Exploring Interactive Effects of Arsenic and Selenium Exposure on Larval Zebrafish (Danio rerio)

Owen Luo; Jinnath Rehana Ritu; Md Helal Uddin; Sravan Kumar Putnala; Mahesh Rachamalla; Som Niyogi; Douglas P Chivers

doi:10.1002/tox.70048

. 2026 Feb 4;41(10):1027–1040. doi: 10.1002/tox.70048

Exploring Interactive Effects of Arsenic and Selenium Exposure on Larval Zebrafish (Danio rerio)

Owen Luo ¹, Jinnath Rehana Ritu ^1,^2,^✉, Md Helal Uddin ^1,², Sravan Kumar Putnala ¹, Mahesh Rachamalla ¹, Som Niyogi ^1,³, Douglas P Chivers ¹

PMCID: PMC13537355 PMID: 41636102

ABSTRACT

Arsenic contamination in aquatic ecosystems is a major environmental concern. Selenium (Se) helps mitigate oxidative stress and hence could reduce the toxic effects of arsenic. However, Se can also be toxic at high concentrations. Given that these metalloids commonly co‐occur in the environment, there is a pressing need for further research into their combined effects on aquatic life. To investigate this interplay, zebrafish embryos were exposed to As alone (as arsenite) or in combination with two different chemical forms of Se including As 120 μg/L alone (as arsenite), As 120 μg/L + Se 25 μg/L (as selenite), As 120 μg/L + Se 120 μg/L (as selenite), and As 120 μg/L + Se 2.5 μg/L (as selenomethionine, SeMet) until 4 days postfertilization. There was no significant difference in the survival, hatching, and deformity rate when fish were exposed to both As and Se. Co‐exposure to As and Se significantly affected thigmotaxis and reflexive movement (for all p < 0.05), with 2.5 μg/L Se mitigating As‐induced impairments. While reactive oxygen species (ROS) levels were elevated in larvae exposed to As alone and As + Se 25 μg/L, there were markedly reduced ROS levels in the As + Se 120 μg/L and As + Se 2.5 μg/L treatments, highlighting Se's antioxidant efficacy. A marked suppression of genes related to antioxidant, neurogenesis, dopaminergic, serotonergic, and motor neurons was observed following arsenic exposure. At the same time, co‐treatment with As + Se 25 μg/L partially restored nrf2a expression (p < 0.05). These findings highlight the potential for naturally co‐occurring Se to modulate As toxicity in aquatic environments, underscoring the importance of considering chemical interactions when assessing ecological risks.

Keywords: arsenite, behavior, developmental toxicity, selenite, selenomethionine

1. Introduction

Arsenic (As) contamination of groundwater poses a major global public health concern, impacting more than 100 million individuals worldwide. The most severe cases are reported in South and Southeast Asia, where geogenic As is mobilized from bedrock into aquifers, constituting a primary natural source of contamination [1, 2]. Furthermore, anthropogenic activities, including mining, industrial discharge, fossil fuel combustion, and the widespread use of As‐based agrochemicals, further exacerbate environmental As pollution [3, 4]. Due to having a high propensity for bioaccumulation in aquatic organisms, including fish and birds, As has been raising significant concerns regarding its trophic transfer and the potential risk of human exposure through the food chain [5]. Chronic exposure to As has been linked to a wide range of adverse health outcomes, including carcinogenesis, cardiovascular disease, diabetes, immunological impairment, reproductive toxicity, and neurobehavioral disorders [6]. Nevertheless, among the inorganic chemical forms of arsenic, arsenite (As³⁺) is particularly hazardous due to its high reactivity and its capacity to disrupt critical cellular processes, including the induction of oxidative DNA damage and apoptosis [7, 8]. As a potent neurotoxicant, arsenite exerts deleterious effects on the brain and central nervous system (CNS) in both mammalian [9, 10] and fish models [11]. For example, Rachamalla et al. [11] reported that dietary exposure to environmentally relevant concentrations of As (as arsenite) in zebrafish significantly impaired cognitive performance, primarily through oxidative stress and disruption of dopaminergic neurotransmission in the brain. It is worth noting that arsenic‐induced cognitive deficits have been found to be inherited transgenerationally in zebrafish across both maternal and paternal lineages, indicating long‐term neurobehavioral effects of As [12]. Similarly, chronic arsenic exposure was reported to induce reproductive toxicity and developmental toxicity in zebrafish offspring across multiple generations [13, 14, 15, 16]. Recognizing its severe toxicity and ubiquitous presence, the World Health Organization [17] has classified As among the top 10 chemicals of primary public health concern.

Like many other trace elements, As toxicity may be modulated by the crosstalk between intracellular pathways involved in the metabolism and regulation of essential and nonessential elements [18]. Selenium (Se) is a crucial micronutrient required for maintaining physiological homeostasis in all organisms, including fishes [19, 20]. However, the essentiality and toxicity of Se lie within a narrow margin, following a biphasic, U‐shaped dose–response relationship, where both deficiency and excess of Se can lead to adverse toxicity [21, 22, 23]. Nevertheless, human activities, especially mining, have been increasing the concentrations of Se both in its inorganic form as selenite and organic form as selenomethionine (SeMet) in the aquatic systems [24, 25, 26, 27]. Within the physiological optimum, Se is crucial for various physiological processes, including antioxidant defense, thyroid hormone metabolism, and immune regulation [28, 29]. On the contrary, exposure to elevated Se, in both organic (SeMet) and inorganic (selenite) forms, has been linked to developmental toxicity and neurobehavioral impairment in fishes [30, 31, 32, 33, 34]. Therefore, it can be inferred that the interactions between Se and As are likely to be influenced by both the dose and the chemical speciation of Se.

The intricate interplay between As and Se becomes particularly significant in contaminated aquatic environments, where both elements frequently co‐occur due to their shared geochemical properties and overlapping anthropogenic sources [35, 36, 37]. Evidence from mammalian studies suggests that Se significantly influences the metabolism and toxicity of As, primarily by enhancing As excretion and reducing oxidative stress [2, 38, 39, 40]. These findings indicate a potential protective role of Se against As‐induced toxicity in biological systems. In As‐exposed populations, Se supplementation has been explored as a potential therapeutic strategy to alleviate As‐induced toxicity [19]. However, in aquatic organisms, particularly fishes, the co‐exposure to As and Se at elevated levels may exacerbate toxicity rather than confer protection. For example, Jamwal et al. [35] reported that Se can potentiate As‐induced oxidative stress in rainbow trout ( Oncorhynchus mykiss ) by suppressing hepatic antioxidant defense response and increasing arsenic accumulation in neural tissues, potentially impairing neurodevelopment and behavioral functions [35]. These findings underscore the dual nature of Se, acting either as a detoxifying agent or a co‐toxicant, depending on the exposure scenario.

Despite the ecological and toxicological significance of As and Se interactions, research on their combined effects in aquatic organisms remains limited. Most studies have focused on mammalian models [41, 42, 43, 44, 45, 46], with scarce data on fishes, particularly at early developmental stages.

With that in mind, the present study aims to investigate the behavioral and physiological effects of co‐exposure to As and Se in larval zebrafish ( Danio rerio ), a widely used vertebrate model in toxicology and neurobehavioral research [47, 48]. We hypothesized that environmentally relevant concentrations of Se (selenite and SeMet) would mitigate As (as arsenite)‐induced developmental and behavioral abnormalities in larval zebrafish by reducing oxidative stress and enhancing monoaminergic neurotransmission. To test this hypothesis, zebrafish embryos were exposed from 0 to 4 days postfertilization (dpf) to five treatment conditions: 0 μg/L (control, no added As/Se/SeMet), As 120 μg/L + Se 0 μg/L, As 120 μg/L + Se 25 μg/L (as selenite), As 120 μg/L + Se 120 μg/L (as selenite), and As 120 μg/L + Se 2.5 μg/L (as SeMet). To our knowledge, this study is the first to investigate the developmental and behavioral outcomes of combined As and Se exposure in fish, providing novel insights into their interactive effects during early vertebrate development.

2. Materials and Methods

2.1. Chemicals and Reagents

Sodium arsenite (> 90% purity), sodium selenite (> 99% purity), and SeMet (SeMet, > 99% purity) were obtained from Sigma‐Aldrich (St. Louis, MO, USA). Stock solutions were prepared in ultrapure water at 100 μg/mL concentrations for sodium arsenite, 50 μg/mL for sodium selenite, and 50 μg/L for SeMet. Experimental solutions were prepared by diluting the stock solutions in 10% E3 medium (5 mM NaCl, 0.17 mM KCl, 0.33 mM CaCl₂, 0.33 mM MgSO₄). All chemicals and reagents, including 1‐phenyl‐2‐thiourea (PTU), were of analytical grade.

2.2. Fish Husbandry and Egg Collection

Wild‐type adult zebrafish (D. rerio) were obtained from the breeding colony maintained at the Collaborative Sciences Research Building, University of Saskatchewan and were housed in a flow‐through system using dechlorinated municipal water from Saskatoon (total hardness: 150 mg/L as CaCO₃, alkalinity: 120 mg/L as CaCO₃, pH: 7.5–8.0, temperature: 27°C, and photoperiod: 14:10 h light–dark). Fish were fed two times, Nutrafin Max flakes (Germany) in the morning and Hikari BIO‐PURE frozen bloodworms (California, USA) in the afternoon. Breeding groups were housed in tanks containing two females and one male. Spawning was induced by the onset of light. Eggs were collected and rinsed with the control solution before starting the exposure study.

