Skip to main content
BMC Research Notes logoLink to BMC Research Notes
. 2026 Aug 8;19:341. doi: 10.1186/s13104-026-07939-8

Frequency and characteristics of extended-spectrum beta-lactamase-producing Escherichia coli in wastewater in Dakar, Senegal

Abdoulaye Cissé 1,2, Komla Mawunyo Dossouvi 3,✉, Ousmane Sow 1, Issa Ndiaye 1, Abdoul Aziz Wane 1, Bissoume Sambe Ba 4, Makhtar Camara 5
PMCID: PMC13536643  PMID: 42681648

Abstract

Objective

This study aimed to investigate the occurrence, antimicrobial resistance profiles, and genetic characteristics of extended-spectrum beta-lactamase (ESBL)-producing E. coli in wastewater collected in Dakar, Senegal.

Results description

All samples (n = 48) carried ESBL-producing isolates. The concentrations of ESBL-producing E. coli ranged from 1.4 × 10⁴ to 3.3 × 10⁵ CFU/100 mL, whereas the ratio of ESBL-producing E. coli among the total E. coli population varied between 0.2% and 16.3%. All the 107 isolated ESBL-producing E. coli isolates were multidrug resistant (MDR), with 100% resistance to beta-lactams (ampicillin, cefalotin, cefotaxime, ceftazidime, cefepime, aztreonam) and high resistance rates to non-beta-lactam antibiotics, including ciprofloxacin (77.6%). No resistance was observed to imipenem. CTX-M-type genes were present in all isolates, with blaCTX−M−1 group (89.7%) and blaCTX−M−8 group (88.8%) being the most prevalent. The blaCTX−M−15 variant, a subgroup of blaCTX−M− group1, was detected in 96.9% of blaCTX−M−1 positive isolates. Additionally, blaTEM (31.8%) and blaOXA−1 (34.6%) were detected, while blaSHV and blaCTX−M−25 group were absent. Phylogenetic analysis of 107 isolates revealed a diverse distribution across four phylogroups: A (37.4%), D (22.4%), B1 (14.0%), and B2 (5.7%). The predominance of phylogroup A, mainly associated with intestinal commensal carriage, suggests fecal contamination as a primary source.

Keywords: Antimicrobial resistance, ESBL-producing E. coli, Genomics, Wastewater, Senegal

Introduction

The global emergence of antimicrobial-resistant bacteria, particularly extended-spectrum β-lactamase (ESBL)-producing Escherichia coli, poses a major public health threat. ESBL-producing E. coli are often resistant to a wide range of β-lactam antibiotics, including penicillins and cephalosporins, thereby limiting treatment options and increasing morbidity, mortality, and healthcare costs worldwide [1]. This resistance is primarily mediated by ESBL enzymes encoded by genes such as blaCTX-M, blaTEM, blaSHV, and blaOXA, with CTX-M-type enzymes currently representing the most globally disseminated ESBL family in both clinical and environmental settings [2]. The global burden of antimicrobial resistance (AMR) was estimated to be 5.7 million deaths and 156.1 million disability-adjusted life years attributable to antibiotic-resistant bacterial infections for 2019 [3]. This burden is higher in low- and middle-income countries (LMICs), particularly in sub-Saharan Africa [3].

Wastewater is increasingly recognized as a critical environmental reservoir and transmission pathway for antimicrobial resistant pathogens. Urban sewage systems and wastewater treatment plants (WWTPs) collect a diverse mixture of bacteria, pharmaceuticals, and antibiotic residues from households, hospitals, and agricultural runoff, creating a favorable environment for the selection and dissemination of resistant bacteria [4]. In LMICs, where wastewater treatment infrastructure is often inadequate, untreated or partially treated sewage is frequently discharged directly into natural water bodies, thereby amplifying the risk of environmental contamination and human exposure downstream [5].

ESBL-producing E. coli have been widely reported in wastewater across several countries, highlighting their ability to persist and potentially spread in aquatic environments [6, 7]. These isolates often exhibit multidrug resistance and belong to diverse phylogenetic backgrounds. E. coli phylogroups (A, B1, B2, and D) differ in ecological distribution and pathogenic potential, raising concerns about their environmental dissemination pathways and associated public health risks [8, 9].

In Senegal and other West African nations, the epidemiology of ESBL-producing bacteria in the environment remains under-investigated, despite the increasing clinical reports of multidrug-resistant (MDR) E. coli [10, 11]. Data on the distribution of ESBL genes and phylogenetic groups in wastewater are particularly scarce, limiting our understanding of the environmental contribution to AMR dissemination.

Understanding the prevalence, resistance mechanisms, and phylogenetic distribution of ESBL-producing E. coli in wastewater is essential for designing effective surveillance systems and intervention strategies within a One Health framework.

Therefore, this study aimed to investigate the occurrence, AMR profiles, ESBL gene content, and phylogenetic distribution of ESBL-producing E. coli in wastewater collected from three urban sites in Dakar, Senegal, during two climatic seasons. By analyzing concentration levels, resistance genes, and phylogenetic groups, we provided insights into the environmental dynamics of ESBL-producing E. coli and their potential public health implications.

