5). Treg cells are a subset of T cells that play an important role in homeostasis and immune tolerance.
Numerous studies have been performed on the immunological aspects of endometriosis and there are evidences that show the relationship between Treg cells and endometriosis. The main marker of these cells is forkhead box P3 (FOXP3), a master transcription factor, which has a special responsibility for the development and function of Treg cells (6). The expression level of FOXP3 in Treg cells is very important for regulatory function of these cells. Decreased FOXP3 levels lead to defective regulatory function of Treg cells (7), and mutations of this gene causes autoimmune diseases in mice (8, 9) and humans (10). A reduction in FOXP3+ Tregs can induce autoinflammation (11, 12). These findings prove that regulation of FOXP3 expression to control immune responses is critical.
Obviously, epigenetic factors control FOXP3 transcription and regulate its expression profile. Histone modifications play key roles in regulating chromatin structure and nuclear processes, and can be passed as epigenetic markers during cell division (13). Different histone modifica tions, such as methylation and acetylation, act in combination and regulate nuclear events and can incorporate different signalling pathways at the chromatin level (14). These mechanisms are a key focus in today’s biomedical research. “Epigenetics” involves changes in gene activity without altering the DNA sequence. It is well-known that changes in epigenetics are a major biological factor that cause issues with genes and lead to diseases. Covalent modifications of histones, including acetylation and methylation, also play crucial roles in shaping genome organisation and influencing gene expression. Endometriosis is considered an epigenetic disease because it is difficult to explain its inherited patterns due to genetic expression patterns alone (15). Knowing the relationship of the FOXP3 gene with endometriosis is important because of its crucial role in immune responses. For this aim, researchers have focused on examining this gene’s expression pattern (16, 17) and polymorphism change in endometriosis (18). However, evaluation of FOXP3 from an epigenetic perspective in endometriosis has not been thoroughly studied. In this study, we investigated the expression of FOXP3 gene in normal and endometriotic tissues. Then, for the first time, we measured the correlation of two specific histone markers, H3K9ac (gene activating) and H3K9me2 (gene repressive), in the promoter of the FOXP3 gene, as a regulatory region, and evaluated its relationship with the expression of this gene in endometriosis.
Materials and Methods
Patient and tissue collection
This case-control study was approved by the Research Ethics Committee of Royan Institute, Tehran, Iran (IR. ACECR.ROYAN.REC.1397.189) and performed in accordance with the approved guidelines (19). Consent was obtained from all participants according to the guidelines of the Declaration of Helsinki (2000 revision), after which endometrial tissue samples were collected.
This study enrolled 40 convenient women of childbearing age (20 to 45 years old) with regular menstrual cycles. The case group consisted of 20 women diagnosed with stages 3 and 4 endometriosis according to the American Society for Reproductive Medicine (ASRM-1997) classification. The control group comprised 20 women with at least one child from a natural pregnancy who underwent laparoscopic sur gery for ovarian cystectomy or tubal surgery, and in whom the absence of endometriosis was confirmed.
In the endometriosis group, ectopic tissues were ob tained by a laparoscopic procedure and eutopic endo metrial tissues were obtained using a pipelle by a skilled gynecologist at the Royan Institute for Reproductive Bio medicine. Biopsies were confirmed by pathological ex amination for endometriosis. The endometrial biopsy in control group was also obtained by pipelle sampling. All tissue samples were rapidly divided into sections of about 50 mg, placed in RNAlater solution, and stored at -80°C until use. Additionally, six samples were selected from each tissue group for epigenetic studies to explore pos sible modifications associated with endometriosis.
Exclusion criteria included the use of hormonal treat ment during the last three months before tissue sampling, irregular menstrual cycles, cancer, inflammatory and autoimmune diseases, endometrial hyperplasia, asthma, glomerulonephritis, osteoporosis, leukaemia, or benign uterine masses such as fibroids and polyps. All study par ticipants completed a clinical questionnaire and signed a written consent form.
