Transmission of Anellovirus From Kidney‐Donor to Pediatric Recipient: An Exploratory Study

ABSTRACT

Background

Among the most abundant viruses in the human blood virome are anelloviruses, including alpha‐, beta‐, and gammatorqueviruses (TTV, TTMV, and TTMDV). Whether anelloviruses are transmitted through kidney transplantation at a young age and subsequently persist in their new host is unknown. This study investigates the dynamics and composition of the anellome in the blood of six pediatric donor–recipient pairs, with monitoring beginning before transplantation and continuing until 2 years after transplantation.

Methods

Donors were sampled once, before donation, while recipients were sampled before and multiple times after transplantation (median 6.5 samples). Quantitative PCR, rolling circle amplification, Illumina sequencing, and SCANellome V2 analysis were used to detect, characterize, and compare anellovirus presence in donors and recipients.

Results

At baseline, four out of six donors tested positive for TTV by quantitative anellovirus PCR, three of whom had sufficient viral loads to enable genomic comparison with their recipients. All recipients tested positive at baseline, five had a moderate viral load (< 10⁵ copies/mL), and one had > 10⁹ copies of TTV DNA/mL. This recipient was already immunosuppressed before transplantation, and only in this recipient was a donor‐derived anellovirus identified. This lineage was detected among 15 other lineages in the recipient and matched one of the four lineages identified in the donor.

Conclusion

This finding demonstrates that anellovirus transmission from donor to recipient occurs in pediatric kidney transplantation. This may be associated with pre‐existing immunosuppression.

Donor‐to‐recipient anellovirus transmission occurred in 1 of 6 pediatric kidney transplant pairs, in a recipient with pre‐existing immunosuppression. The donor‐derived lineage became detectable 1 year after transplantation, indicating no meaningful contribution to early post‐transplant recipient TTV load and supporting continued research into TTV as an early post‐transplant biomarker of immunosuppression.

Abbreviations

DNA

deoxyribonucleic acid

ORF1

open reading frame 1

PCR

polymerase chain reaction

qPCR

quantitative polymerase chain reaction

RCA

rolling circle amplification

RPM

reads per million

TTMDV

torque teno midi virus

TTMV

torque teno mini virus

TTV

torque teno virus

1. Introduction

The human blood virome comprises a diverse group of viruses [1], of which anelloviruses are recognized as commensal members [2]. Anelloviruses belonging to Alpha‐, Beta‐, and Gammatorquevirus genera are found in humans and consist of torque teno (TTV), torque teno mini (TTMV), and torque teno midi viruses (TTMDV), respectively. The viruses carry negative‐sense, single‐stranded, circular DNA ranging in size from 1.6 to 3.9 kb [3]. In the blood of healthy individuals, they account for over 70% of the virome, positioning them as the predominant viral component in the human body [4].

The collective population of anelloviruses that infect an individual is referred to as the anellome [2]. The anellome is highly individualized, varies in both genus composition and viral load, and may persist in individuals for decades [5]. Although anelloviruses are highly prevalent, not all individuals have PCR‐detectable viral loads. An analysis using PCR detected anellovirus DNA in 53% of healthy blood donors [5]. However, the reported prevalence of anellovirus infection varies significantly by region, subpopulation, and detection methods used [6]. Typically, infections are acquired in early childhood, leading to chronic infections characterized by long‐lasting detectable viremia. Anelloviruses are present across a wide range of body sites, including blood, saliva, nasal secretions, and various organ and tissue samples [7, 8]. Transmission likely occurs through peripartum exposure, breastfeeding, fecal‐oral routes, or parenterally through transfusions and organ transplantations [9, 10].

Kidney transplantation is the preferred treatment for children with end‐stage renal disease [11]. It is widely considered the most effective renal replacement therapy for children because it significantly improves survival and quality of life [12]. However, transplant recipients need lifelong immunosuppressive therapy to prevent graft rejection [11, 13]. Adult transplant recipients show an association between TTV plasma levels and host immune status, with elevated TTV levels potentially serving as a marker of increased immunosuppression [14, 15, 16]. Metagenomic analysis of donor–recipient pairs in lung transplantation shows bidirectional transmission of TTV, with donor‐derived TTV occasionally persisting in recipient blood and recipient‐derived strains colonizing the graft tissue over several months post‐transplant [17]. However, to the best of our knowledge, the transmission and persistence of donor anelloviruses have never been studied in (pediatric) kidney transplant recipients.