Materials and methods

Study setting

This prospective cross-sectional study was conducted in Dakar, the capital city of Senegal in West Africa. Dakar was chosen as the study location due to its significance as an urban area with specific wastewater treatment infrastructure.

The study was conducted from May 2019 to December 2019. This timeframe was chosen to capture the seasonal variations in the wastewater composition and microbiological characteristics.

To assess the presence of ESBL E. coli and its potential impact, we selected three key sampling sites: a communal open sewer line (Canal4) (14.689348, -17.458989 Dakar, Senegal) within the city. This location was chosen to represent an urban environment and to assess the presence of ESBL E. coli in raw sewage. Samples were also collected from sewage discharge into the sea (Soumbedioune) (14.678475, -17.460697 Gueule Tapée-Fass, Dakar, Senegal). This location was included to assess the impact of such discharges on the presence of ESBL E. coli in marine environments. Additional influent (incoming communal wastewater) samples were obtained from a local WWTP (PHXF+4C8, Dakar, Senegal).

Sampling description

Water samples were collected according to the World Health Organization’s Tricycle protocol [12]. A total of 48 water samples were collected, with eight samples from each sampling site, repeated in both the dry and rainy seasons. Samples were obtained from a depth of 20–30 cm beneath the water surface. One thousand milliliters of water was collected from each site every month and stored in a sterile bottle at 2–8 °C.

Escherichia coli load determination

Upon arrival at the laboratory, the stored water samples were comprehensively analyzed within 24 h. The analysis involved various steps, including serial dilutions, membrane filtration, enumeration of bacterial colonies, calculation of colony-forming unit (CFU) concentrations per 100 mL, and determination of decimal proportions of ESBL E. coli among total E. coli. A systematic serial dilution protocol was used. Water samples, initially stored at 4 °C, were thoroughly mixed to ensure an even distribution of suspended matter. Using sterile techniques, 1 mL of each sample was added to 9 mL of phosphate-buffered saline (PBS) to create an initial dilution. Serial tenfold dilutions were prepared by transferring 1 mL of sample into 9 mL of the diluent. For membrane filtration, when the volume of diluted sample to be filtered was less than 20 mL, at least 20 mL of sterile diluent was first added to the filtration funnel. The required volume of the diluted sample (9 mL) was then aseptically pipetted into the funnel, and the contents were gently mixed. Filtration was performed through 0.45-µm pore-size cellulose ester membrane filters (Millipore, Burlington, MA, USA) under vacuum, which was applied only until all liquid had passed through the membrane. The inner walls of the funnel were subsequently rinsed with sterile diluent, and the rinse was also filtered through the same membrane, in accordance with ISO 8199:2005. The membrane filter was placed on the surface of the TBX agar (Bio-Rad, Marnes-la-Coquette, France) as well as TBX agar supplemented by 4 mg/L of CTX (Sigma, Burlington, MA, USA) plates under aseptic conditions. Plates were incubated at 37 °C for 18–24 h. After incubation, bacterial colonies displaying characteristic morphologies on TBX agar, with or without CTX 4 mg/L, were carefully examined and enumerated. According to the manufacturer’s specifications, E. coli colonies appeared blue-green, whereas non-E. coli microorganisms formed white colonies. For each TBX and TBX/CTX plate, colony counts were recorded as colony-forming units (CFUs). Plates with more than 100 colonies were considered uncountable. E. coli concentrations (CFU/100 mL) were calculated according to ISO 8199:2005 using the following equation, based on confirmed colony counts.

graphic file with name d33e443.gif

total count: total count of countable colonies (CFU on plates with < 100 colonies).

total volume: total volume plated on the plates used for the total count of countable colonies.

ratio confirmed: number of colonies taken to species / ESBL confirmation ÷ number of colonies confirmed as E. coli / ESBL.

The decimal proportions of ESBL E. coli among the total E. coli for each sample were calculated by dividing the presumptive ESBL-positive bacteria concentration (from TBX plates with CTX) by the total E. coli concentration (from TBX plates). For each wastewater sample positive on TBX agar supplemented with cefotaxime, up to five well-isolated presumptive E. coli colonies were randomly selected for further analysis. In cases where fewer than five colonies were present on the plate, all available colonies were selected. These colonies were re-streaked on TBX agar supplemented with cefotaxime for purification and subsequent ESBL confirmation.

Control strains, such as E. coli ATCC 25,922, Klebsiella pneumoniae ATCC BAA 1706, ESBL E. coli NCSU10455, and Klebsiella pneumoniae ATCC 70,063 (ESBL non-E. coli), were employed to ensure robust quality control in all sample analyses.

Antimicrobial susceptibility testing and ESBL confirmation

A total of 107 ESBL-producing E. coli isolates from wastewater samples were tested for their susceptibility to 15 antibiotics.