RNA isolation and cDNA preparation
Endometrial tissues were removed from RNAlater solution and homogenised using a scalpel blade and glass homogeniser. Total RNA was extracted using the TRIzol reagent (cat: 15596026, Invitrogen, USA) according to the standard protocol of the manufacturer. Digestion was performed with DNase1 (cat: 2270, Takara, USA) to remove genomic DNA contamination from the RNA sample. cDNA synthesis was done using a Takara kit (cat: RR037A Takara Bio, Japan).
Quantitative real-time polymerase chain reaction
FOXP3 mRNA expression was assessed by quantitative real-time polymerase chain reaction (PCR) using a Step One Plus™ Real-time PCR System (Applied Biosystems, USA). All cDNAs were co-amplified with endogenous glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as the control gene and by using specific primers. The reaction program was set at 95°C for 4 minutes, 40 cycles at 95°C for 15 seconds, and 60°C for 1 minute. All primers were designed using PerlPrimer software (version 1.1.21) and confirmed by Gene Runner software (version 3.05). Eventually the specificity of the primer sequences was checked by using BLAST software (http://blast.ncbi.nlm.nih.gov/Blast.cgi) and the UCSC genome browser (http://www.genome.ucsc. edu). Table 1 lists the primer sequences for FOXP3 and GAPDH. Gene expression data were analysed using the ΔΔCt quantitative method to estimate relative fold change values.
Table 1.
Primers used in this study
|
| ||
|---|---|---|
| Name | Primer sequences (5'-3') | Productlength (bp) |
|
| ||
| FOXP3 gene | F: ACTGACCAAGGCTTCATCT | 179 |
| R: GGAACTCTGGGAATGTGCT | ||
| FOXP3 promoter | F: AGAATGGTGTCTCTGCCTG | 195 |
| R: TGCCCTTTACGAGTCATCTG | ||
| GAPDH gene | F: TGAGAAGTATGACAACAGCCTC | 134 |
| R: TGATGGCATGGACTGTGGT | ||
|
| ||
Chromatin immunoprecipitation real-time polymerase chain rection
The chromatin immunoprecipitation (ChIP) method was performed as previously described (20). In order to evaluate epigenetic alterations, homogenised endometrial tissues were washed three times with phosphate buffer saline and cross-linked with 1% formaldehyde. Then, by using a sonicator system (UCD200 Bioruptor sonication system, Diagenode, Belgium), we obtained a soluble chromatin that contained 500 to 1000 bp of DNA fragments. After 5 minutes of centrifugation at 4°C and 14 000 g, the supernatant was aliquoted into three parts - one part for the input control, and the other two parts were incubated overnight at 4°C on a rotator with anti-H3K9ac (cat: ab1220, Abcam, UK) and anti -H3K9me2 (cat: ab4441, Abcam, UK). Incubation with protein A-sepharose CL-4B beads (cat: 17-0780-01, GE Healthcare, Sweden) was performed for 2 hours at 4°C to precipitate the immune-selected complexes. The beads were washed with different washing buffers, then decrosslinking of the antibody/beads was accomplished by heating the samples at 65°C for 4 hours. The purified DNA was obtained using a DNA purification kit (cat: 112-102, GeneAll, South Korea) and quantified by real-time PCR using a Step One Plus™ Real-time PCR system (Applied Biosystems, USA). The PCR conditions were: 95°C for 3 minutes, 40 cycles at 95°C for 15 seconds, and 60°C for 1 minute. As described previously (21), the data were expressed as fold enrichment of DNA associated with the different immunoprecipitated epigenetic markers relative to a 1/100 dilution of input chromatin. Table 1 lists the primer sequences for the FOXP3 promoter.
Statistical analysis
All data analyses were performed using SPSS software (version 22.0) and one-way ANOVA followed by the post-hoc Tukey test to compare the differences between eutopic, ectopic, and control tissues. P<0.05 were considered statistically significant.
Results
FOXP3 gene expression
FOXP3 gene expression showed significantly reduced expressions of this gene in ectopic and eutopic tissues of women with endometriosis compared to the control group (P=0.001). No significant difference in FOXP3 gene expression was observed between ectopic and eutopic tissues in the endometriosis group (Fig .1).
Fig.1.