Personalized immunosuppressive therapy is essential in pediatric kidney transplant recipients to balance the risk of rejection and infection. TTV quantification has been proposed as a biomarker for dosing of immunosuppressive medication. Transmission of donor TTV lineages could interfere with recipient TTV‐based dosing of immunosuppression. Reassuringly, studies in adult kidney transplant recipients have shown that recipient TTV concentrations are largely independent of donor‐derived TTVs [18]. However, whether this also applies to pediatric kidney transplant recipients is currently unknown. For this reason, we investigated the dynamics of the anellome in pediatric kidney transplant recipients. We hypothesized that anelloviruses are introduced via the donor kidney, and donor anelloviruses infect and persist in the recipient. To address this hypothesis, using a next‐generation sequencing approach, we analyzed six donor–recipient pairs over several time points, ranging from prior to transplantation to 2 years after transplantation. This study enabled the tracking of anellovirus transmission and virus kinetics over time.

2. Methods

2.1. Sample Selection

This exploratory study included six living kidney donor–recipient pairs who underwent kidney transplantation at the pediatric nephrology department of the Amsterdam UMC between 2020 and 2023. Recipients were monitored from before transplantation up to 2 years post‐transplantation (median age = 15.1 years; range: 2.93–17.5 years; median number of samples = 6.5; range: 2–11). The patient characteristics are described in Table 1. Blood samples were collected before transplantation, every 2 months in the first year after transplantation, and every 4 months in the second year after transplantation. Donors were all “living donors” and they were sampled once, 22–380 days before donation. Blood plasma or serum samples from donors and recipients were stored at −80°C.

TABLE 1.

Baseline characteristics of pediatric kidney transplant recipients and their living donors.

Characteristics	Value
Number of donor–recipient pairs	6 (living kidney donors)
Recipient median age, years (range)	15.1 (2.9–17.5)
Number of samples per recipient, median (range)	6.5 (2–11)
Donor sample timing	Single pre‐transplant measurement, 22–380 days before transplantation
Recipient sample timing	1–12 days pre‐transplantation to 2 years post‐transplantation
Immunosuppressive therapy pre‐transplantation	Tacrolimus + prednisolone: 1 of 6 (17%) None: 5 of 6 (83%)
Donors testing positive for anelloviruses	4 of 6 (67%)
Recipients testing positive for anelloviruses	6 of 6 (100%)
Immunosuppressive regimen post‐transplantation	Early steroid‐withdrawal (tacrolimus + mycophenolate mofetil): 5 of 6 (83%) Non‐early steroid‐withdrawal (tacrolimus + mycophenolate mofetil + prednisolone): 1 of 6 (17%)
Blood transfusion prior to or during early post‐transplant period	0 of 6 (0%)

2.2. Ethics Statement

This study was classified as a non‐WMO (non–Medical Research Involving Human Subjects Act) study (METC number P1a 2023.1034, date: 8‐3‐2024). Therefore, approval from the Medical Ethics Committee of Amsterdam University Medical Center, University of Amsterdam, was not required. Where possible, informed consent was obtained.

2.3. Nucleic Acid Isolation

One hundred and ten μL of serum from the donors and recipients was centrifuged for 10 min at 5000 g. One hundred μL of supernatant was subsequently treated with 20 U TURBO DNase (Thermo Fisher Scientific, Waltham, MA, USA) to select intact virus particles as input for anellome analysis. Boom isolation method [19] was used to extract the nucleic acids, with elution in 65 μL water (Avantor, Radnor Township, PA, USA).