Antimicrobial susceptibility testing (AST) was performed using the Kirby-Bauer disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST/CA-SFM 2020) guidelines [13]. The tested antibiotics disks (Bio-Rad, France) were ampicillin (10 µg), amoxicillin/clavulanic acid (20 µg/10 µg), ticarcillin (75 µg), cefalotin (30 µg), cefotaxime (5 µg), ceftazidime (10 µg), cefepime (30 µg), aztreonam (30 µg), cefoxitin (30 µg), tetracycline (30 µg), nalidixic acid (30 µg), ciprofloxacin (5 µg), imipenem (10 µg), gentamicin (10 µg), and trimethoprim/sulfamethoxazole (1.25 µg/23.75 µg). ESBL production was screened using a double-disk synergy test with cefotaxime, ceftazidime, and cefepime disks located 30 mm from the amoxicillin/clavulanic acid disk [13]. MDR was defined as non-susceptibility to at least one antimicrobial agent in at least three different antibiotic classes [14]. E. coli ATCC 25,922 was used as an ESBL-negative reference strain and K. pneumoniae ATCC 700,603 as an ESBL-positive reference strain.

Detection of ESBL resistance genes

Gene sequences encoding β-lactamase enzymes of the TEM-, SHV-, OXA-1-, and CTX-M-type, which confer resistance to β-lactam antibiotics, were detected using simplex PCR on DNA extracted using a commercial genomic DNA purification kit (QIAampDNA Mini Kit; QIAGEN, France). For positive isolates of blaCTX−M- type, another PCR was performed to determine the blaCTX−M groups (blaCTX−M−1 group, blaCTX−M−2 group, blaCTX−M−8 group, blaCTX−M−9 group, and blaCTX−M−25 group). The presence of the blaCTX−M−15 variant was screened in all isolates positive for the blaCTX−M−1 group. All isolates were screened for the target genes. CTX-M, blaCTX-M-1, blaCTX-M-9, blaCTX-M-15, blaCTX-M-25, blaOXA-1, blaTEM, blaSHV). Each reaction included positive and negative controls. PCRs were carried out in 20 µL reaction volume (2.5 µl DNA + 17.5 µl Master MixFIREPolR). The PCR assay was conducted using an Eppendorf thermal cycler (Mastercycler X50a, Eppendorf, Montesson, France) for each primer set (Table 1), following the specific amplification conditions outlined below: initial denaturation at 95 °C for 3 min, followed by 35 cycles of denaturation at 94 °C for 1 min. The annealing temperature was optimized for each primer set (Table 2). Elongation was performed at 72 °C for 1 min, with a final elongation step at 72 °C for 7 min. Ten micro liters of each amplicon were separated on 1.5% agarose gel in 1X TAE buffer for 35 min at 135 volts and the amplified fragment detected using a GelDoc imager (BioRad).

Table 1.

Characteristics of primers used in this study

Target genes Primer sequences Amplicon size (bp) Annealing temperature References
bla TEM

F: TTGGGTGCACGAGTGGGTTA

R: TAATTGTTGCCGGGAAGCTA

506 55 °C [15]
bla SHV

F: TCGGGCCGCGTAGGCATGAT

R: AGCAGGGCGACAATCCCGCG

628 52 °C [15]
bla OXA−1

F: ATGAAAAACACAATACATATC

R: AATTTAGTGTGTTTAGAATGG

830 56 °C [11]
bla CTX−M

F: ATGTGCAGYACCAGTAARGTKATGGC

R: TGGGTRAARTARGTSACCAGAAYSAGCGG

592 55 °C [15]
bla CTX−M−1 group

F: GGTTAAAAAATCACTGCGTC

R: TTACAAACCGTYGGTGACGA

873 50 °C [15]
bla CTX−M−15

F: CACACGTGGAATTTAGGGACT

R: GCCGTCTAAGGCGATAAACA

995 50 °C [15]
bla CTX−M−2 group

F: ATGATGACTCAGAGCATTCGCCGC

R: TCAGAAACCGTGGGTTACGATTTT

876 56 °C [15]
bla CTX−M−8 group

F: TGATGAGACATCGCGTTAAG

R: TAACCGTCGGTGACGATTTT

666 52 °C [15]
bla CTX−M−9 group

F: GTGACAAAGAGAGTGCAACGG

R: ATGATTCTCGCCGCTGAAGCC

856 55 °C [15]
bla CTX−M−25 group

F: AACCCACGATGTGGGTAGC

R: CCTCGCTGTGCTTGTATCC

327 52 °C [15]

F : forward primer; R : reverse primer

Table 2.

Concentrations of E. coli and ESBL-producing E. coli in wastewater samples across sites and seasons

Site Season E. coli (CFU/100 mL) IC 95% E. coli ESBL_E. coli (CFU/100 mL) IC 95% ESBL_E. coli % ESBL Ratio
Soumbedioune Dry season 6.3 × 10⁷ (6.3 × 10⁷, 6.3 × 10⁷) 1.3 × 10⁵ (1.3 × 10⁵, 1.3 × 10⁵) 0.2
Wet season 1.5 × 10⁷ (1.5 × 10⁷, 1.5 × 10⁷) 2.0 × 10⁵ (2.0 × 10⁵, 2.0 × 10⁵) 1.4
Canal 4 Dry season 5.97 × 10⁷ (5.95 × 10⁷, 5.99 × 10⁷) 2.4 × 10⁵ (2.4 × 10⁵, 2.4 × 10⁵) 0.4
Wet season 1.0 × 10⁷ (1.0 × 10⁷, 1.0 × 10⁷) 3.3 × 10⁵ (3.3 × 10⁵, 3.3 × 10⁵) 3.2
STEP (WWTP) Dry season 1.2 × 10⁵ (1.2 × 10⁵, 1.2 × 10⁵) 2.0 × 10⁴ (1.99 × 10⁴, 2.0 × 10⁴) 16.3
Wet season 2.5 × 10⁵ (2.5 × 10⁵, 2.5 × 10⁵) 1.4 × 10⁴ (1.4 × 10⁴, 1.4 × 10⁴) 5.5