FOXP3 expression in control, eutopic, and ectopic tissues. Relative mRNA expression of FOXP3 in eutopic and ectopic tissues of 20 patients with endometriosis compared to the 20 women in the control group. Comparisons were made by ANOVA. Mean significant changes at the *; P<0.05 level and Ns; Not significant.
Incorporation of activating repressive histone markers H3K9ac/H3K9me2 into the promoter of the FOXP3 gene
As expected, incorporation of the gene activating histone marker H3K9ac into the FOXP3 promoter region showed a significant decrease in both eutopic and ectopic endometrial tissues compared to normal endometrium. There was no significant difference in the binding level of this factor in eutopic and ectopic tissues (Fig .2).
Fig.2.
Epigenetic marker (H3K9ac and H3K9me2) enrichment at the FOXP3 promoter. Incorporation of H3K9ac and H3K9me2 histone markers into the promoter of FOXP3 in eutopic and ectopic tissues of six patients with endometriosis compared to six women in the control group. Comparisons were made by ANOVA. Mean significant changes at the *; P<0.05 level and Ns; Not significant.
Incorporation of H3K9me2, a gene silencing histone marker, was also assessed. As shown in Figure 2, H3K9me2 was significantly increased in eutopic endometrial tissue compared to normal endometrium (P=0.016). In addition, this epigenetic marker was more prevalent in ectopic tissue compared to normal endometrial tissue, but this increase was not statistically significant.
These histone modification data paralleled the expression profile of the FOXP3 gene in endometriotic tissues compared to normal endometrium (Fig .1).
Discussion
Various studies have reported aberrant function of the immune system in endometriosis. This highly prevalent disease is initiated and progresses by numerous genetic and epigenetic modifications that affect the immune system. Evidence exists that show the relationship between Treg cells and endometriosis. Tregs may play an important role in reducing the ability of newly recruited immune cells to target sloughed endometrial cells and, in turn, increase the survival and implantation of the endometriotic cells (22). Our findings have shown that the mRNA level of the FOXP3 gene, as a master transcription factor of Treg cells, significantly decreased in the eutopic and ectopic lesions of endometriosis compared to the control group. The epigenetic data in this study revealed a significant decrease in H3K9ac and a significant increase in H3K9me2 of the FOXP3 promoter in the eutopic and ectopic tissues of endometriosis patients compared to the control group. These epigenetic changes were aligned with a decreased FOXP3 gene expression profile in endometriosis. In addition, it seems that epigenetic modifications of the H3K9ac/me2 in the FOXP3 promoter can affect expression of this gene in endometriosis, which is expected.
Under healthy conditions, some shed endometrial cells may be transferred to regional lymph nodes for destruction, but a defective immune system may help the survival of these fragments and permit implantation at an ectopic site (22). In addition, dysregulated immune responses and inflammatory conditions, influenced by Treg cells, play a significant role in endometriosis progression (23). The balance between phenotypic plasticity and stability of Treg cells is defined by the accurate regulation of transcriptional and epigenetic events required to ensure stable expression of the FOXP3 gene in Treg cells (24). Expression of this gene at the appropriate time and place is very important for inhibitory function of Tregs, which guarantees cleansing of the body from sloughed endometriotic cells. On the other side, decreased levels of FOXP3 can lead to defective regulatory function of Treg cells, autoimmune and auto inflammation (8-12). Our findings of FOXP3 gene expression supported previous studies reported by Koval et al. (25), which showed significantly less FOXP3 mRNA in eutopic endometrium samples from infertile women with endometriosis compared to a control group. Additionally, studies showed a reduction in expression of this gene in hormone-sensitive cancerous tissues, such as breast, in 70% of cases (26). Some studies reported that FOXP3 gene expression levels in the endometrial tissues of infertile women were twice as low as those in healthy women (27). It is hypothesised that a decrease in FOXP3 gene expression in the eutopic and ectopic endometrial tissues of women with endometriosis may reflect an impaired function or altered phenotype of Treg cells. This dysfunction may lead to failure in maintaining proper immunological tolerance, and result in inadequate immune surveillance and allow growth of ectopic endometrial lesions, which would contribute to endometriosis. In contrast, some studies reported an increase in mRNA levels in the FOXP3 gene in endometrial samples of women with endometriosis compared to a control group. Notably, the menstrual phase of the uterus affects the results during sample collection; the abovementioned study was performed under different conditions (preimplantation phase) (28). FOXP3 is a key factor in Treg cell development; for these purposes, simultaneous FOXP3 gene expression and Treg-specific epigenetic changes are critical (29). We selected H3K9ac/me2 as the epigenetic marker at the FOXP3 promoter because they represent two opposing chromatin states and have well-established roles in regulating gene expression. Since FOXP3 plays a critical role in Treg cell function and its expression must be tightly controlled, understanding the balance between these two epigenetic marks provides meaningful insights into regulation of this gene. As expected, the gene expression results were in line with other studies, although the main purpose of our study was to evaluate the epigenetic modifications of this gene in endometriotic tissues in comparison with normal endometrial tissues. This is an innovative part of our research. Various data suggest that Treg cells are influenced by epigenetic mechanisms that modulate expression of the FOXP3 gene and its associated epigenetic modifications (30).