2.4. Anelloviridae Genera‐Specific Quantitative PCRs

Genus‐specific qPCRs were performed to detect TTV, TTMV, and TTMDV. The TTMDV qPCR detects TTMDV but can also amplify some TTMV as previously described [20]. The qPCR reactions included 400 nM forward and reverse primers (final concentration), 200 nM probe (final concentration), and QuantiNova ProbePCR Master Mix (Qiagen, Hilden, Germany). A 40‐cycle qPCR was performed using the Rotor‐Gene Q Real‐time PCR cycler (Qiagen, Hilden, Germany). The cycling program consisted of 3 min at 95°C, followed by 40 cycles of 5 s at 95°C and 5 s at 60°C. A dilution series of positive control plasmids was used together with Rotor‐Gene Q series software (version 2.3.4) to analyze and determine the viral load of the samples. The detection limit of the qPCRs was 2600 copies viral DNA/mL serum, which is essential for the broad‐range primers required to capture the extensive sequence heterogeneity of anelloviruses.

2.5. Rolling Circle Amplification and Illumina Library Preparation

To enable anellome analysis, rolling circle amplification (RCA) and Illumina library preparation were performed as described previously [4]. Briefly, Phi29 DNA polymerase (Thermo Fisher Scientific, Waltham, MA, USA) was used to amplify all circular DNA. The reaction was performed for 4 h at 30°C, followed by 10 min at 65°C. Amplified nucleic acids were fragmented using NEBNext dsDNA Fragmentase (New England Biolabs, Ipswich, MA, USA) for 25 min at 37°C. Fragmented DNA was blunted using DNA Polymerase I, Large (Klenow) Fragment (New England Biolabs, Ipswich, MA, USA). Afterwards, A‐tailing was performed using DNA Polymerase I, Large (Klenow) Fragment (3′‐> 5′ exo‐) (New England Biolabs, Ipswich, MA, USA). Both reactions were performed at 37°C for 30 min. AMPure XP Beads (Beckman Coulter, CA, USA) were used to clean up between enzymatic reactions at a 1.8:1 beads‐to‐sample ratio. T4 ligase (Invitrogen, Waltham, MA, USA) was used to perform overnight ligation at 16°C and ligate the NEBNext Adaptor for Illumina (New England Biolabs, Ipswich, MA, USA) onto the nucleic acids. Size selection and clean‐up were performed using AMPure XP Beads at a 0.85:1 beads‐to‐sample ratio. The adaptor‐ligated DNA was used for an adaptor enrichment PCR with Q5 Hot Start High‐Fidelity 2× Master Mix (New England Biolabs, Ipswich, MA, USA), NEBNext Universal PCR Primer for Illumina (New England Biolabs, Ipswich, MA, USA), a sample unique NEBNext Index primer (New England Biolabs, Ipswich, MA, USA) and USER enzyme (New England Biolabs, Ipswich, MA, USA). The cycling program consisted of 15 min at 37°C, 30 s at 98°C, followed by 12 cycles of 10 s at 98°C, and 75 s at 65°C, with a final extension of 5 min at 65°C. AMPure XP Beads size selection was performed two more times with a 0.85:1 beads‐to‐sample ratio. The concentration of each sample was measured using the Qubit 1X dsDNA Highsensitivity assay kit (Invitrogen, Waltham, MA, USA), and the samples were pooled at equimolar concentrations. Sequence analysis was performed using the Illumina MiSeq System (Illumina, San Diego, CA, USA). Donor and recipient samples were processed on separate days and analyzed in separate Illumina runs to reduce the risk of sample‐to‐sample contamination. In addition, samples from each donor–recipient pair carried different index identifiers.

2.6. Anellome Analysis

The Illumina sequence reads were trimmed using Trimmomatic [21] (version 0.39) on GITbash (version V2.35.2) to remove adaptor sequences and low quality reads. The trimmed reads were aligned using the SCANellome tool [22] (version August 5, 2024). SCANellome uses a human and nonhuman primate anellovirus database with ORF1 sequences of 469 TTV, 1908 TTMV, and 1393 TTMDV lineages. The software was used to generate a table with mapped reads. An anellovirus lineage was considered to be present in a sample when the median sequence depth was ≥ 10 and the coverage of ORF1 was ≥ 75%. The read counts of the lineages were normalized to reads per million (RPM), and heatmaps were created per donor/recipient pair using GraphPad Prism (version 10.0.0).