Phylogenetic grouping of E. coli

E. coli isolates were assigned to one of the four main phylogenetic groups (A, B1, B2, or D) according to the method described by Clermont et al. [16], using a multiplex PCR targeting the chuA and yjaA genes, and the TspE4.C2 DNA fragment. PCR products were analysed by agarose gel electrophoresis as previously described. Appropriate positive and negative controls were included in the assay.

Statistical analysis

Descriptive statistics were used to describe the frequencies and percentages of categorical variables, including the prevalence of ESBL genes, phylogenetic groups, and antimicrobial resistance. The 95% confidence intervals were determined for E. coli and ESBL-producing E. coli concentrations using exact binomial confidence limits at a significance level of α = 0.05. The concentrations of ESBL-producing E. coli in different environmental samples were compared using the Kruskal–Wallis test. Association between seasonality and ESBL-producing E. coli concentrations in environmental samples was analysed using the Wilcoxon–Mann–Whitney test. Analyses were performed using the RStudio software. P-values were obtained from the proportion comparison test using the Chi-square test at a 5% risk threshold, and the level of significance for all statistical tests was set at P < 0.05.

Results

Concentration of E. coli and ESBL producing E. coli in wastewater

All 48 environmental wastewater samples tested positive for ESBL-producing E. coli. The concentrations of ESBL-producing E. coli ranged from 1.4 × 10⁴ to 3.3 × 10⁵ CFU/100 mL, whereas the total E. coli levels ranged from 1.2 × 10⁵ to 6.3 × 10⁷ CFU/100 mL (Table 2). The ratio of ESBL-producing E. coli among the total E. coli population varied between 0.2 and 16.3% (Table 2). No statistically significant difference was observed in the concentration of ESBL-producing E. coli between the dry and rainy seasons (P = 1.00). Similarly, although some variation was noted between sites, the differences in the concentration of ESBL-producing E. coli were not statistically significant (P = 0.10).

Antibiotic resistance profile of ESBL producing E. coli isolates

A total of 107 ESBL-producing E. coli isolates from wastewater samples were tested for their susceptibility to 15 antibiotics. The resistance profile revealed that all isolates were multidrug resistant (MDR). All isolates exhibited 100% resistance to ticarcillin, cefalotin, cefotaxime, ceftazidime, cefepime, aztreonam, and ampicillin (Table 3). This resistance profile is consistent with the characteristic phenotype of ESBL-producing E. coli, which are capable of hydrolyzing a broad range of β-lactam antibiotics, including penicillins and cephalosporins. In contrast, all isolates remained susceptible to imipenem.

Table 3.

Antimicrobial resistance rates among the 107 ESBL-producing E. coli isolates analyzed in this study

Antibiotic families Antibiotic Total Resistance
n (%)
Comparison wet season vs. dry season
Wet season
n (%)
Dry season
n (%)
P-values
Ampicillin 107 (100) 44 (100) 63 (100) -
Ticarcillin 107 (100) 44 (100) 63 (100) -
Cefalotin 107 (100) 44 (100) 63 (100) -
β-lactams Cefoxitin 42 (39.2) 21 (47.7) 21 (33.3) 0.1
Cefotaxime 107 (100) 44 (100) 63 (100) -
Ceftazidime 107 (100) 44 (100) 63 (100) -
Cefepime 107 (100) 44 (100) 63 (100) -
Aztreonam 107 (100) 44 (100) 63 (100) -
Imipenem 0 0 0 -
Quinolone Nalidixic acid 86 (80.4) 33 (7) 53 (84.1) 0.2
Fluoroquinolone Ciprofloxacin 83 (77.6) 36 (81.8) 47 (74.6) 0.4
Aminoglycoside Gentamicin 51 (47.7) 17 (38.6) 34 (54.0) 0.1
Tetracycline Tetracycline 80 (74.8) 36 (81.8) 44 (69.8) 0.2
Sulfonamide SXT 81 (75.7) 31 (70.4) 50 (79.4) 0.3

SXT Trimethoprim + sulfamethoxazole

For non-beta-lactam antibiotics (Nalidixic acid, ciprofloxacin, tetracycline, SXT), resistance rates were also high (above 70% of resistant isolates), with the exception of gentamicin, for which it was 47.7% (Table 3). There was no difference between the AMR rates during the wet and dry seasons (Table 3).

Carriage of extended-spectrum β-lactamase-encoding genes

blaCTX−M genes were detected in all isolates (Table 4). The blaCTX−M−1 group was the most prevalent, and among blaCTX−M−1 positive isolates, 96.9% harbored blaCTX−M−15 subgroup.

Table 4.