2.3. Experimental Design

Zebrafish embryos (~4 hpf) were randomly exposed to five different nominal concentrations of As and Se in the form of arsenite, selenite and selenomethionine (as SeMet) namely: (1) 0 μg/L (control, no added As/Se/SeMet), (2) As 120 μg/L (as arsenite) + Se 0 μg/L (no added selenium), (3) As 120 μg/L (as arsenite) + Se 25 μg/L (as selenite), (4) As 120 μg/L (as arsenite) + Se 120 μg/L (as selenite), and (5) As 120 μg/L (as arsenite) + Se 2.5 μg/L (SeMet). It is important to mention here that a single concentration of arsenic (120 μg/L as arsenite) was selected for this study, based on levels reported in contaminated natural environments and its known toxicity in fishes [13, 49]. However, the primary objective of the current study was to investigate whether Se modulates As‐induced toxicity; therefore, the experimental design focused on As‐exposed and As‐Se co‐exposed groups. Se concentrations were chosen to reflect nontoxic and/or environmentally relevant toxic doses for larval zebrafish, with selenite (25 and 120 μg/L) representing inorganic Se [28, 44] and selenomethionine (SeMet, 2.5 μg/L) representing organic Se [50]. It is worth noting that fishes in natural aquatic environments primarily encounter waterborne selenium as selenite, but SeMet can also enter via algal cell lysis or die‐off. Therefore, including both forms allowed assessment of the potential ameliorative effects of chemically distinct Se species on As‐induced toxicity. Higher selenite concentrations and lower SeMet concentrations were used to account for the greater toxicity of SeMet compared to selenite [25]. Embryos were placed in 90 mm Petri dishes containing 50 mL of exposure solutions with four replicates per treatment (60 embryos per replicate). Larvae were exposed for four days postfertilization (dpf) under controlled conditions (photoperiod of 14‐h light/10‐h dark and temperature of 28°C), after which larvae from all treatment groups were transferred to control water (E3 medium) for an additional 24 h. Fifty percent of the exposure solution was exchanged for fresh solutions daily. At 5 dpf, key developmental endpoints, including hatching rate, deformity rate and survivability, were assessed using the following formula.

Hatching rate (%) = \frac{Number of hatched embryos}{Total number of embryos} \times 100

Deformity rate (%) = \frac{Number of malform embryos}{Total number of embryos} \times 100

Survivability (%) = \frac{Number of survival embryos}{Total number of embryos} \times 100

Reactive oxygen species (ROS) levels in larvae at 5 dpf were assessed to evaluate oxidative stress. 1‐phenyl‐2‐thiourea (PTU) (0.003% w/v) was added to the exposure solutions to suppress pigmentation during fluorescence analysis. However, PTU was not used to assess developmental endpoints and behavioral assays. Furthermore, thigmotaxis and the light–dark preference test were assessed as behavioral endpoints. Following behavioral assessments, larvae were immediately preserved in RNAlater and stored at −80°C for subsequent gene expression analysis via RT‐qPCR. A schematic of the experimental design is shown in Figure 1. All experimental procedures were conducted in accordance with the guidelines approved by the Animal Research Ethics Committee of the University of Saskatchewan (Protocol No. AUP20220070).

2.4. Measurement of Arsenic and Selenium Concentrations

Total concentrations of As and Se in the exposure media were quantified using a graphite furnace atomic absorption spectrometer (GFAAS; PerkinElmer AAnalyst 800, USA), following previously described methods [11, 33]. Briefly, water samples were acidified with 0.2% (v/v) trace metal‐grade nitric acid (Fisher Scientific Ltd., Canada) and stored at 4°C until analysis. Quality assurance and control were ensured using method blanks, sample duplicates, certified standards for As and Se (Fisher Scientific, Canada), and a certified reference material (DOLT‐4). The analytical method demonstrated a recovery rate of 96% for both As and Se. The measured total As and Se concentrations for nominal As and Se exposure levels of 0 (control, no added As/Se), As 120 (as arsenite), Se 25 (as selenite), Se 120 (as selenite), and Se 2.5 μg/L (as SeMet) were below the detection levels (< 1 μg/L for both As and Se) for control, 124 ± 10.12, 24.34 ± 5.08, 116.62 ± 12.71, and 2.4 ± 0.29 μg/L, respectively (mean ± SEM; n = 6). As the variation among nominal and measured concentrations was within 5%, nominal values were used for all subsequent references.

2.5. Behavioral Analysis

The reflexive movement test was conducted to evaluate the interactive effects of As and Se on motor response development. Individual larvae were placed in each well of a transparent 6‐well plate (35 mm diameter) and acclimated for 20 min. Following acclimatization, they were exposed to alternating 5‐min light and 5‐min dark for 20 min. Key parameters measured included total distance traveled (mm), activity counts (numbers/min), and maximum speed in light and dark phases. To allow for video recording, infrared light was used in the dark condition. To assess thigmotactic behavior, another set of larvae was acclimated for 10 min, and movements were recorded for an additional 10 min. Thigmotaxis was quantified by calculating the percentage of total distance traveled within the outer zone of each well and the percentage of time spent in this zone. The outer zone was defined as the area within 8 mm of the well border [51, 52]. For both behavioral experiments, larval movements were recorded with a GoPro Hero4 camera (v05.00) at 30 frames per second (fps). Data from the recorded video was extracted using customized Python‐based software [53, 54].

2.6. Determination of ROS Levels

Intracellular ROS intensity was determined by using 2′,7′‐dichlorodihydrofluorescein diacetate (DCF‐DA) staining, an oxidation‐sensitive fluorescent probe. Ten live larvae (5 dpf) from each treatment group were stained which consisted of washing them three times with 1 × PBS (pH 7.4), incubating live larvae with 20 μg/mL DCF‐DA solution for 2 h in a dark environment and finally washing them 3 times with 1 × PBS (pH 7.4). After washing, larvae were positioned laterally on glass depression slides for imaging using the Zeiss AxioPlan fluorescence microscope at an excitation and emission wavelength of 450–490 nm and 510–520 nm, respectively. During imaging, a solution of 3.5% methylcellulose was used to fix the larvae. The fluorescence intensity was quantified using ImageJ software [55] using the corrected total cell fluorescence (CTCF) formula:

2.7. RNA Extraction, cDNA Synthesis and Quantitative Real‐Time qPCR Analysis

The expression of selected genes associated with neurogenesis (ngn1, huc, bdnf, nrd4, sf1), serotonergic (pet1, tph2, serta), dopaminergic signaling (sncgb, otpa, robo2, th1), motor response (insem1a, pax2a), and antioxidant response (mn‐sod, gpx, nrf2a, nrf2b) was analyzed by quantitative reverse transcription polymerase chain reaction (RT‐qPCR). Total RNA was extracted following the manufacturer's protocol from pooled samples (10 zebrafish larvae/replicate) using the RNeasy Mini Kit (GeneBio Systems, Ontario, Canada). RNA concentration and purity were verified using a NanoDrop spectrophotometer (Thermo Scientific, USA) with 260 and 280 nm absorbance. Only samples with a 260/280 nm ratio between 1.8 and 2.0 were selected for downstream analysis. Complementary DNA (cDNA) was synthesized from 1 μg of total RNA using the GB‐Script III 1st Strand cDNA Synthesis Kit (GeneBio Systems, Ontario, Canada). qRT‐PCR reactions were performed in a 20 μL reaction mixture containing 10 μL SYBR Green PCR Master Mix (SensiFast, Bioline, USA), 2 μL cDNA, 0.8 μL each of forward and reverse gene‐specific primers (Table 1), and 6.4 μL nuclease‐free water. Thermal cycling conditions included an initial denaturation at 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min, using an ABI QuantStudio 6 (Applied Biosystems, USA). β‐actin was the reference gene due to its stable expression in zebrafish embryos [56]. Relative gene expression was quantified using the 2^−ΔΔCt method [57].

TABLE 1.

List of primers used for RT‐qPCR analysis in larval zebrafish.

Gene	Forward primer	Reverse primer
Ngn1	CAGCCCACCAATAAGGTTATCA	TGGAGACGCAGGTGGTTTTC
huC	AGACAAGATCACAGGCCAGAGCTT	TGGTCTGCAGTTTGAGACCGTTGA
Bdnf	ACTCCAACAGATGCTGGTAGGT	ATAGTAACGAACAGGATGG
Nrd4	CAGGTGCTACAATAACAGATCAC	TAATACGACTCACTATAGGGGTAGTGAGTCGGATGAGGCG
Pet1	CCATTCAGTTTTCAGGTATTTCC	CCATTCAGTTTTCAGGTATTTCC
Tph2	CCAGGAGTGCCTCATTACCA	GCTCTGCGTGTAAGGGTTGT
Serta	TAATACGACTCACTATAGGGGTCCAACAGACGAGCCTTGA	TGGGAGTGTTCCATCGGTTG
Sncgb	TCCGCAAAATATCTATCACCTG	GTGTTCTGGGGAAAAAAAACAG
Otpa	CTTAACGAGCTGGAACGCAG	CGGAACACGTTGGTGGTCTT
Robo2	GCAGCGAACACTCAACTGAC	CCACATCCACACCTCAGTTCT
Th1	GGGCAATCAGCGAGCAAA	ACTGACCTTCCTGAGTCTCCA
Insem1a	CAGCAGAGAGCACGAGAGG	GAAAGACTCCGCTGAGATGG
Pax2a	TCTCACCCGCAGTACACAAC	CTAGTGGCGGTCATAGGCAG
MnSOD	AGCGTGACTTTGGCTCATTT	ATGAGACCTGTGGTCCCTTG
GPx	CCCTCTGTTTGCGTTCCTGA	TCTTGAATGGTTCCCCGTCC
Nrf‐2a	GAGCGGGAGAAATCACACAGAATG	CAGGAGCTGCATGCACTCATCG
Nrf‐2b	GCCACGTTATGCTGGGTTTC	CTGCGGACAACGATAGCAGA
β‐Actin	AGGTCATCACCATTGGCAAT	GATGTCCACGTCGCACTTCAT

Open in a new tab

2.8. Statistical Analysis

Data normality and homogeneity of variances were assessed using the Shapiro–Wilk and Levene tests, respectively. For datasets meeting the assumption of homogeneity, one‐way analysis of variance (ANOVA) was conducted to evaluate the effects of arsenic and selenium co‐exposure on measured parameters, followed by Dunnett's post hoc test to identify significant differences between the control and each treatment group. Results are expressed as mean ± standard error of the mean (SEM), with statistical significance set at p < 0.05. All statistical analyses were performed using SPSS 20.0 (SPSS Inc., Chicago, IL, USA) and GraphPad Prism 8 (GraphPad Software Inc., San Diego, CA, USA).

3. Results

3.1. Apical Parameters Assessment of Larval Zebrafish

The potential developmental toxicity of As and Se co‐exposure in zebrafish embryos was assessed by evaluating apical parameters including hatching success, survival, and larval deformities. There were no significant differences in mean hatching rate, survival rate, and deformity rate of larval zebrafish among the treatment groups (Figure S1a–c).