2.7. Genome Comparison of Transmitted Lineages and Lineage Specific PCR

SPAdes De Novo Assembler [23] (version 4.0.0) was used in standard mode (Settings ‐careful and ‐only‐assemble) to create scaffolds. The assembled scaffolds were analyzed using the annotation and viral discovery tool Cenote‐Taker2 [24] (version 2.1.5) to detect anellovirus scaffolds. The anellovirus scaffolds from Recipient 1 at Month 13 were analyzed using the Blastnt tool [25]. The scaffold belonging to alphatorquevirus homin 13 (the species where MT783404 belongs) was selected and aligned with Illumina reads from Donor 1 via Codon Code Aligner software (Version 6.0.2) at 95% identity. Alignment with the recipient reference TTV homin 13 was visually inspected for read coverage, and a contig of the donor TTV homin 13 was generated. The ORF1 of the Donor 1 and the Recipient 1 TTV homin 13 were extracted with ORFfinder (https://www.ncbi.nlm.nih.gov/orffinder/) and compared with the Blastnt tool using the “align two or more sequences” mode.

A Donor 1/Recipient 1 TTV homin 13 specific PCR was developed for the hypervariable region of ORF1. For the PCR reaction, 400 nM (final concentration) forward primer (5′‐CACATAGATGCTCAGAAAGCCCAGTT‐3′), 400 nM (final concentration) reverse primer (5′‐TATTCCTGTTACTTGGTCAGGGTGA‐3′), and DreamTaq Green PCR (Thermo Fisher Scientific, Waltham, MA, USA) were used. The amplification conditions were 3 min at 94°C, followed by 40 cycles of 30 s at 94°C, 30 s at 55°C, and 2 min at 72°C, and a final elongation step of 7 min at 72°C. The PCR product was visualized on a 2% agarose gel stained with ethidium bromide using a GeneRuler 100 bp Plus DNA Ladder (Thermo Fisher Scientific, Waltham, MA, USA) for size reference.

3. Results

Blood samples were available from six donor–recipient pairs, with longitudinal follow‐up of the recipients. Three donors were living‐unrelated (Donors 1, 2, and 3), whereas the other three were living‐related (Donors 4, 5, and 6). Donors 1, 2, 3, and 5 tested positive for TTV, and none tested positive for TTMV or TTMDV (Figure 1). Donor 5 showed borderline TTV reactivity, which was insufficient for subsequent anellome sequencing and analysis.

FIGURE 1.

Anellovirus qPCR viral loads in Donors 1–6. Viral loads (DNA copies/mL) of TTV (orange circle), TTMDV (pink square), and TTMV (blue triangle) are shown for the six kidney donors. Negative qPCR results, below the limit of detection, are depicted in the hatched area.

All six recipients tested positive for anelloviruses. Figure 2 shows their TTV, TTMV, and TTMDV loads as measured by qPCR at different time points pre‐ and post‐transplantation. TTV was the most abundantly observed anellovirus, with high loads detectable in every recipient, usually peaking in the first 6 months after transplantation. The TTMV and TTMDV loads were generally lower and sometimes absent, as observed in Recipient 2. Recipient 1 had high anellovirus loads (> 10⁹ copies/mL) before transplantation.

FIGURE 2.

Anellovirus qPCR viral loads in Recipient 1–6. Viral loads (DNA copies/mL) of TTV (orange circle), TTMDV (pink square), and TTMV (blue triangle) are shown for six kidney transplant recipients. The vertical red arrow in each panel indicates the moment of kidney transplantation (Tx). Negative qPCR test results, below the limit of detection, are depicted in the hatched area.