Prevalence of ESBL and other β-lactamase genes among ESBL-producing E. coli isolates

ESBL Genes Total
n (%)
Comparison Wet season vs. Dry season
Wet season
n (%)
Dry season
n (%)
P-values
blaCTX−M family

blaCTX–M–1 group

blaCTX–M–15 sub-group

96 (89.7) 35 (79.5) 61 (96.8) 0.004
93 (86.9) 35 (79.5) 58 (92.1) 0.1
blaCTX–M−2 group 5 (4.7) 3 (6.8) 2 (3.2) 0.4
blaCTX−M−8 group 95 (88.8) 41 (93.2) 54 (85.7) 0.2
blaCTX−M−9 group 6 (5.6) 4 (9.1) 2 (3.2) 0.2
blaCTX−M−25 group 0 0 0 –
blaSHV family 0 0 0 –
blaTEM family 34 (31.8) 16 (36.4) 18 (28.6) 0.4
bla OXA−1 37 (34.6) 16 (36.4) 21 (33.3) 0.8

A high prevalence of blaCTX−M−8 group genes was also observed, whereas blaCTX−M−9 and blaCTX−M−2 groups were detected less frequently. No blaCTX−M−25 group gene was identified (Table 4).

The E. coli isolates collected during the dry season carried significantly more blaCTX−M−1 group genes than those collected during the wet season (P = 0.004).

Combination of ESBL and other β-lactamase genes and patterns of CTX-M groups

Combinations of β-lactamase genes was highly prevalent of the E. coli isolates (Table 5). β-lactamase gene combinations involved blaCTX−M together with blaOXA−1 and/or blaTEM (Table 5). Within the blaCTX−M group, the association of blaCTX−M−1 and blaCTX−M−8 was the predominant pattern, while other blaCTX−M group combinations were detected less frequently (Table 5). In addition, a subset of isolates exhibited complex genotypic resistance patterns, combining blaCTX−M−1, blaCTX−M−8, blaCTX−M−15, blaOXA−1, and blaTEM.

Table 5.

Distribution of β-lactamase genotypes in ESBL-producing E. coli isolates

Combination of β-lactamase genes n (%)
blaCTX−M−group+ blaOXA−1 37 (34.6)
blaCTX−M−group + blaTEM 34 (31.8)
blaCTX−M−group + blaOXA−1 + blaTEM 25 (23.4)
Combination of blaCTX−M groups
blaCTX−M−1 + blaCTX−M−8 83 (77.6)
blaCTX−M−8 + blaCTX−M−9 4 (3.7)
blaCTX−M−2 + blaCTX−M−8 3 (2.8)
blaCTX−M−1 + blaCTX−M−2 + blaCTX−M−8 2 (1.9)
blaCTX−M−1 + blaCTX−M−9 2 (1.9)

Phylogroups of the ESBL-producing E. coli

Phylogrouping analysis of the 107 ESBL-producing E. coli isolates from wastewater revealed a diverse distribution across four main phylogroups: A, B1, B2, and D. Phylogroup A was the most prevalent, accounting for 37.4% (n = 40) of the isolates, followed by phylogroup D (22.4%, n = 24), B1 (14.0%, n = 15), and B2 (5.7%, n = 5). The remaining 23 isolates could not be assigned to any of these major phylogroups using the Clermont et al. method [16].

Discussion

AMR poses a serious threat to global health, and the World Health Organization (WHO) classifies ESBL-producing E. coli as critical-priority pathogens [17]. Multidrug-resistant E. coli can be considered an indicator of antibiotic-resistant bacteria, as E. coli is a ubiquitous and commensal species that can provide relevant indications of the spread of antibiotic resistance [18]. This study demonstrated a high burden of ESBL-producing E. coli in urban wastewater in Dakar, with 100% of samples testing positive across all sites and seasons. These findings align with global reports indicating that wastewater, particularly in densely populated urban areas, serves as a major reservoir and amplifier of antimicrobial-resistant bacteria [19–21].

The concentration of ESBL-producing E. coli observed in our samples (1.36 × 10⁴ to 3.30 × 10⁵ CFU/100 mL) was comparable to that reported in similar studies conducted in low-resource settings [22, 23]. Similar concentration ranges have also been described in urban wastewater systems in France [24] and Turkey [25], highlighting the global nature of this issue. Notably, although variations were observed between seasons and locations, these differences were not statistically significant. This suggests a continuous and stable input of resistant isolates into the wastewater system, possibly from human and animal fecal sources, regardless of the climatic conditions [26, 27].

All isolates exhibited MDR, particularly to β-lactams, quinolones, and sulfonamides, reflecting the overuse and misuse of antibiotics in both clinical and community settings in sub-Saharan Africa [28–30]. The universal presence of CTX-M genes, especially the CTX-M-1 group and CTX-M-15 variants, is consistent with global trends in both human and environmental settings worldwide, indicating their broad dissemination across diverse E. coli populations [31, 32].

The co-occurrence of multiple β -lactamase- and ESBL-encoding genes within isolates, including blaTEM, blaOXA−1, and blaCTX−M, has been widely reported to be associated with mobile genetic elements and co-selection in previous studies [33, 34]. This complex resistance architecture could enhance bacterial adaptability to various environmental conditions, including those found in wastewater systems [35, 36]. Interestingly, no resistance was observed to imipenem, a carbapenem antibiotic, which remains a reliable therapeutic option for infections caused by ESBL-producing E. coli [37]. However, the widespread use of carbapenems must be carefully monitored to prevent the emergence of carbapenem-resistant isolates of bacteria.