3.2. Effects on ROS Production

At 5 dpf, larvae exposed to As 120 μg/L (as arsenite) + Se 0 μg/L exhibited the highest fluorescence intensity of ROS levels, followed by those exposed to As 120 μg/L (as arsenite) + Se 25 μg/L (as selenite) (one‐way ANOVA, F _4,47 = 13.87, p < 0.001 followed by Dunnett's multiple comparisons test: p < 0.001 for all comparisons) (Figure 2). Although ROS fluorescence intensity was increased in larvae exposed to As 120 μg/L (as arsenite) + Se 120 μg/L (as selenite) and As 120 μg/L (as arsenite) + Se 2.5 μg/L (as SeMet) compared to the control group (0 As/Se, no added As/Se group), there was no significant difference between the control (0 As/Se, no added As/Se group) versus As 120 μg/L (as arsenite) + Se 120 μg/L (as selenite) (p = 0.399) group, or control group (0 As/Se, no added As/Se group) versus As 120 μg/L (as arsenite) + Se 2.5 μg/L (as SeMet) group (p = 0.233).

Mean (±SEM) ROS production levels in zebrafish larvae exposed to selenium as selenite (Se) (25 and 120 µg/L) and Selenomethionine (2.5 µg/L) with a constant co‐exposure with arsenic (As) of 120 µg/L (as arsenite) at 5 days post‐fertilization. (n = 10/Treatment). Star (*) represent statistical differences at α = 0.05.

3.3. Thigmotaxis Behavioral Assay

The co‐exposure of Se and As had a significant impact on zebrafish larvae's distance traveled (one‐way ANOVA, F _4,175 = 6.95, p < 0.001) and time spent in the outer zone (one‐way ANOVA, F _4,175 = 7.7, p < 0.001) compared to the control group (0 As/Se, no added As/Se group). Dunnett's multiple comparisons test indicated a substantial reduction in distance traveled by larvae exposed to As 120 μg/L (as arsenite) + Se 0 μg/L (p < 0.001), As 120 μg/L (as arsenite) + Se 25 μg/L (as selenite) (p = 0.004), and As 120 μg/L (as arsenite) + Se 120 μg/L (as selenite) (p < 0.001). However, no significant difference was observed when exposed to As 120 μg/L (as arsenite) + Se 2.5 μg/L (as SeMet) compared to the control group (0 As/Se, no added As/Se group) (p = 0.121) (Figure 3a). Similarly, larvae in the As 120 μg/L (as arsenite) + Se 0 μg/L exhibited a significant decrease in the time spent at the outer zone (47.84% ± 4.74%) followed by As 120 μg/L (as arsenite) + Se 120 μg/L (as selenite) (51.47% ± 4.93%) and As 120 μg/L (as arsenite) + Se 25 μg/L (as selenite) (59.14% ± 3.27%), respectively (Dunnett's multiple comparisons test, p < 0.001; p = 0.018; and p < 0.001, respectively) compared to the control group (0 As/Se, no added As/Se group) (75.65% ± 2.62%). In contrast, exposure to As 120 μg/L + Se 2.5 μg/L (as SeMet) (67.32% ± 4.48%) did not result in a statistical difference compared to the control (0 As/Se, no added As/Se group) (p = 0.411) (Figure 3b).

Mean (±SE) (a) outer zone distance travelled (%) and (b) outer zone time spent (%) by larval zebrafish in response to selenium as selenite (Se) (25 and 120 µg/L) and Selenomethionine (2.5 µg/L) with a constant Arsenic (As) of 120 µg/L at 5 days post‐fertilization (n = 36/Treatment). Star (*) represent statistical differences at α = 0.05. Representative heatmaps are provided in the Figure S2.

3.4. Light–Dark Reflexive Movement

The co‐exposure of As and Se significantly affected the total distance traveled (mm) (one‐way ANOVA, F _4,180 = 7.09, p < 0.001), activity counts (numbers (n)/min) (one‐way ANOVA, F _4,180 = 3.49, p = 0.009), maximum light speed (mm/s) (one‐way ANOVA, F _4,180 = 8.55, p < 0.001) and maximum dark speed (mm/s) (one‐way ANOVA, F _4,175 = 6.94, p < 0.001) of 5 dpf zebrafish larvae. On one hand, the total distance traveled (mm) by larvae was significantly reduced in As 120 μg/L (as arsenite) + Se 0 μg/L, As 120 μg/L (as arsenite) + Se 25 μg/L (as selenite) and As 120 μg/L (as arsenite) + Se 120 μg/L (as selenite) treated group compared to the control group (0 As/Se, no added As/Se group) (Dunnett's multiple comparisons test: p < 0.003; p < 0.005; and p < 0.001 respectively) (Figure 4a). On the other hand, the total distance traveled (mm) by larvae in As 120 μg/L (as arsenite) + Se 2.5 μg/L (as SeMet) did not show any significant difference compared to the control group. Similarly, activity counts of larval zebrafish were significantly decreased in the As 120 μg/L (as arsenite) + Se 0 μg/L (p = 0.002) and As 120 μg/L (as arsenite) + Se 25 μg/L (as selenite) (p = 0.046) treated groups compared to the control group (0 As/Se, no added As/Se group) whereas no significant difference was observed among As 120 μg/L (as arsenite) + Se 120 μg/L (as selenite) and As 120 μg/L (as arsenite) + Se 2.5 μg/L (as SeMet) compared to the control (0 As/Se, no added As/Se group) (for all comparisons, p > 0.05) (Figure 4b).

Mean (±SE) (a) total distance travelled (mm), (b) activity/min, (c) maximum speed in light (mm/s) and (d) maximum speed in dark (mm/s) by larval zebrafish in response to selenium as selenite (Se) (25 and 120 µg/L) and Selenomethionine (2.5 µg/L) with a constant arsenic (As) of 120 µg/L at 5 days post‐fertilization (n = 37/Treatment). Star (*) represent statistical differences at α = 0.05. Representative heatmaps are provided in the Figure S3.

The maximum speed in light (mm/s) and dark conditions (mm/s) was significantly reduced in larvae exposed to the As 120 μg/L (as arsenite) + Se 0 μg/L, As 120 μg/L (as arsenite) + Se 25 μg/L (as selenite), and As 120 μg/L (as arsenite) + Se 120 μg/L (as selenite) treated group compared to the control (0 As/Se, no added As/Se group) (Dunnett's multiple comparisons test: p < 0.001 for all comparisons) (Figure 4c,d). On the contrary, the maximum speed in both light and dark conditions was not significantly different between As 120 μg/L (as arsenite) + Se 2.5 μg/L (as SeMet) treated group compared to the control (0 As/Se, no added As/Se group) (Figure 4c,d).

3.5. Gene Expression at 5 dpf

3.5.1. Modulation of Antioxidant Gene Expression Following Arsenic and Selenium Co‐Exposure

Co‐exposure to As and Se significantly affected the expression levels of Mn‐sod (one‐way ANOVA, F _4,21 = 3.306, p = 0.03) and gpx (one‐way ANOVA, F _4,25 = 5.948, p = 0.002) antioxidant genes at 5 dpf zebrafish larvae. The expression of Mn‐sod was significantly downregulated in the As 120 μg/L (as arsenite) + Se 0 μg/L treated group compared to the control (0 As/Se, no added As/Se) (Dunnett's multiple comparisons test: p < 0.001). Furthermore, co‐exposure of Se (both selenite and SeMet) and As also showed significantly lower Mn‐sod expression than the control group (0 As/Se, no added As/Se) (Dunnett's multiple comparisons test: control vs. As 120 μg/L [as arsenite] + Se 25 μg/L [as selenite]: p = 0.003; control vs. As 120 μg/L [as arsenite] + Se 120 μg/L [selenite]: p = 0.006 and control vs. As 120 μg/L [as arsenite] + Se 2.5 μg/L [as SeMet]: p = 0.003). Similarly, gpx expression was markedly reduced, demonstrating a 3.09‐fold reduction in As 120 μg/L (as arsenite) + Se 0 μg/L (p < 0.001) compared to the control (0 As/Se, no added As/Se), followed by As 120 μg/L (as arsenite) + Se 2.5 μg/L (as SeMet) (p = 0.002), and As 120 μg/L (as arsenite) + Se 25 μg/L (as selenite) (p = 0.003) and As 120 μg/L (as arsenite) + Se 120 μg/L (as selenite) (p = 0.02) compared to the control group (0 As/Se, no added As/Se) (Figures 5a and S4). In addition, co‐exposure to As and Se also affected the nrf2a expression (one‐way ANOVA, F _4,20 = 8.679, p < 0.001), while there was no significant difference in nrf2b expression (one‐way ANOVA, F _4,22 = 1.621, p = 0.205). A marked downregulation of nrf2a was observed in the As 120 μg/L (as arsenite) + Se 0 μg/L group compared to the control group (0 As/Se, no added As/Se) (p < 0.001). Notably, As 120 μg/L (as arsenite) + Se 25 μg/L (as selenite) showed a significant restoration of nrf2a expression compared to the As 120 μg/L (as arsenite) + Se 0 μg/L group (Figure 5b), while expression levels were comparable to the control group (0 As/Se, no added As/Se) (p = 0.996) (Figures 5a and S4).

Heatmap showing the relative gene expression patterns of neurogenesis, serotonergic, dopaminergic, motor and antioxidant markers in zebrafish larvae exposed to Se 25 and 120 μg/L (as selenite) and Se 2.5 μg/L (as selenomethionine, SeMet) with a constant co‐exposure with As 120 μg/L (as arsenite) at 5 days postfertilization. Rows represent genes; columns, exposure concentrations; black bars represent baseline (control group). Red and green bars represent an upregulation and downregulation of genes, respectively. The intensity of the color increases as the expression differences increase, as shown in the bar on the right. An asterisk indicates that data are significantly different from the control group (0 As/Se, no added As/Se) (a) and As 120 μg/L (as arsenite) + Se 0 μg/L (b). There were five replicates, and each replicate contained 10 larvae. *p < 0.05.