Our epigenetic assessment of the FOXP3 gene promoter indicated that changes in the H3K9me2 modification, which serves as a repressive histone marker, and in the H3K9ac modification, which acts as an activating histone marker, align with the observed gene expression results. In other words, increased H3K9me2 is associated with decreased FOXP3 gene expression, whereas increased H3K9ac leads to enhanced FOXP3 gene expression.
In the present study, the H3K9ac histone mark was significantly reduced in ectopic and eutopic tissues compared to the control tissues, the epigenetic modification which is in accordance to the decreased expression profile of FOXP3 gene in endometriotic tissues.
On the other hand, the overall level of H3K9me2 in the promoter region of the FOXP3 gene was elevated in both the eutopic and ectopic groups compared to the control samples. The increase was statistically significant in the eutopic group, but not in the ectopic group, which was possibly due to the sample size. Of note, the elevated level of this epigenetic marker, H3K9me2, in the endometriotic groups supported the findings related to the gene expression.
The results of one study showed significantly lower total H3K9ac levels in the ectopic group compared to endometrial tissue of the normal and endometriosis groups (31). Besides, the overall mean of H3K9me2 in the endometrium of the control group was significantly lower than the ectopic and eutopic tissues of patients with endometriosis. The overall level of H3 histone acetylation in endometriotic lesions was lower than the endometrial tissue of the control group, which supported our study results.
Reduced FOXP3 expression may be one of the factors involved in endometriosis. The results of epigenetic studies show that FOXP3 gene expression appears to be regulated by H3K9me2 and H3K9ac histone markers. Understanding the molecular setting of the FOXP3 gene and Treg cell stability will shed light on their pathological dysregulation and determine novel therapeutic strategies. Numerous studies indicate that mutations in the FOXP3 gene are associated with carcinogenesis and its expression level may serve as a prognostic indicator in the oncological context. FOXP3 is an important factor in the pathomechanism where the tumour escapes the immune system response (32). Endometriosis increases the risk of ovarian cancer (33), and it is hypothesised that studying the impact of epi-drugs in endometriosis patients may provide novel options for control of this disease. In addition, histone acetylation is vital for the activation of key genes related to endometriosis, which makes it a significant target for potential therapies. Adjusting histone acetylation could help reduce the symptoms of endometriosis. However, the complex interaction between different epigenetic markers suggests that acetylation might also regulate other molecular activities. For example, histone deacetylase (HDAC) inhibitors increase histone acetylation, which can suppress cell division and influence DNA damage repair mechanisms. These processes highlight the impact of histone acetylation on cellular functions and provide a basis for exploring new treatment avenues for endometriosis by modulating acetylation levels. It is essential to conduct comprehensive research to optimize the therapeutic benefits while minimising adverse effects before employing HDAC inhibitors for endometriosis treatment (34).
Finally, limitations of the current research included the small sample size and sample heterogeneity. It is essential to emphasise that the analysis was based on samples representative of entire tissues, which includes stromal, epithelial, and inflammatory cells. This cellular mixture can result in different epigenetic profiles between the eutopic and ectopic endometrium from the same patient. Moreover, in this study, we did not consider the phases of the menstrual cycle. Another limitation of this study is that some eutopic and ectopic tissue samples originated from the same patients, whereas others were obtained from different individuals.