Phylogroup distribution analysis revealed a predominance of phylogroup A (47.61%), primarily associated with commensal and environmental isolates, indicating that fecal contamination from human or animal sources is the primary origin of ESBL-producing E. coli in these wastewater systems. This finding aligns with previous studies reporting the widespread presence of phylogroup A in environmental samples [16, 38]. The significant detection of phylogroup D (28.60%), frequently linked to extraintestinal pathogenic E. coli (ExPEC), suggests the introduction and persistence of potentially pathogenic isolates in aquatic ecosystems, raising concerns regarding their environmental dissemination and possible public health implications. In contrast, the lower prevalence of phylogroup B2 (6.00%), a group often associated with highly virulent clinical isolates, may reflect the reduced fitness or adaptation of these isolates to wastewater conditions. Additionally, the presence of phylogroup B1 (17.90%), known to include both commensal and diarrheagenic pathotypes, highlights the role of wastewater as a reservoir of diverse antimicrobial-resistant E. coli lineages capable of harboring and potentially transmitting resistance traits across different ecological niches. The phylogroup distribution we observed follows those reported in several studies [39]. Overall, these findings demonstrate the genetic diversity of ESBL-producing E. coli circulating in wastewater environments.

Taken together, these results emphasize the role of wastewater as both a reservoir and conduit for the persistence and potential dissemination of ESBL-producing E. coli. These findings highlight the urgent need for improved sanitation infrastructure, stricter antimicrobial stewardship, and the implementation of integrated One Health surveillance strategies in Senegal and similar settings.

Limitations of this study

Whole-genome sequencing (WGS) analysis of the isolates could provide a more comprehensive view of their genetic characteristics. WGS would allow the determination of the full resistome, identifying all antimicrobial resistance genes present, including those not captured by targeted PCR. It could also reveal the virulome, highlighting potential virulence factors, and the mobilome, identifying plasmids, transposons, and other mobile genetic elements contributing to the spread of resistance. In addition, WGS could refine the phylogenetic and sequence type classification, providing higher resolution than conventional phylogrouping and helping to track the potential dissemination of high-risk clones.

Another limitation of this study is the exclusive focus on urban wastewater. Sampling rural wastewater systems would provide valuable information on differences in antimicrobial resistance patterns between urban and rural settings, which could inform risk assessments and targeted interventions. Future studies should aim to integrate WGS and more diverse sampling to provide a complete understanding of the distribution, diversity, and dynamics of ESBL-producing E. coli in different wastewater environments.

Acknowledgements

The authors thank all members of pole of Microbiology of Institut Pasteur de Dakar for their precious assistance.

Abbreviations

AMR

Antimicrobial resistance

AST

Antimicrobial susceptibility testing

ESBL

Extended-spectrum β-lactamase

ExPEC

Extraintestinal pathogenic E. coli

LMICs

Low- and middle-income countries

MDR

Multidrug-resistant

WHO

World Health Organization

Author contributions

Conceptualization: AC, MC, BSB. Methodology: AC, OS, IN, AAW. Sample collection: AC, OS, IN, AAW. Data analyses: KMD, AC. Validation: MC, BSB. Original draft writing: AC, KMD. Manuscript review: KMD, BSB, MC. Project administration: MC, BSB. All the authors have read and approved the manuscript by the end of the statement.

Funding

This study received no funding.