No significant differences were observed in the expression levels of Mn‐sod and gpx among the As and Se co‐treatment groups (120 μg/L [as arsenite] + Se 0 μg/L; As 120 μg/L [as arsenite] + Se 25 μg/L [as selenite]; As 120 μg/L [as arsenite] + Se 120 μg/L [as selenite]; As 120 μg/L [as arsenite] + Se 2.5 μg/L [as SeMet] treated group) (p > 0.05; Figure 5b). However, nrf2a expression was significantly upregulated by approximately 6.65‐fold (Figure 5b) in the group co‐exposed to As 120 μg/L (as arsenite) + Se 25 μg/L (as selenite) compared to the As 120 μg/L (as arsenite) + Se 0 μg/L (p = 0.007) exposed group. While nrf2b expression did not differ significantly from the As 120 μg/L (as arsenite) + Se 0 μg/L group, a downward trend in expression was observed in the As and Se co‐exposure groups (Figure 5b).

3.5.2. Expression of Neurodevelopmental Genes

Quantitative analysis revealed a significant downregulation of ngn1 mRNA levels following exposure to As 120 μg/L (as arsenite) + Se 0 μg/L compared to the control group (0 As/Se, no added As/Se) (p = 0.004) (Figures 5a and S4). In addition, co‐exposure to As and Se (As 120 μg/L [as arsenite] + Se 25 μg/L [as selenite]; As 120 μg/L [as arsenite] + Se 2.5 μg/L [as SeMet]) showed a significant downregulation in ngn1 gene expression (p < 0.01) compared to the control (0 As/Se, no added As/Se) except for the As 120 μg/L (as arsenite) + Se 120 μg/L (as selenite) group. A similar pattern was observed for huc (one‐way ANOVA, F _4,25 = 4.649, p = 0.006), bdnf (F _4,23 = 6.345, p < 0.001), and sf1 (F _4,25 = 5.355, p = 0.003), which were significantly downregulated at As 120 μg/L (as arsenite) + Se 0 μg/L and the As‐Se co‐treatment groups (As 120 μg/L [as arsenite] + Se 25 μg/L [as selenite]; As 120 μg/L [as arsenite] + Se 120 μg/L [as selenite]; As 120 μg/L [as arsenite] + Se 2.5 μg/L [as SeMet]) when compared to the control group (0 As/Se, no added As/Se) (p < 0.01 for all). In contrast, nrd4 expression remained unaffected across all treatment conditions (F _4,20 = 0.94, p = 0.461). Notably, examined neurodevelopmental genes expression levels in all treatment groups were statistically comparable to those of the As 120 μg/L (as arsenite) + Se 0 μg/L exposed group (Figure 5b).

3.5.3. Expression of Neuronal Signaling Pathway Genes

Exposure to As 120 μg/L (as arsenite) + Se 0 μg/L markedly downregulated the expression of key dopaminergic genes sncgb, robo2, and th1 compared to the control group (0 As/Se, no added As/Se) (p < 0.01). In addition, robo2 and th1 showed downregulation in their expression at the As‐Se co‐exposed groups (As 120 μg/L [as arsenite] + Se 25 μg/L [as selenite]; As 120 μg/L [as arsenite] + Se 120 μg/L [as selenite]; As 120 μg/L [as arsenite] + Se 2.5 μg/L [as SeMet]) compared to the control group (0 As/Se, no added As/Se) (p < 0.05 for all) (Figures 5a and S4). Furthermore, the expression of these genes was found to be comparable among As‐Se co‐exposed groups, As 120 μg/L (as arsenite) + Se 25 μg/L (as selenite); As 120 μg/L (as arsenite) + Se 120 μg/L (as selenite); As 120 μg/L (as arsenite) + Se 2.5 μg/L (as SeMet) and As 120 μg/L (as arsenite) + Se 0 μg/L group exposed group (p > 0.05) (Figure 5b).

The serotonergic genes, pet1 (F _4,22 = 3.581, p = 0.022) and tph2 (F _4,24 = 6.424, p < 0.001) were found to be affected in their expression upon exposure to different concentrations of As and As‐Se co‐exposed groups (Figures 5a and S4). pet1 expression was significantly downregulated at the As 120 μg/L + Se 0 μg/L (p = 0.016) compared to the control group (0 As/Se, no added As/Se) group. Whereas, tph2 expression was also significantly reduced at the As 120 μg/L + Se 0 μg/L exposed group, including all As and Se co‐treatment groups (As 120 μg/L [as arsenite] + Se 25 μg/L [as selenite]; As 120 μg/L [as arsenite] + Se 120 μg/L [as selenite]; As 120 μg/L [as arsenite] + Se 2.5 μg/L [as SeMet]) relative to the control group (0 As/Se, no added As/Se) (p < 0.001). In contrast, no significant difference in serta expression was observed between any of the treatment groups (p = 0.290) (Figures 5a and S4). Moreover, As‐Se co‐treatments (As 120 μg/L [as arsenite] + Se 25 μg/L [as selenite]; As 120 μg/L [as arsenite] + Se 120 μg/L [as selenite]; As 120 μg/L [as arsenite] + Se 2.5 μg/L [as SeMet]) did not alter the gene expression of pet1, tph2, and serta compared to the As 120 μg/L + Se 0 μg/L exposed group (p > 0.05 for all) (Figure 5b).

The motor neuron‐associated gene, Pax2a was significantly downregulated at As 120 μg/L + Se 0 μg/L treated group compared to the control group (F _4,22 = 6.386, p < 0.001). Conversely, insm1a expression was not significantly altered (F _4,21 = 3.581, p = 1.561) (Figures 5a and S4). Furthermore, Pax2a expression was found to be significantly downregulated in all As‐Se co‐exposed groups (As 120 μg/L [as arsenite] + Se 25 μg/L [as selenite]; As 120 μg/L [as arsenite] + Se 120 μg/L [as selenite]; As 120 μg/L [as arsenite] + Se 2.5 μg/L [as SeMet]) compared to the control group (0 As/Se, no added As/Se) (p < 0.05 for all) (Figure 5a).

4. Discussion

Arsenic (As) and selenium (Se) frequently co‐occur as contaminants in aquatic ecosystems, with their continuous input driven by both natural sources and human activities [58]. Consequently, fishes inhabiting such environments will likely be simultaneously long‐term exposed to both elements, leading to bioaccumulation. Additionally, larger organisms may prey upon these fish, leading to biomagnification up the food chain [23, 35]. However, most studies have examined the toxicological impacts of As or Se individually, with a primary focus on adult life stages and with little attention on early life stages of fishes [11, 30, 32, 33, 34, 49, 59, 60]. The effects of co‐exposure to As and Se at environmentally relevant concentrations on neurodevelopment and behavior during early life, the most sensitive stages of fish development, remain unexplored. To address this knowledge gap, we investigated the interactive effects of As and Se co‐exposure on neurodevelopmental and behavioral outcomes in larval zebrafish ( D. rerio ), offering novel insights into the dual roles of Se as both a protective antioxidant and a potential prooxidant at elevated concentrations. It is important to note that the exposure concentrations of both As and Se used in this experiment represent environmentally realistic levels [23, 49].

Our findings reveal a nuanced interaction between As and Se, with Se exhibiting concentration‐ and speciation‐dependent effects. While As exposure at 120 μg/L (as arsenite) did not significantly alter apical developmental endpoints such as hatching success, mortality, or larval deformities, behavioral assays revealed pronounced alterations in thigmotaxis and reflexive responses, both by As as well as As and Se co‐exposures (selenite and SeMet). Notably, moderate to high concentrations of Se (25 and 120 μg/L as selenite) did not mitigate As‐induced behavioral toxicity, whereas a low concentration of organic Se (2.5 μg/L as selenomethionine, SeMet) showed ameliorative effects on behavior. These findings underscore the heightened sensitivity of behavioral endpoints in detecting sublethal neurotoxicity, even in the absence of morphological abnormalities. Consistent with our observations, previous studies have also reported no significant developmental toxicity at comparable or higher As concentrations. For instance, Piyushbhai et al. [61] found no significant effects on hatching or larval deformities below 22 μg/L As, and no mortality differences below 15 μg/L As (as arsenite). Similarly, Li et al. [62] reported that early‐life exposure to low doses of arsenite (< 37.5 mg/L) did not compromise embryo survival or cause visible malformations during zebrafish embryogenesis (4–120 hpf).

Behavioral phenotypes are orchestrated by complex neural networks and are considered vital indicators of neurological function and organismal fitness [63]. In ecotoxicology, alterations in behavior are increasingly recognized as reliable and sensitive biomarkers for detecting neurotoxic effects of environmental pollutants [63, 64]. Extensive research has demonstrated that exposure to neurotoxic contaminants can lead to behavioral disruptions during the early developmental phases of zebrafish [49, 65, 66]. Given the increased susceptibility of the developing nervous system to toxic insults, behavioral assays have emerged as a robust and practical approach for assessing chemical‐induced neurotoxicity in larval fish [67, 68]. In alignment with these findings, the present study supports the idea that behavioral endpoints are highly sensitive indicators of developmental toxicity induced by prevalent environmental contaminants such as As and Se in fish.

In the present study, exposure to As (120 μg/L as arsenite) significantly impaired anxiety‐related behaviors in larval zebrafish. Notable reductions were observed in thigmotaxis parameters, specifically time spent and distance traveled in the outer zone, as well as in reflexive responses, including total distance traveled, activity per minute, and maximum speed under both light and dark conditions, indicating elevated anxiety‐like behavior. These findings are consistent with those of Zhu et al. [49], who reported that As concentrations above 100 μg/L (as arsenite) disrupted thigmotaxis and light–dark response behaviors in larval zebrafish. Similarly, Wang et al. [69] observed reduced swimming speed, total distance, and altered spatial preference in zebrafish larvae exposed to 100 μg/L As (as arsenite) for 28 days. Piyushbhai et al. [61] also reported impaired touch responses in larvae exposed to < 30 μg/L As (as arsenite), although behavioral assessments in that study were conducted visually, introducing potential observer bias. In contrast, Baldissarelli et al. [70] documented reduced locomotion in adult zebrafish exposed to 5 mg/L As (as arsenite), which is approximately 40 times higher than that used in our study and less environmentally relevant.