Conclusion
The discovery of epigenetic settings of Treg cells creates a new perspective for understanding the role of these regulatory cells in disease and health. A set of precise transcriptional and epigenetic adjustments is required for stable expression of the FOXP3 gene and proper function of Treg cells. The data reported in this study contribute to a better understanding of FOXP3 expression and epigenetic alteration in endometriosis, and suggests the use of new drugs and epi-drugs for this disease.
Acknowledgments
The authors express their appreciation to all the women who participated in this study. This paper is dedicated to the memory of Dr. Saeid Kazemi Ashtiani, the late founder of Royan Institute. This work was part of an M.Sc. thesis, which was supported by Royan Institute (project code: 96000286) and Kharazmi University.
Conflict of Interest
Fariba Ramezanali, Elham Amirchaghmaghi, and Maryam Shahhoseini are reviewers or editors for this journal. They did not participate in any capacity related to the peer review of this manuscript, nor were they involved in editorial decisions.
Author’s Contributions
S.Ch.; Performed the experiments and Wrote the manuscript. R.F.; Provided technical support. S.I.; Consultation. N.B.; Performed the experiments. F.R.; Administrative support for collecting the samples. G.K.; Consultation. E.A., M.Sh.; Provided expertise and Supervision, Revision of the manuscript. All authors read and approved the final manuscript.
References
- 1.Giudice LC. Clinical practice.Endometriosis. N Engl J Med. 2010;362(25):2389–2398. doi: 10.1056/NEJMcp1000274. doi: 101056/NEJMcp1000274. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Vallvé-Juanico J, Houshdaran S, Giudice LC. The endometrial im mune environment of women with endometriosis. Hum Reprod Up date. 2019;25(5):564–591. doi: 10.1093/humupd/dmz018. doi: 101093/humupd/dmz018. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Sampson JA. Heterotopic or misplaced endometrial tissue. Am J Obstet Gynecol. 1925;10(5):649–664. doi: 101016/S0002 9378(25)90629-1. [Google Scholar]
- 4.Paul Dmowski W, Braun DP. Immunology of endometriosis. Best Pract Res Clin Obstet Gynaecol. 2004;18(2):245–263. doi: 10.1016/j.bpobgyn.2004.02.001. doi: 101016/jbpobgyn200402001. [DOI] [PubMed] [Google Scholar]
- 5.Osuga Y, Koga K, Hirota Y, Hirata T, Yoshino O, Taketani Y. Lym phocytes in endometriosis. Am J Reprod Immunol. 2011;65(1):1–10. doi: 10.1111/j.1600-0897.2010.00887.x. doi: 101111/j1600-0897201000887x. [DOI] [PubMed] [Google Scholar]
- 6.Kokcu A. A current view of the role of epigenetic changes in the ae tiopathogenesis of endometriosis. J Obstet Gynaecol. 2016;36(2):153–159. doi: 10.3109/01443615.2015.1036403. doi: 103109/0144361520151036403. [DOI] [PubMed] [Google Scholar]
- 7.Wan YY, Flavell RA. Regulatory T-cell functions are subverted and converted owing to attenuated Foxp3 expression. Nature. 2007;445(7129):766–770. doi: 10.1038/nature05479. doi: 101038/nature05479. [DOI] [PubMed] [Google Scholar]
- 8.Godfrey VL, Wilkinson JE, Rinchik EM, Russell LB. Fatal lymphore ticular disease in the scurfy (sf) mouse requires T cells that mature in a sf thymic environment: potential model for thymic education. Proc Natl Acad Sci USA. 1991;88(13):5528–5232. doi: 10.1073/pnas.88.13.5528. doi: 101073/ pnas88135528. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Godfrey VL, Wilkinson JE, Russell LB. X-linked lymphoreticular disease in the scurfy (sf) mutant mouse. Am J Pathol. 1991;138(6):1379–1387. [PMC free article] [PubMed] [Google Scholar]