Subsequent anellome analysis of donor–recipient pairs 1, 2, and 3, using Illumina sequencing and a database of reference ORF1 anellovirus sequences to map and characterize the anellome [21], showed a low number of anellovirus lineages in Donors 1, 2, and 3 (four TTV lineages in Donor 1, one TTV lineage in Donor 2, and one TTV lineage in Donor 3). In Recipients 1, 2, and 3, the anellome included several TTV, TTMV, and TTMDV lineages (Figure 3).

FIGURE 3.

Anellovirus lineage detection in donor–recipient pairs before and after kidney transplantation. Anellovirus lineages (TTV, TTMDV, and TTMV), identified along the y‐axis by unique accession numbers, are represented in shades of green and quantified as reads per million (RPM). On the x‐axis “Donor” indicates the donor anellome prior to kidney donation; “pre Tx” indicates the recipient anellome prior to transplantation; numeric labels indicate serum collection timepoints in months after kidney transplantation, for Pairs 1, 2, and 3.

Only in Recipient 1, one of the post‐transplant TTV lineages, belonging to the Alphatorquevirus homin 13 species, matched a lineage identified in the donor. This lineage showed the closest match to GenBank entry MT783404 and was detectable 13 and 21 months after transplantation. To check for identity, Illumina reads of this overlapping virus lineage were de novo assembled to create full ORF1 sequences of the donor and recipient. A genome comparison of the lineage from Donor 1 and Recipient 1 showed a high identity > 99% (Figure 4). Since NGS approaches, such as Illumina, have the risk of run‐to‐run contamination, we confirmed transmission by viral lineage‐specific PCR designed on the hypervariable region in ORF1. Figure 5 shows that the lineage was only found in Donor 1 and Recipient 1, at the time points when the lineage was also found by anellome analysis.

FIGURE 4.

Nucleotide alignment of ORF1 TTV homin 13 from Donor 1 (sampled 22 days prior to transplantation), and from Recipient 1 (sampled at 13 and 21 months after kidney transplantation).

FIGURE 5.

Specific PCR detection of Donor 1 TTV lineage in Recipient 1. Two percent agarose gel electrophoresis of the TTV homin 13–specific PCR product (195 bp), stained with ethidium bromide. Upper panel: Recipient 1 at pre‐transplantation (PR), 1 month (1 M), 3 months (3 M), 5 months (5 M), 13 months (13 M), and 21 months (21 M) after transplantation. Lower panel: Donors 1–6 (D1–D6). In both panels: M = GeneRuler 100 bp Plus DNA Ladder; N = no‐template control.

4. Discussion

In this exploratory study, we investigated whether anelloviruses could be transmitted from person to person via kidney transplantation. Among several anellovirus lineages in three recipients, one anellovirus lineage displayed a very high sequence similarity with a lineage from the corresponding donor, as confirmed by lineage‐specific PCR on the donor and recipient samples. We conclude that kidney transplantation can introduce new anellovirus lineages into recipients.

TTV was the most frequently detected anellovirus in our cohort, with high viral loads observed in all transplant recipients and consistent post‐transplant increase, typically peaking within the first 6 months after transplantation. This pattern is in line with previous studies [26] and supports the notion that TTV dynamics are closely linked to the post‐transplant immunological state.

Our findings add nuance to this interpretation by suggesting that donor‐derived transmission through the kidney graft may contribute to these viral dynamics. In Recipient 1, a post‐transplant TTV lineage matched a lineage detected in the donor, while alternative transmission routes could be excluded, supporting graft‐mediated transmission. Notably, this donor‐derived lineage was detected at a later post‐transplant timepoint than the initial phase of peaking TTV loads. This pattern suggests that the early increase in TTV load is more likely driven by expansion of pre‐existing recipient‐derived virus under immunosuppressive pressure, whereas donor‐derived virus may have been introduced at low abundance and only became detectable later. This interpretation is supported by previous studies that show transmission of TTV lineages via blood transfusion in relative abundance over time [5].

This finding might be of clinical relevance, as TTV load is increasingly being explored as a biomarker to guide immunosuppressive therapy. Recent studies have shown that higher TTV loads are associated with an increased risk of post‐transplant infection and lower rates of acute rejection, supporting its role as a novel marker of the overall state of immunosuppression [27]. In adult transplant recipients, recipient TTV concentrations appear to be largely independent of donor‐derived TTV [18], although whether this also applies to pediatric kidney transplant recipients has remained unclear.