Importantly, co‐exposure to As (120 μg/L as arsenite) and Se at moderate to high concentrations (25 and 120 μg/L as selenite) exacerbated behavioral impairments, affecting both thigmotaxis and reflexive responses. These concentrations far exceed established water quality guidelines, including the Canadian Council of Ministers of the Environment [71] recommendation of 1 μg/L Se for aquatic life, and the US EPA [72] water column criteria of 1.5 μg/L for lentic and 3.1 μg/L for lotic waters. The observed behavioral disruptions may be attributed to the prooxidant properties of Se at elevated concentrations. Supporting this, Uddin et al. [33] reported that Se alone, at 50 and 100 μg/L as selenite, impaired thigmotaxis and social behavior in larval zebrafish. Interestingly, co‐exposure to a low concentration of organic Se (2.5 μg/L as SeMet) with As (120 μg/L as arsenite) ameliorated both thigmotaxis and reflexive behavioral impairments. This protective effect may be due to the antioxidant properties of Se, highlighting its neuroprotective potential within the physiologically optimal range. It is important to note here that both individual exposure to As (as arsenite) and co‐exposure to moderate and higher concentrations of Se (as selenite) impaired ecologically important behaviors that may likely increase the risk of predation and overall fitness of fishes [33, 49, 69].

Oxidative stress, induced by environmental contaminants, is a critical mechanism underlying developmental neurotoxicity in fish [73]. Early life stages of fishes are particularly vulnerable, as their antioxidant defense systems are often insufficient to counteract the excessive production of ROS [74]. In the present study, embryonic exposure to As (120 μg/L as arsenite) induced oxidative stress in larval zebrafish, as evidenced by increased intracellular ROS levels. Key antioxidant defense components at the cellular level, including glutathione peroxidase (GPx), manganese superoxide dismutase (MnSOD), and the redox‐regulating transcription factor nrf2a, were found to be dysregulated in response to As exposure. These findings support the hypothesis that As‐induced oxidative stress contributes to the observed behavioral impairments in zebrafish larvae. Consistent with our results, Sun et al. [75] reported that early‐life exposure of zebrafish to environmentally relevant concentrations of As (< 150 μg/L as arsenite) disrupted antioxidant defense mechanisms, as indicated by altered mRNA expression levels of Cu/ZnSOD and MnSOD. Similarly, zebrafish embryos co‐exposed to As (120 μg/L as arsenite) and Se (25 μg/L as selenite) exhibited significant oxidative stress, as indicated by elevated ROS production and dysregulation of key antioxidant genes. These molecular and biochemical changes were associated with pronounced behavioral impairments, including altered thigmotaxis and reflexive responses. In contrast, embryos co‐exposed to As (120 μg/L as arsenite) and a higher concentration of Se (120 μg/L as selenite) also showed behavioral deficits; however, oxidative stress could not be confirmed as the underlying mechanism, as ROS production, although elevated, did not significantly differ from the control (no added As or Se). This discrepancy may be due to an insufficient sample size, limiting the statistical power to detect changes in ROS levels.

Interestingly, co‐exposure to As (120 μg/L as arsenite) and a low concentration of Se (2.5 μg/L as SeMet) appeared to mitigate As‐induced behavioral impairments. This protective effect may be attributed to the antioxidant properties of Se, as supported by significantly reduced ROS production relative to the As‐alone treatment. However, the observed behavioral rescue was not reflected at the molecular level, as the As‐induced suppression of antioxidant genes was not simultaneously ameliorated by co‐treatment with SeMet. An alternative explanation for the protective effect of low‐level Se (as SeMet) could be the formation of As‐Se complexes, such as seleno‐bis(S‐glutathionyl) arsinium ion ([(GS)₂AsSe]⁻), which may facilitate the detoxification and excretion of As from the organism [76]. These findings highlight the complex, dose‐dependent interactions between As and Se species in modulating oxidative stress and neurobehavioral outcomes in developing zebrafish.

Proper functioning of motor and dopaminergic neurons is essential for normal locomotor behavior, and disruptions in these systems are linked to various neurodegenerative disorders [77, 78, 79]. In the present study, zebrafish embryos exposed to As (120 μg/L as arsenite) exhibited significant downregulation of key dopaminergic genes (sncgb, robo2, and th1) and the motor neuron marker pax2a. These molecular alterations may underlie the observed impairment in locomotor activity. Furthermore, co‐exposure to As (120 μg/L) with Se in both inorganic (selenite at 25 and 120 μg/L) and organic (seleno‐l‐methionine, SeMet at 2.5 μg/L) forms also led to dysregulation of dopaminergic and motor neuron gene expression. Notably, despite these molecular disruptions, co‐exposure with low‐dose Se (2.5 μg/L as SeMet) ameliorated As‐induced behavioral deficits.

Serotonin (5‐HT) is a critical neurotransmitter in the CNS, involved in the regulation of mood, social behavior, and cognitive functions [12]. The serotonergic system operates through a complex network that governs serotonin synthesis, release, uptake, degradation, and receptor activity [80]. In the present study, zebrafish embryos exposed to As (120 μg/L as arsenite) exhibited significant dysregulation of key serotonergic genes, including tph2 and pet1, which are essential for serotonin synthesis and reuptake [33]. Additionally, genes associated with neurogenesis (ngn1, huc, and bdnf) were downregulated, suggesting that As exposure disrupts neural development and may contribute to the observed neurotoxicity. Co‐exposure to As with Se, either as selenite (25 and 120 μg/L) or seleno‐l‐methionine (SeMet, 2.5 μg/L), also resulted in downregulation of serotonergic and neurogenesis‐related genes, reinforcing the role of these molecular disruptions in As‐Se‐induced neurotoxicity. It is noteworthy that low‐level exposure to Se as SeMet significantly ameliorated both thigmotaxis and reflexive behavioral alterations induced by exposure to 120 μg/L As. However, the underlying mechanisms responsible for this protective effect remain unclear. Although ROS production was reduced under this co‐exposure scenario, the expression levels of key antioxidant genes, dopaminergic, motor, and serotonergic genes remained suppressed. This discrepancy suggests that cellular responses may not always align with transcriptional activity, possibly due to posttranscriptional regulatory mechanisms. These findings underscore the need for further investigations at the proteomic and functional levels to elucidate better the molecular pathways involved.

5. Conclusion

This study underscores the complex interplay between As and Se, leading to different neurobehavioral implications in zebrafish. The findings demonstrate that waterborne low‐dose Se, particularly in the form of SeMet, can effectively attenuate As‐induced neurotoxicity. None of the tested concentrations (As alone or co‐exposed with Se, either selenite or SeMet) significantly affected survival, hatching success, or morphological deformities of zebrafish larvae. Fluorescence intensity of ROS was elevated in groups exposed to As alone or combined with medium‐dose Se as selenite. However, higher concentrations of Se (as selenite) and low‐dose Se (as SeMet) significantly reduced ROS levels, highlighting Se's antioxidant potential when administered at appropriate doses and speciation. These results suggest that both organic and inorganic forms of Se can confer protective effects against As toxicity, though the efficacy is dose‐dependent and form‐specific. Further research is needed to elucidate the long‐term consequences of As‐Se co‐exposure in aquatic organisms. Such investigations will be critical for developing ecologically sound and effective regulatory strategies for managing As and Se contamination in aquatic systems.

Author Contributions

Owen Luo: conceptualization, methodology, investigation, data curation, formal analysis, visualization, and writing – original draft. Jinnath Rehana Ritu: formal analysis, writing – original draft, writing – review and editing. Md Helal Uddin: writing – original draft, writing – review and editing. Sravan Kumar Putnala: methodology, investigation, writing – review and editing. Mahesh Rachamalla: writing – review and editing. Som Niyogi: conceptualization, methodology, validation, funding acquisition, supervision, writing – review and editing. Douglas P. Chivers: conceptualization, methodology, validation, funding acquisition, supervision, writing – review and editing.

Funding

This work was supported by the Natural Sciences and Engineering Research Council of Canada, RGPIN 04597‐2024. Owen Luo was supported by University Graduate Scholarships (UGS) and Graduate Teaching Fellowships (GTF) at the University of Saskatchewan.

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Figure S1: (a) Hatching rate (%), (b) survival rate (%), and (c) deformity rate (%) of larval zebrafish exposed to selenium (Se) at 25 and 120 μg/L as selenite and 2.5 μg/L as selenomethionine with a constant Arsenic (As) of 120 μg/L (as arsenite) at 5 days postfertilization (n = 4/treatment).

Figure S2: Heatmaps representing the thigmotaxis behavior in zebrafish across different concentrations of arsenic (As) and selenium (Se). Warmer colors (red, yellow) represent regions where zebrafish spent more time. Cooler colors (blue) represent areas of less activity.

Figure S3: Heatmaps representing the reflexive response behavior in zebrafish across different concentrations of arsenic (As) and selenium (Se). Warmer colors (red, yellow) represent regions where zebrafish spent more time. Cooler colors (blue) represent areas of less activity.

Figure S4: Bar diagrams (mean ± SEM) showing the fold change in expression of different genes across treatment groups relative to the control group (*p < 0.05; **p < 0.01; ***p < 0.001).