Data availability

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Declarations

Ethics approval and consent to participate

This study has received the Ethical Research approval of the Ministry of Health and Social Action of Senegal under the reference “00000002 MSAS/CNERS/SP”, Protocol ID: SEN21/70. As the three-sample collection sites were public land, the permissions for sampling on the lands have also been given by the Ministry of Health and Social Action of Senegal under the same reference “00000002 MSAS/CNERS/SP”. Wastewater sample collection was conducted following institutional, national, and international guidelines.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Tängdén T, Giske C. Global dissemination of extensively drug-resistant carbapenemase‐producing E nterobacteriaceae: clinical perspectives on detection, treatment and infection control. J Intern Med. 2015;277 (5):501–12. [DOI] [PubMed] [Google Scholar]
  • 2.Dupouy V, Doublet B, Arpaillange N, Praud K, Bibbal D, Brugère H, et al. Dominant plasmids carrying extended-spectrum β‐lactamases blaCTX‐M genes in genetically diverse Escherichia coli from slaughterhouse and urban wastewaters. Environ Microbiol Rep. 2016;8 (5):789–97. [DOI] [PubMed] [Google Scholar]
  • 3.Murray CJ, Ikuta KS, Sharara F, Swetschinski L, Aguilar GR, Gray A, et al. Global burden of bacterial antimicrobial resistance in 2019: a systematic analysis. Lancet. 2022;399 (10325):629–55. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Sully EK, Geller BL, Li L, Moody CM, Bailey SM, Moore AL, et al. Peptide-conjugated phosphorodiamidate morpholino oligomer (PPMO) restores carbapenem susceptibility to NDM-1-positive pathogens in vitro and in vivo. J Antimicrob Chemother. 2017;72 (3):782–90. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Berendonk TU, Manaia CM, Merlin C, Fatta-Kassinos D, Cytryn E, Walsh F, et al. Tackling antibiotic resistance: the environmental framework. Nat Rev Microbiol. 2015;13 (5):310–7. [DOI] [PubMed] [Google Scholar]
  • 6.Liu X, Guo X, Liu Y, Lu S, Xi B, Zhang J, et al. A review on removing antibiotics and antibiotic resistance genes from wastewater by constructed wetlands: performance and microbial response. Environ Pollut. 2019;254:112996. [DOI] [PubMed] [Google Scholar]
  • 7.Li Q, Zou H, Wang D, Zhao L, Meng M, Wang Z, et al. Tracking spatio-temporal distribution and transmission of antibiotic resistance in aquatic environments by using ESBL-producing Escherichia coli as an indicator. J Environ Manage. 2023;344:118534. [DOI] [PubMed] [Google Scholar]
  • 8.Ramos S, Silva V, Dapkevicius MLE, Caniça M, Tejedor-Junco MT, Igrejas G, et al. Escherichia coli as commensal and pathogenic bacteria among food-producing animals: Health implications of extended spectrum β-lactamase (ESBL) production. Animals. 2020;10 (12):2239. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Mellata M. Human and avian extraintestinal pathogenic Escherichia coli: infections, zoonotic risks, and antibiotic resistance trends. Foodborne Pathog Dis. 2013;10 (11):916–32. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Diene SM, Rolain J-M. Investigation of antibiotic resistance in the genomic era of multidrug-resistant Gram-negative bacilli, especially Enterobacteriaceae, Pseudomonas and Acinetobacter. Expert Rev Anti-infective Therapy. 2013;11 (3):277–96. [DOI] [PubMed] [Google Scholar]
  • 11.Dossouvi KM, Ba BS, Lo G, Cissé A, Ba-Diallo A, Ndiaye I et al. Molecular characterization of extended-spectrum beta-lactamase-producing extra-intestinal pathogenic Escherichia coli isolated in a university teaching hospital Dakar-Senegal. BioRxiv. 2022:2022.07. 20.500880.
  • 12.WHO. WHO Integrated Global Surveillance on ESBL-Producing E. coli Using a. One Health Approach: Implementation and Opportunities [Internet]. 2020. https://www.who.int/publications/i/item/9789240021402
  • 13.CASFM. Société Française de Microbiologie Enterobacterales. In: CA-SFM / EUCAST : Société Française de Microbiologie Ed. ; 2020: pp. 46–56.; 2020.
  • 14.Magiorakos A-P, Srinivasan A, Carey RB, Carmeli Y, Falagas M, Giske C, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect. 2012;18 (3):268–81. [DOI] [PubMed] [Google Scholar]
  • 15.Gundran RS, Cardenio PA, Villanueva MA, Sison FB, Benigno CC, Kreausukon K, et al. Prevalence and distribution of bla CTX-M, bla SHV, bla TEM genes in extended-spectrum β-lactamase-producing E. coli isolates from broiler farms in the Philippines. BMC Vet Res. 2019;15:1–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Clermont O, Christenson JK, Denamur E, Gordon DM. The C lermont E scherichia coli phylo-typing method revisited: improvement of specificity and detection of new phylo‐groups. Environ Microbiol Rep. 2013;5 (1):58–65. [DOI] [PubMed] [Google Scholar]
  • 17.Organization WH. WHO bacterial priority pathogens list, 2024: bacterial pathogens of public health importance, to guide research, development, and strategies to prevent and control antimicrobial resistance. World Health Organization; 2024.
  • 18.Authority EFS. The European Union Summary Report on Antimicrobial Resistance in zoonotic and indicator bacteria from humans, animals and food in 2020/2021. EFSA J. 2023;21 (3):e07867. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Cacace D, Fatta-Kassinos D, Manaia CM, Cytryn E, Kreuzinger N, Rizzo L, et al. Antibiotic resistance genes in treated wastewater and in the receiving water bodies: A pan-European survey of urban settings. Water Res. 2019;162:320–30. [DOI] [PubMed] [Google Scholar]