In our cohort, donor‐derived TTV transmission was observed in only one donor–recipient pair. Moreover, the transmitted lineage became detectable only at 13 and 21 months after transplantation. These findings suggest that donor‐derived TTV is unlikely to substantially influence recipient TTV quantification during the early post‐transplant period. This is in line with previous studies indicating that recipient TTV load primarily reflects host immune regulation and hematopoietic dynamics [28, 29].

In adults, TTV expansion after transplantation is largely independent of donor TTVs and reflects the recipient's immune environment rather than donor‐to‐recipient TTV transmission [18]. Recipient 1, who harbored a donor‐derived TTV lineage, was already receiving tacrolimus and prednisolone therapy before transplantation and showed high levels of anelloviral DNA before transplantation (Figure 2). This may have facilitated the transmission and persistence of donor‐derived anellovirus. Whether this transmitted lineage has specific properties compared with other TTVs remains unknown.

Other TTV transmission routes than through the kidney graft should be considered. TTV has been detected in blood products and various biological fluids, including saliva, urine, feces, and respiratory secretions, and has also been shown to be transmitted vertically [30, 31]. In our case, Donor 1 and Recipient 1 were unrelated and they also did not share a household.

Transmission through blood products has been well documented for anelloviruses and should therefore be considered as a potential alternative explanation of transmission [32]. As Recipient 1 did not receive any blood products during the peri‐transplant period, transfusion‐related TTV is unlikely. This raises the possibility that donor‐derived TTV was transmitted with the kidney graft itself. Although donor kidneys are routinely perfused with a solution before transplantation, complete removal of blood remnants and TTV particles seems unlikely. Moreover, TTV has been detected in kidney tissue, with a prevalence of 45% in a Finnish study [33]. In addition, replication intermediates and TTV mRNA have been identified in kidney tissue [34].

The transmitted TTV lineage became detectable 1 year after transplantation. This observation may be explained by temporal fluctuations in viral load, with levels at earlier time points remaining below the detection threshold of the assays. Interestingly, although the overall anellovirus concentration decreased after 13 months post‐transplantation, this single transmitted lineage appeared to persist. The virus may have required an adaptation period to establish efficient replication within the new host before reaching detectable levels in the blood. In contrast, most studies report that TTV loads usually peak 3 months after transplantation, with a subsequent decline through Month 6 [35]. However, this has been studied in adult kidney transplant recipients but not in children. In other post‐transplant viral infections, such as cytomegalovirus, Epstein–Barr virus, and BK polyomavirus infection, viremia typically manifests within the first year post‐transplant [36]. Whether donor‐derived TTV follows similar dynamics in pediatric kidney transplant recipients remains to be further explored. However, our findings suggest that donor‐derived TTV is unlikely to substantially influence recipient TTV load during the early post‐transplant period.

5. Conclusion

Our pilot study demonstrated the transmission of anellovirus from a kidney donor to a pediatric kidney transplant recipient. However, the donor‐derived lineage became detectable only 1 year after transplantation, suggesting that donor‐derived TTV transmission does not meaningfully contribute to recipient TTV load during the early post‐transplant period.

Author Contributions

Luna S. Klomp and Maarten G.J.M. Burggraaff wrote the manuscript, Luna S. Klomp performed data analysis, and Maarten G.J.M. Burggraaff, together with Martin Deijs and Anne L. Timmerman performed the experiments. Margreet Bakker and Michel Molier collected clinical samples. Mariet Feltkamp, Lia van der Hoek, and Antonia H.M. Bouts designed the study, edited the manuscript, and supervised the study. All authors read and approved the final version of the manuscript.

Funding

This work was supported by Stichting Steun Emma Kinderziekenhuis (WAR2023‐09).

Conflicts of Interest

The authors declare no conflicts of interest.

Data Availability Statement

The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.