TOX-41-1027-s001.docx^{(2.2MB, docx)}

Acknowledgments

This work was supported by the Discovery grants from the Natural Sciences and Engineering Research Council of Canada (NSERC) to Som Niyogi and Douglas P. Chivers. Owen Luo was supported by University Graduate Scholarships (UGS) and Graduate Teaching Fellowships (GTF) at the University of Saskatchewan.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

References

1. Abu Bakar N., Wan Ibrahim W. N., Che Abdullah C. A., et al., “Embryonic Arsenic Exposure Triggers Long‐Term Behavioral Impairment With Metabolite Alterations in Zebrafish,” Toxics 10, no. 9 (2022): 493, 10.3390/toxics10090493. [DOI] [PMC free article] [PubMed] [Google Scholar]
2. Smits J. E., Krohn R. M., Akhtar E., et al., “Food as Medicine: Selenium Enriched Lentils Offer Relief Against Chronic Arsenic Poisoning in Bangladesh,” Environmental Research 176 (2019): 108561, 10.1016/j.envres.2019.108561. [DOI] [PubMed] [Google Scholar]
3. Ali H., Khan E., and Ilahi I., “Environmental Chemistry and Ecotoxicology of Hazardous Heavy Metals: Environmental Persistence, Toxicity, and Bioaccumulation,” Journal of Chemistry 2019 (2019): 1–14, 10.1155/2019/6730305. [DOI] [Google Scholar]
4. Shaji E., Santosh M., Sarath K. V., Prakash P., Deepchand V., and Divya B. V., “Arsenic Contamination of Groundwater: A Global Synopsis With Focus on the Indian Peninsula,” Geoscience Frontiers 12, no. 3 (2021): 101079, 10.1016/j.gsf.2020.08.015. [DOI] [Google Scholar]
5. Rahman S. H., Khanam D., Adyel T. M., Islam M. S., Ahsan M. A., and Akbor M. A., “Assessment of Heavy Metal Contamination of Agricultural Soil Around Dhaka Export Processing Zone (DEPZ), Bangladesh: Implication of Seasonal Variation and Indices,” Applied Sciences 2, no. 3 (2012): 584–601, 10.3390/app2030584. [DOI] [Google Scholar]
6. Kapaj S., Peterson H., Liber K., and Bhattacharya P., “Human Health Effects From Chronic Arsenic Poisoning – A Review,” Journal of Environmental Science and Health, Part A 41, no. 10 (2006): 2399–2428, 10.1080/10934520600873571. [DOI] [PubMed] [Google Scholar]
7. Ratnaike R. N., “Acute and Chronic Arsenic Toxicity,” Postgraduate Medical Journal 79, no. 933 (2003): 391–396, 10.1136/pmj.79.933.391. [DOI] [PMC free article] [PubMed] [Google Scholar]
8. Yedjou C., Tchounwou P., Jenkins J., and McMurray R., “Basic Mechanisms of Arsenic Trioxide (ATO)‐Induced Apoptosis in Human Leukemia (HL‐60) Cells,” Journal of Hematology & Oncology 3, no. 1 (2010): 28, 10.1186/1756-8722-3-28. [DOI] [PMC free article] [PubMed] [Google Scholar]
9. Ramos‐Chávez L. A., Rendón‐López C. R., Zepeda A., Silva‐Adaya D., Del Razo L. M., and Gonsebatt M. E., “Neurological Effects of Inorganic Arsenic Exposure: Altered Cysteine/Glutamate Transport, NMDA Expression and Spatial Memory Impairment,” Frontiers in Cellular Neuroscience 9 (2015): 21, 10.3389/fncel.2015.00021. [DOI] [PMC free article] [PubMed] [Google Scholar]
10. Tyler C. R. and Allan A. M., “The Effects of Arsenic Exposure on Neurological and Cognitive Dysfunction in Human and Rodent Studies: A Review,” Current Environmental Health Reports 1 (2014): 132–147, 10.1007/s40572-014-0012-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
11. Rachamalla M., Salahinejad A., Khan M., Datusalia A. K., and Niyogi S., “Chronic Dietary Exposure to Arsenic at Environmentally Relevant Concentrations Impairs Cognitive Performance in Adult Zebrafish ( Danio rerio ) via Oxidative Stress and Dopaminergic Dysfunction,” Science of the Total Environment 886 (2023): 163771, 10.1016/j.scitotenv.2023.163771. [DOI] [PubMed] [Google Scholar]
12. Rachamalla M., da Silva Junior F. C., Hecker M., and Niyogi S., “Transgenerational Inheritance of Cognitive Deficits Induced by Ancestral Arsenic Exposure in Zebrafish ( Danio rerio ) via Maternal and Paternal Lineages,” Environmental Science & Technology 59 (2025): 9930–9942, 10.1021/acs.est.5c00409. [DOI] [PubMed] [Google Scholar]
13. Putnala S. K., Rachamalla M., and Niyogi S., “Neurodevelopmental and Behavioural Effects of Arsenic in Zebrafish ( Danio rerio ),” Aquatic Toxicology 289 (2025): 107566, 10.1016/j.aquatox.2025.107566. [DOI] [PubMed] [Google Scholar]
14. Putnala S. K., da Silva F. C., Luo O., Rachamalla M., and Niyogi S., “Reproductive Effects of Chronic Dietary Exposure to Arsenic‐Contaminated Oligochaetes in Zebrafish ( Danio rerio ),” Science of the Total Environment 1005 (2025): 180885, 10.1016/j.scitotenv.2025.180885. [DOI] [PubMed] [Google Scholar]
15. Rachamalla M., da Silva Junior F. C., Putnala S. K., Hecker M., and Niyogi S., “Maternal and Paternal Dietary Arsenic Exposure Impairs Reproduction and Development in Zebrafish Offspring: The Role of HPG Axis Dysregulation and Altered DNA Methylation,” Environmental Pollution 380 (2025): 126528, 10.1016/j.envpol.2025.126528. [DOI] [PubMed] [Google Scholar]
16. Rachamalla M., Salahinejad A., Kodzhahinchev V., and Niyogi S., “Reproductive and Developmental Effects of Sex‐Specific Chronic Exposure to Dietary Arsenic in Zebrafish (Danio rerio),” Toxics 12 (2024): 302, 10.3390/toxics12040302. [DOI] [PMC free article] [PubMed] [Google Scholar]
17. WHO , “Arsenic,” (2022), https://www.who.int/news‐room/fact‐sheets/detail/arsenic.
18. Jamwal A. and Niyogi S., “Dose and Chemical Species‐Specific Effects of Selenium Against Arsenite Toxicity in Cultured Hepatocytes of Rainbow Trout ( Oncorhynchus mykiss ),” Metallomics 9, no. 6 (2017): 744–756, 10.1039/C7MT00006E. [DOI] [PubMed] [Google Scholar]
19. Selvaraj V., Yeager‐Armstead M., and Murray E., “Protective and Antioxidant Role of Selenium on Arsenic Trioxide–Induced Oxidative Stress and Genotoxicity in the Fish Hepatoma Cell Line PLHC‐1,” Environmental Toxicology and Chemistry 31, no. 12 (2012): 2861–2869, 10.1002/etc.2022. [DOI] [PubMed] [Google Scholar]
20. Eisler R., “Handbook of Chemical Risk Assessment: Health Hazards to Humans, Plants, and Animals,” in Three Volume Set, 1st ed. (CRC Press, 2000), 10.1201/9780367801397. [DOI] [Google Scholar]
21. Kang D., Lee J., Wu C., et al., “The Role of Selenium Metabolism and Selenoproteins in Cartilage Homeostasis and Arthropathies,” Experimental & Molecular Medicine 52, no. 8 (2020): 1198–1208, 10.1038/s12276-020-0408-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
22. Turrubiates‐Hernández F. J., Márquez‐Sandoval Y. F., González‐Estevez G., Reyes‐Castillo Z., and Muñoz‐Valle J. F., “The Relevance of Selenium Status in Rheumatoid Arthritis,” Nutrients 12, no. 10 (2020): 3007, 10.3390/nu12103007. [DOI] [PMC free article] [PubMed] [Google Scholar]
23. Uddin M. H., Ritu J. R., Putnala S. K., Rachamalla M., Chivers D. P., and Niyogi S., “Selenium Toxicity in Fishes: A Current Perspective,” Chemosphere 364 (2024): 143214, 10.1016/j.chemosphere.2024.143214. [DOI] [PubMed] [Google Scholar]
24. Zhao G., Hu J., Gao M., Zhu Y., and Hong Y., “Excessive Selenium Affects Neural Development and Locomotor Behavior of Zebrafish Embryos,” Ecotoxicology and Environmental Safety 238 (2022): 113611, 10.1016/j.ecoenv.2022.113611. [DOI] [PubMed] [Google Scholar]
25. Janz D. M., DeForest D. K., Brooks M. L., et al., “Selenium Toxicity to Aquatic Organisms,” in Ecological Assessment of Selenium in the Aquatic Environment, ed. Chapman P. M., Adams W. J., Brooks M. L., et al. (Society of Environmental Toxicology and Chemistry (SETAC), 2010), 139–230. [Google Scholar]
26. Staicu L. C., van Hullebusch E. D., Rittmann B. E., and Lens P. N. L., “Industrial Selenium Pollution: Sources and Biological Treatment Technologies,” in Bioremediation of Selenium Contaminated Wastewater, ed. van Hullebusch E. D. (Springer International Publishing, 2017), 75–101, 10.1007/978-3-319-57831-6_4. [DOI] [Google Scholar]
27. He Y., Xiang Y., Zhou Y., et al., “Selenium Contamination, Consequences and Remediation Techniques in Water and Soils: A Review,” Environmental Research 164 (2018): 288–301, 10.1016/j.envres.2018.02.037. [DOI] [PubMed] [Google Scholar]
28. Hariharan S., Chauhan S., Marcharla E., Alphonse C. R. W., Rajaretinam R. K., and Ganesan S., “Developmental Toxicity and Neurobehavioral Effects of Sodium Selenite and Selenium Nanoparticles on Zebrafish Embryos,” Aquatic Toxicology 266 (2024): 106791, 10.1016/j.aquatox.2023.106791. [DOI] [PubMed] [Google Scholar]
29. Lin Y., Hu L., Li X., et al., “The Beneficial and Toxic Effects of Selenium on Zebrafish. A Systematic Review of the Literature,” Toxicology Research 13, no. 2 (2024): tfae062, 10.1093/toxres/tfae062. [DOI] [PMC free article] [PubMed] [Google Scholar]
30. Attaran A., Salahinejad A., Naderi M., Crane A. L., Niyogi S., and Chivers D. P., “Effects of Chronic Exposure to Selenomethionine on Social Learning Outcomes in Zebrafish (Danio rerio): Serotonergic Dysregulation and Oxidative Stress in the Brain,” Chemosphere 247 (2020): 125898, 10.1016/j.chemosphere.2020.125898. [DOI] [PubMed] [Google Scholar]
31. Attaran A., Salahinejad A., Crane A. L., Niyogi S., and Chivers D. P., “Chronic Exposure to Dietary Selenomethionine Dysregulates the Genes Involved in Serotonergic Neurotransmission and Alters Social and Antipredator Behaviours in Zebrafish (Danio rerio),” Environmental Pollution 246 (2019): 837–844, 10.1016/j.envpol.2018.12.090. [DOI] [PubMed] [Google Scholar]
32. Naderi M., Salahinejad A., Jamwal A., Chivers D. P., and Niyogi S., “Chronic Dietary Selenomethionine Exposure Induces Oxidative Stress, Dopaminergic Dysfunction, and Cognitive Impairment in Adult Zebrafish ( Danio rerio ),” Environmental Science & Technology 51, no. 21 (2017): 12879–12888, 10.1021/acs.est.7b03937. [DOI] [PubMed] [Google Scholar]
33. Uddin M. H., Ritu J. R., Chivers D. P., and Niyogi S., “Neurodevelopmental and Behavioural Effects of Waterborne Selenite in Larval Zebrafish (Danio rerio),” Environmental Research 273 (2025): 121240, 10.1016/j.envres.2025.121240. [DOI] [PubMed] [Google Scholar]
34. Uddin M. H., Salvador C., Ritu J. R., Putnala S. K., Chivers D. P., and Niyogi S., “Selenomethionine‐Induced Neurotoxicity and Behavioural Alterations in Larval Zebrafish ( Danio rerio ),” Ecotoxicology and Environmental Safety 303 (2025): 118788, 10.1016/j.ecoenv.2025.118788. [DOI] [PubMed] [Google Scholar]
35. Jamwal A., Saibu Y., MacDonald T. C., George G. N., and Niyogi S., “The Effects of Dietary Selenomethionine on Tissue‐Specific Accumulation and Toxicity of Dietary Arsenite in Rainbow Trout (Oncorhynchus mykiss) During Chronic Exposure,” Metallomics 11, no. 3 (2019): 643–655, 10.1039/c8mt00309b. [DOI] [PubMed] [Google Scholar]
36. Zeng H., Uthus E. O., and G. F. Combs, Jr. , “Mechanistic Aspects of the Interaction Between Selenium and Arsenic,” Journal of Inorganic Biochemistry 99, no. 6 (2005): 1269–1274, 10.1016/j.jinorgbio.2005.03.006. [DOI] [PubMed] [Google Scholar]
37. Zwolak I. and Zaporowska H., “Selenium Interactions and Toxicity: A Review. Selenium Interactions and Toxicity,” Cell Biology and Toxicology 28, no. 1 (2012): 31–46, 10.1007/s10565-011-9203-9. [DOI] [PubMed] [Google Scholar]
38. Davis C. D., Uthus E. O., and Finley J. W., “Dietary Selenium and Arsenic Affect DNA Methylation In Vitro in Caco‐2 Cells and In Vivo in Rat Liver and Colon,” Journal of Nutrition 130, no. 12 (2000): 2903–2909, 10.1093/jn/130.12.2903. [DOI] [PubMed] [Google Scholar]