- 10.Bennett CL, Christie J, Ramsdell F, Brunkow ME, Ferguson PJ, Whitesell L, et al. The immune dysregulation, polyendocrinopathy, enteropathy, X-linked syndrome (IPEX) is caused by mutations of FOXP3. Nat Genet. 2001;27(1):20–21. doi: 10.1038/83713. doi: 101038/83713. [DOI] [PubMed] [Google Scholar]
- 11.Lahl K, Loddenkemper C, Drouin C, Freyer J, Arnason J, Eberl G, et al. Selective depletion of Foxp3+ regulatory T cells induces a scurfy-like disease. J Exp Med. 2007;204(1):57–63. doi: 10.1084/jem.20061852. doi: 101084/ jem20061852. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Kim JM, Rasmussen JP, Rudensky AY. Regulatory T cells prevent catastrophic autoimmunity throughout the lifespan of mice. Nat Im munol. 2007;8(2):191–197. doi: 10.1038/ni1428. doi: 101038/ni1428. [DOI] [PubMed] [Google Scholar]
- 13.Yun M, Wu J, Workman JL, Li B. Readers of histone modifications. Cell Res. 2011;21(4):564–578. doi: 10.1038/cr.2011.42. doi: 101038/cr201142. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Zhang G, Pradhan S. Mammalian epigenetic mechanisms. IUBMB Life. 2014;66(4):240–256. doi: 10.1002/iub.1264. doi: 101002/iub1264. [DOI] [PubMed] [Google Scholar]
- 15.Koninckx PR, Ussia A, Adamyan L, Wattiez A, Gomel V, Martin DC. Pathogenesis of endometriosis: the genetic/epigenetic theory. Fer til Steril. 2019;111(2):327–340. doi: 10.1016/j.fertnstert.2018.10.013. doi: 101016/jfertnstert201810013. [DOI] [PubMed] [Google Scholar]
- 16.Berbic M, Hey-Cunningham AJ, Ng C, Tokushige N, Ganewatta S, Markham R, et al. The role of Foxp3+ regulatory T-cells in endo metriosis: a potential controlling mechanism for a complex, chronic immunological condition. Hum Reprod. 2010;25(4):900–907. doi: 10.1093/humrep/deq020. doi: 101093/humrep/deq020. [DOI] [PubMed] [Google Scholar]
- 17.Podgaec S, Barbeiro DF, Gueuvoghlanian-Silva BY, Bellelis P, Abrão MS, Baracat EC. Foxp3 expression in deep rectosigmoid endometriosis lesions and its association with chronic pelvic pain. J Reprod Immunol. 2014:104-105: 96-99. doi: 10.1016/j.jri.2014.05.002. doi: : 10.1016/j.jri.2014.05.002. [DOI] [PubMed] [Google Scholar]
- 18.André GM, Barbosa CP, Teles JS, Vilarino FL, Christofolini DM, Bi anco B. Analysis of FOXP3 polymorphisms in infertile women with and without endometriosis. Fertil Steril. 2011;95(7):2223–2227. doi: 10.1016/j.fertnstert.2011.03.033. doi: 101016/jfertnstert201103033. [DOI] [PubMed] [Google Scholar]
- 19.Abbas Suleiman A, Nader A, Winzenborg I, Beck D, Polepally AR, Ng J, et al. Exposure-safety analyses identify predictors of change in bone mineral density and support elagolix labeling for endome triosis-associated pain. CPT Pharmacometrics Syst Pharmacol. 2020;9(11):639–648. doi: 10.1002/psp4.12560. doi: 101002/psp412560. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Samadieh Y, Favaedi R, Ramezanali F, Afsharian P, Aflatoonian R, Shahhoseini M. Epigenetic dynamics of HOXA10 gene in infertile women with endometriosis. Reprod Sci. 2019;26(1):88–96. doi: 10.1177/1933719118766255. doi: 101177/1933719118766255. [DOI] [PubMed] [Google Scholar]
- 21.Favaedi R, Shahhoseini M, Akhoond MR. Comparative epigenetic analysis of Oct4 regulatory region in RA-induced differentiated NT2 cells under adherent and non-adherent culture conditions. Mol Cell Biochem. 2012;363(1-2):129–134. doi: 10.1007/s11010-011-1165-y. doi: 101007/s11010-011-1165-y. [DOI] [PubMed] [Google Scholar]