  • 20.Abia ALK, Baloyi T, Traore AN, Potgieter N. The African wastewater resistome: Identifying knowledge gaps to inform future research directions. Antibiotics. 2023;12 (5):805. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Milenkov M, Proux C, Rasolofoarison TL, Rakotomalala FA, Rasoanandrasana S, Rahajamanana VL et al. Implementation of the WHO Tricycle protocol for surveillance of extended-spectrum β-lactamase producing Escherichia coli in humans, chickens, and the environment in Madagascar: a prospective genomic epidemiology study. Lancet Microbe. 2024;5 (8). [DOI] [PubMed]
  • 22.Puspandari N, Sunarno S, Febrianti T, Febriyana D, Saraswati RD, Rooslamiati I, et al. Extended spectrum beta-lactamase-producing Escherichia coli surveillance in the human, food chain, and environment sectors: Tricycle project (pilot) in Indonesia. One Health. 2021;13:100331. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Banu RA, Alvarez JM, Reid AJ, Enbiale W, Labi A-K, Ansa ED, et al. Extended spectrum beta-lactamase Escherichia coli in river waters collected from two cities in Ghana, 2018–2020. Trop Med Infect Disease. 2021;6 (2):105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Bréchet C, Plantin J, Sauget M, Thouverez M, Talon D, Cholley P, et al. Wastewater treatment plants release large amounts of extended-spectrum β-lactamase–producing Escherichia coli into the environment. Clin Infect Dis. 2014;58 (12):1658–65. [DOI] [PubMed] [Google Scholar]
  • 25.Gundogdu A, Kilic H, Kurekci C, Alp E. Insufficient decontamination in Sewage treatment plants induce the risk of artificial selection of extended-spectrum β-lactamase producing Escherichia coli. Cell Mol Biol. 2017;63 (9):80–6. [DOI] [PubMed] [Google Scholar]
  • 26.García-Aljaro C, Blanch A, Campos C, Jofre J, Lucena F. Pathogens, faecal indicators and human‐specific microbial source‐tracking markers in sewage. J Appl Microbiol. 2019;126 (3):701–17. [DOI] [PubMed] [Google Scholar]
  • 27.Agga GE, Arthur TM, Durso LM, Harhay DM, Schmidt JW. Antimicrobial-resistant bacterial populations and antimicrobial resistance genes obtained from environments impacted by livestock and municipal waste. PLoS ONE. 2015;10 (7):e0132586. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Siachalinga L, Godman B, Mwita JC, Sefah IA, Ogunleye OO, Massele A et al. Current antibiotic use among hospitals in the sub-Saharan Africa region; findings and implications. Infect Drug Resist. 2023:2179–90. [DOI] [PMC free article] [PubMed]
  • 29.Belachew SA, Hall L, Selvey LA. Non-prescription dispensing of antibiotic agents among community drug retail outlets in Sub-Saharan African countries: a systematic review and meta-analysis. Antimicrob Resist Infect Control. 2021;10 (1):13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Kariuki S, Dougan G. Antibacterial resistance in sub-Saharan Africa: an underestimated emergency. Ann N Y Acad Sci. 2014;1323 (1):43–55. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Bevan ER, Jones AM, Hawkey PM. Global epidemiology of CTX-M β-lactamases: temporal and geographical shifts in genotype. J Antimicrob Chemother. 2017;72 (8):2145–55. [DOI] [PubMed] [Google Scholar]
  • 32.Ramadan AA, Abdelaziz NA, Amin MA, Aziz RK. Novel bla CTX-M variants and genotype-phenotype correlations among clinical isolates of extended spectrum beta lactamase-producing Escherichia coli. Sci Rep. 2019;9 (1):4224. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Agyekum A, Fajardo-Lubián A, Ansong D, Partridge SR, Agbenyega T, Iredell JR. blaCTX-M-15 carried by IncF-type plasmids is the dominant ESBL gene in Escherichia coli and Klebsiella pneumoniae at a hospital in Ghana. Diagn Microbiol Infect Dis. 2016;84 (4):328–33. [DOI] [PubMed] [Google Scholar]
  • 34.Guo W, Wang D, Wang X, Wang Z, Zhu H, Hu J, et al. Identification and characterization of a plasmid co-harboring blaCTX-M-55 and blaTEM-141 in Escherichia albertii from broiler in China. J Integr Agric. 2025;24 (8):3212–21. [Google Scholar]
  • 35.Szczepanowski R, Linke B, Krahn I, Gartemann K-H, Gutzkow T, Eichler W, et al. Detection of 140 clinically relevant antibiotic-resistance genes in the plasmid metagenome of wastewater treatment plant bacteria showing reduced susceptibility to selected antibiotics. Microbiology. 2009;155 (7):2306–19. [DOI] [PubMed] [Google Scholar]
  • 36.Wellington EM, Boxall AB, Cross P, Feil EJ, Gaze WH, Hawkey PM, et al. The role of the natural environment in the emergence of antibiotic resistance in Gram-negative bacteria. Lancet Infect Dis. 2013;13 (2):155–65. [DOI] [PubMed] [Google Scholar]
  • 37.Son SK, Lee NR, Ko J-H, Choi JK, Moon S-Y, Joo EJ, et al. Clinical effectiveness of carbapenems versus alternative antibiotics for treating ESBL-producing Enterobacteriaceae bacteraemia: a systematic review and meta-analysis. J Antimicrob Chemother. 2018;73 (10):2631–42. [DOI] [PubMed] [Google Scholar]
  • 38.Johnson JR, Delavari P, Kuskowski M, Stell AL. Phylogenetic distribution of extraintestinal virulence-associated traits in Escherichia coli. J Infect Dis. 2001;183 (1):78–88. [DOI] [PubMed] [Google Scholar]
  • 39.Stoppe NC, Silva JS, Carlos C, Sato MI, Saraiva AM, Ottoboni LM, et al. Worldwide phylogenetic group patterns of Escherichia coli from commensal human and wastewater treatment plant isolates. Front Microbiol. 2017;8:2512. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.


Articles from BMC Research Notes are provided here courtesy of BMC

RESOURCES