39. Levander O. A., “Metabolic Interrelationships Between Arsenic and Selenium,” Environmental Health Perspectives 19 (1977): 159–164, 10.1289/ehp.7719159. [DOI] [PMC free article] [PubMed] [Google Scholar]
40. McIntyre D. O. and Linton T. K., “Arsenic,” in Fish Physiology, vol. 31 (Elsevier, 2011), 297–349, 10.1016/S1546-5098(11)31028-X. [DOI] [Google Scholar]
41. Adedara I. A., Fabunmi A. T., Ayenitaju F. C., et al., “Neuroprotective Mechanisms of Selenium Against Arsenic‐Induced Behavioral Impairments in Rats,” Neurotoxicology 76 (2020): 99–110, 10.1016/j.neuro.2019.10.009. [DOI] [PubMed] [Google Scholar]
42. Bai A.‐M., Li Q., Li Y., et al., “Investigation Into Environmental Selenium and Arsenic Levels and Arseniasis Prevalence in an Arsenic‐Affected Coal‐Burning Area,” Frontiers in Nutrition 9 (2022): 922481, 10.3389/fnut.2022.922481. [DOI] [PMC free article] [PubMed] [Google Scholar]
43. Cai Z., Zhang Y., Zhang W., et al., “Arsenic Retention in Erythrocytes and Excessive Erythrophagocytosis Is Related to Low Selenium Status by Impaired Redox Homeostasis,” Redox Biology 52 (2022): 102321, 10.1016/j.redox.2022.102321. [DOI] [PMC free article] [PubMed] [Google Scholar]
44. Cheng B.‐J., Sheng J., Wang H.‐L., et al., “Selenium Attenuates the Association of Co‐Exposure to Arsenic, Cadmium, and Lead With Cognitive Function Among Chinese Community‐Dwelling Older Adults,” Environmental Science and Pollution Research 30, no. 13 (2022): 36377–36391, 10.1007/s11356-022-24783-y. [DOI] [PubMed] [Google Scholar]
45. Ren Z., Deng H., Deng Y., et al., “Effects of Selenium on Arsenic‐Induced Liver Lesions in Broilers,” Biological Trace Element Research 199, no. 3 (2021): 1080–1089, 10.1007/s12011-020-02222-8. [DOI] [PubMed] [Google Scholar]
46. Ren Z., Wu Q., Deng H., et al., “Effects of Selenium on the Immunotoxicity of Subacute Arsenic Poisoning in Chickens,” Biological Trace Element Research 199, no. 11 (2021): 4260–4272, 10.1007/s12011-020-02558-1. [DOI] [PubMed] [Google Scholar]
47. Fitzgerald J. A., Könemann S., Krümpelmann L., Županič A., and Vom Berg C., “Approaches to Test the Neurotoxicity of Environmental Contaminants in the Zebrafish Model: From Behavior to Molecular Mechanisms,” Environmental Toxicology and Chemistry 40, no. 4 (2021): 989–1006, 10.1002/etc.4951. [DOI] [PubMed] [Google Scholar]
48. Panula P., Chen Y.‐C., Priyadarshini M., et al., “The Comparative Neuroanatomy and Neurochemistry of Zebrafish CNS Systems of Relevance to Human Neuropsychiatric Diseases,” Neurobiology of Disease 40, no. 1 (2010): 46–57, 10.1016/j.nbd.2010.05.010. [DOI] [PubMed] [Google Scholar]
49. Zhu Y., Yang Q., Gu J., et al., ““Environmental Standard Limit Concentration” Arsenic Exposure Is Associated With Anxiety, Depression, and Autism‐Like Changes in Early‐Life Stage Zebrafish,” Journal of Hazardous Materials 469 (2024): 133953, 10.1016/j.jhazmat.2024.133953. [DOI] [PubMed] [Google Scholar]
50. Arnold M. C., Forte J. E., Osterberg J. S., and Di Giulio R. T., “Antioxidant Rescue of Selenomethionine‐Induced Teratogenesis in Zebrafish Embryos,” Archives of Environmental Contamination and Toxicology 70 (2016): 311–320, 10.1007/s00244-015-0235-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
51. Han S., Fei F., Sun S., et al., “Increased Anxiety Was Found in serpini1 Knockout Zebrafish Larval,” Biochemical and Biophysical Research Communications 534 (2021): 1013–1019, 10.1016/j.bbrc.2020.10.048. [DOI] [PubMed] [Google Scholar]
52. Merola C., Lucon‐Xiccato T., Bertolucci C., and Perugini M., “Behavioural Effects of Early‐Life Exposure to Parabens in Zebrafish Larvae,” Journal of Applied Toxicology 41, no. 11 (2021): 1852–1862, 10.1002/jat.4171. [DOI] [PubMed] [Google Scholar]
53. Irons T. D., MacPhail R. C., Hunter D. L., and Padilla S., “Acute Neuroactive Drug Exposures Alter Locomotor Activity in Larval Zebrafish,” Neurotoxicology and Teratology 32, no. 1 (2010): 84–90, 10.1016/j.ntt.2009.04.066. [DOI] [PubMed] [Google Scholar]
54. Xu Y., Peng T., Xiang Y., Liao G., Zou F., and Meng X., “Neurotoxicity and Gene Expression Alterations in Zebrafish Larvae in Response to Manganese Exposure,” Science of the Total Environment 825 (2022): 153778, 10.1016/j.scitotenv.2022.153778. [DOI] [PubMed] [Google Scholar]
55. Yang X., Wang X., Gao D., et al., “Developmental Toxicity Caused by Sanguinarine in Zebrafish Embryos via Regulating Oxidative Stress, Apoptosis and wnt Pathways,” Toxicology Letters 350 (2021): 71–80, 10.1016/j.toxlet.2021.07.001. [DOI] [PubMed] [Google Scholar]
56. Casadei R., Pelleri M. C., Vitale L., et al., “Identification of Housekeeping Genes Suitable for Gene Expression Analysis in the Zebrafish,” Gene Expression Patterns 11, no. 3–4 (2011): 271–276, 10.1016/j.gep.2011.01.003. [DOI] [PubMed] [Google Scholar]
57. Livak K. J. and Schmittgen T. D., “Analysis of Relative Gene Expression Data Using Real‐Time Quantitative PCR and the 2^−ΔΔCT Method,” Methods 25, no. 4 (2001): 402–408, 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
58. Babich H., Martin‐Alguacil N., and Borenfreund E., “Arsenic‐Selenium Interactions Determined With Cultured Fish Cells,” Toxicology Letters 45, no. 2–3 (1989): 157–164, 10.1016/0378-4274(89)90005-2. [DOI] [PubMed] [Google Scholar]
59. Attaran A., Salahinejad A., Naderi M., Crane A. L., Chivers D. P., and Niyogi S., “Transgenerational Effects of Selenomethionine on Behaviour, Social Cognition, and the Expression of Genes in the Serotonergic Pathway in Zebrafish,” Environmental Pollution 286 (2021): 117289, 10.1016/j.envpol.2021.117289. [DOI] [PubMed] [Google Scholar]
60. Naderi M., Ferrari M. C. O., Chivers D. P., and Niyogi S., “Maternal Exposure to Dietary Selenium Causes Dopaminergic Hyperfunction and Cognitive Impairment in Zebrafish Offspring,” Environmental Science & Technology 52, no. 22 (2018): 13574–13583, 10.1021/acs.est.8b04768. [DOI] [PubMed] [Google Scholar]
61. Piyushbhai M. K., Binesh A., Shanmugam S. A., and Venkatachalam K., “Exposure to Low‐Dose Arsenic Caused Teratogenicity and Upregulation of Proinflammatory Cytokines in Zebrafish Embryos,” Biological Trace Element Research 201 (2023): 3487–3496, 10.1007/s12011-022-03418-w. [DOI] [PubMed] [Google Scholar]
62. Li D., Lua C., Wang J., et al., “Developmental Mechanisms of Arsenite Toxicity in Zebrafish (Danio rerio) Embryos,” Aquatic Toxicology 91 (2009): 229–237, 10.1016/j.aquatox.2008.11.007. [DOI] [PubMed] [Google Scholar]
63. Kane M. J., Hambrick D. Z., and Conway A. R. A., “Working Memory Capacity and Fluid Intelligence Are Strongly Related Constructs: Comment on Ackerman, Beier, and Boyle (2005),” Psychological Bulletin 131, no. 1 (2005): 66–71, 10.1037/0033-2909.131.1.66. [DOI] [PubMed] [Google Scholar]
64. Tierney K. B., “Behavioural Assessments of Neurotoxic Effects and Neurodegeneration in Zebrafish,” Biochimica et Biophysica Acta (BBA) ‐ Molecular Basis of Disease 1812, no. 3 (2011): 381–389, 10.1016/j.bbadis.2010.10.011. [DOI] [PubMed] [Google Scholar]
65. Chen L., Huang C., Hu C., Yu K., Yang L., and Zhou B., “Acute Exposure to DE‐71: Effects on Locomotor Behavior and Developmental Neurotoxicity in Zebrafish Larvae,” Environmental Toxicology and Chemistry 31, no. 10 (2012): 2338–2344, 10.1002/etc.1958. [DOI] [PubMed] [Google Scholar]
66. Chen L., Yu K., Huang C., et al., “Prenatal Transfer of Polybrominated Diphenyl Ethers (PBDEs) Results in Developmental Neurotoxicity in Zebrafish Larvae,” Environmental Science & Technology 46, no. 17 (2012): 9727–9734, 10.1021/es302119g. [DOI] [PubMed] [Google Scholar]
67. Sloman K. A. and McNeil P. L., “Using Physiology and Behaviour to Understand the Responses of Fish Early Life Stages to Toxicants,” Journal of Fish Biology 81, no. 7 (2012): 2175–2198, 10.1111/j.1095-8649.2012.03435.x. [DOI] [PubMed] [Google Scholar]
68. Wang W., Wang B., Liu Z., and Xia X., “Developmental Toxicity and Alteration of Gene Expression in Zebrafish Embryo Exposed to 6‐Benzylaminopurine,” Chemosphere 233 (2019): 336–346, 10.1016/j.chemosphere.2019.05.261. [DOI] [PubMed] [Google Scholar]
69. Wang Y. H., Wang Y. K., Yu X. G., et al., “Chronic Environmental Inorganic Arsenic Exposure Causes Social Behavioral Changes in Juvenile Zebrafish (Danio rerio),” Science of the Total Environment 867 (2023): 161296, 10.1016/j.scitotenv.2022.161296. [DOI] [PubMed] [Google Scholar]
70. Baldissarelli L. A., Capiotti K. M., Bogo M. R., Ghisleni G., and Bonan C. D., “Arsenic Alters Behavioral Parameters and Brain Ectonucleotidases Activities in Zebrafish ( Danio rerio ),” Comparative Biochemistry and Physiology, Part C 155 (2012): 566–572, 10.1016/j.cbpc.2012.01.006. [DOI] [PubMed] [Google Scholar]
71. Canadian Council of Ministers of the Environment , “Canadian Water Quality Guidelines for the Protection of Aquatic Life: Guidance on the Site‐Specific Application of Water Quality Guideline in Canada: Procedures for Deriving Numerical Water Quality Objectives,” in Canadian Environmental Quality Guidelines, 1999 (Canadian Council of Ministers of the Environment, 2003). [Google Scholar]
72. US EPA, O , “National Recommended Water Quality Criteria—Aquatic Life Criteria Table [Data and Tools],” (2015), https://www.epa.gov/wqc/national‐recommended‐water‐quality‐criteria‐aquatic‐life‐criteria‐table.
73. Sayre L. M., Perry G., and Smith M. A., “Oxidative Stress and Neurotoxicity,” Chemical Research in Toxicology 21, no. 1 (2008): 172–188, 10.1021/tx700210j. [DOI] [PubMed] [Google Scholar]
74. Félix L. M., Vidal A. M., Serafim C., et al., “Ketamine‐Induced Oxidative Stress at Different Developmental Stages of Zebrafish (Danio rerio) Embryos,” RSC Advances 6, no. 66 (2016): 61254–61266, 10.1039/C6RA08298J. [DOI] [Google Scholar]
75. Sun H. J., Zhang J. Y., Wang Q., et al., “Environmentally Relevant Concentrations of Arsenite Induces Developmental Toxicity and Oxidative Responses in the Early Life Stage of Zebrafish,” Environmental Pollution 254 (2019), 10.1016/j.envpol.2019.113022. [DOI] [PubMed] [Google Scholar]
76. Gailer J., George G. N., Pickering I. J., et al., “A Metabolic Link Between Arsenite and Selenite: The Seleno‐Bis(S‐ Glutathionyl) Arsinium Ion,” Journal of the American Chemical Society 122 (2000): 4637–4639. [Google Scholar]
77. Karam C., Scelsa S. N., and MacGowan D. J. L., “The Clinical Course of Progressive Bulbar Palsy,” Amyotrophic Lateral Sclerosis 11, no. 4 (2010): 364–368, 10.3109/17482960903513159. [DOI] [PubMed] [Google Scholar]
78. Rowland L. P. and Shneider N. A., “Amyotrophic Lateral Sclerosis,” New England Journal of Medicine 344, no. 22 (2001): 1688–1700, 10.1056/NEJM200105313442207. [DOI] [PubMed] [Google Scholar]
79. Singer M. A., Statland J. M., Wolfe G. I., and Barohn R. J., “Primary Lateral Sclerosis,” Muscle & Nerve 35, no. 3 (2007): 291–302, 10.1002/mus.20728. [DOI] [PubMed] [Google Scholar]
80. Sahu A., Gopalakrishnan L., Gaur N., et al., “The 5‐Hydroxytryptamine Signaling Map: An Overview of Serotonin‐Serotonin Receptor Mediated Signaling Network,” Journal of Cell Communication and Signaling 12, no. 4 (2018): 731–735, 10.1007/s12079-018-0482-2. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S4: Bar diagrams (mean ± SEM) showing the fold change in expression of different genes across treatment groups relative to the control group (*p < 0.05; **p < 0.01; ***p < 0.001).