- 22.Berbic M, Fraser IS. Regulatory T cells and other leukocytes in the pathogenesis of endometriosis. J Reprod Immunol. 2011;88(2):149–155. doi: 10.1016/j.jri.2010.11.004. doi: 101016/jjri201011004. [DOI] [PubMed] [Google Scholar]
- 23.Braundmeier A, Jackson K, Hastings J, Koehler J, Nowak R, Fa zleabas A. Induction of endometriosis alters the peripheral and endometrial regulatory T cell population in the non-human pri mate. Hum Reprod. 2012;27(6):1712–1722. doi: 10.1093/humrep/des083. doi: 101093/hum rep/des083. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Bellanti JA, Li D. Treg cells and epigenetic regulation. Adv Exp Med Biol. 2021;1278:95–114. doi: 10.1007/978-981-15-6407-9_6. doi: 101007/978-981-15-6407-9_6. [DOI] [PubMed] [Google Scholar]
- 25.Koval HD, Chopyak VV, Kamyshnyi OM, Kurpisz MK. Transcription regulatory factor expression in T-helper cell differentiation pathway in eutopic endometrial tissue samples of women with endometrio sis associated with infertility. Cent Eur J Immunol. 2018;43(1):90–96. doi: 10.5114/ceji.2018.74878. doi: 105114/ceji201874878. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Buchynska LG, Iurchenko NP, Verko NP, Nekrasov KA, Kashuba VI. FOXP3 gene promoter methylation in endometrial cancer cells. Exp Oncol. 2015;37(4):246–249. [PubMed] [Google Scholar]
- 27.Teles A, Schumacher A, Kühnle MC, Linzke N, Thuere C, Reich ardt P, et al. Control of uterine microenvironment by foxp3(+) cells facilitates embryo implantation. Front Immunol. 2013;4:158–158. doi: 10.3389/fimmu.2013.00158. doi: 103389/fimmu201300158. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Chen S, Zhang J, Huang C, Lu W, Liang Y, Wan X. Expression of the T regulatory cell transcription factor FoxP3 in peri-implantation phase endometrium in infertile women with endometriosis. Reprod Biol Endocrinol. 2012;10:34–34. doi: 10.1186/1477-7827-10-34. doi: 101186/1477-7827-10-34. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Kitagawa Y, Ohkura N, Sakaguchi S. Molecular determinants of regulatory T cell development: the essential roles of epige netic changes. Front Immunol. 2013;4:106–106. doi: 10.3389/fimmu.2013.00106. doi: 103389/fim mu201300106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Joudi AM, Reyes Flores CP, Singer BD. Epigenetic control of regu latory T cell stability and function: implications for translation. Front Immunol. 2022;13:861607–861607. doi: 10.3389/fimmu.2022.861607. doi: 103389/fimmu2022861607. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Monteiro JB, Colón-Díaz M, García M, Gutierrez S, Colón M, Seto E, et al. Endometriosis is characterized by a distinct pattern of his tone 3 and histone 4 lysine modifications. Reprod Sci. 2014;21(3):305–318. doi: 10.1177/1933719113497267. doi: 101177/1933719113497267. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Szylberg Ł, Karbownik D, Marszałek A. The role of FOXP3 in hu man cancers. Anticancer Res. 2016;36(8):3789–3794. [PubMed] [Google Scholar]
- 33.Saraswat L, Ayansina D, Cooper KG, Bhattacharya S, Horne AW, Bhattacharya S. Impact of endometriosis on risk of further gynae cological surgery and cancer: a national cohort study. BJOG. 2018;125(1):64–72. doi: 10.1111/1471-0528.14793. doi: 101111/1471-052814793. [DOI] [PubMed] [Google Scholar]
- 34.Hsiao KY, Wu MH, Tsai SJ. Epigenetic regulation of the pathologi cal process in endometriosis. Reprod Med Biol. 2017;16(4):314–319. doi: 10.1002/rmb2.12047. doi: 101002/rmb212047. [DOI] [PMC free article] [PubMed] [Google Scholar]