TOX-41-1027-s001.docx^{(2.2MB, docx)}

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

[tox70048-bib-0001] 1. Abu Bakar N., Wan Ibrahim W. N., Che Abdullah C. A., et al., “Embryonic Arsenic Exposure Triggers Long‐Term Behavioral Impairment With Metabolite Alterations in Zebrafish,” Toxics 10, no. 9 (2022): 493, 10.3390/toxics10090493. [DOI] [PMC free article] [PubMed] [Google Scholar]

[tox70048-bib-0002] 2. Smits J. E., Krohn R. M., Akhtar E., et al., “Food as Medicine: Selenium Enriched Lentils Offer Relief Against Chronic Arsenic Poisoning in Bangladesh,” Environmental Research 176 (2019): 108561, 10.1016/j.envres.2019.108561. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0003] 3. Ali H., Khan E., and Ilahi I., “Environmental Chemistry and Ecotoxicology of Hazardous Heavy Metals: Environmental Persistence, Toxicity, and Bioaccumulation,” Journal of Chemistry 2019 (2019): 1–14, 10.1155/2019/6730305. [DOI] [Google Scholar]

[tox70048-bib-0004] 4. Shaji E., Santosh M., Sarath K. V., Prakash P., Deepchand V., and Divya B. V., “Arsenic Contamination of Groundwater: A Global Synopsis With Focus on the Indian Peninsula,” Geoscience Frontiers 12, no. 3 (2021): 101079, 10.1016/j.gsf.2020.08.015. [DOI] [Google Scholar]

[tox70048-bib-0005] 5. Rahman S. H., Khanam D., Adyel T. M., Islam M. S., Ahsan M. A., and Akbor M. A., “Assessment of Heavy Metal Contamination of Agricultural Soil Around Dhaka Export Processing Zone (DEPZ), Bangladesh: Implication of Seasonal Variation and Indices,” Applied Sciences 2, no. 3 (2012): 584–601, 10.3390/app2030584. [DOI] [Google Scholar]

[tox70048-bib-0006] 6. Kapaj S., Peterson H., Liber K., and Bhattacharya P., “Human Health Effects From Chronic Arsenic Poisoning – A Review,” Journal of Environmental Science and Health, Part A 41, no. 10 (2006): 2399–2428, 10.1080/10934520600873571. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0007] 7. Ratnaike R. N., “Acute and Chronic Arsenic Toxicity,” Postgraduate Medical Journal 79, no. 933 (2003): 391–396, 10.1136/pmj.79.933.391. [DOI] [PMC free article] [PubMed] [Google Scholar]

[tox70048-bib-0008] 8. Yedjou C., Tchounwou P., Jenkins J., and McMurray R., “Basic Mechanisms of Arsenic Trioxide (ATO)‐Induced Apoptosis in Human Leukemia (HL‐60) Cells,” Journal of Hematology & Oncology 3, no. 1 (2010): 28, 10.1186/1756-8722-3-28. [DOI] [PMC free article] [PubMed] [Google Scholar]

[tox70048-bib-0009] 9. Ramos‐Chávez L. A., Rendón‐López C. R., Zepeda A., Silva‐Adaya D., Del Razo L. M., and Gonsebatt M. E., “Neurological Effects of Inorganic Arsenic Exposure: Altered Cysteine/Glutamate Transport, NMDA Expression and Spatial Memory Impairment,” Frontiers in Cellular Neuroscience 9 (2015): 21, 10.3389/fncel.2015.00021. [DOI] [PMC free article] [PubMed] [Google Scholar]

[tox70048-bib-0010] 10. Tyler C. R. and Allan A. M., “The Effects of Arsenic Exposure on Neurological and Cognitive Dysfunction in Human and Rodent Studies: A Review,” Current Environmental Health Reports 1 (2014): 132–147, 10.1007/s40572-014-0012-1. [DOI] [PMC free article] [PubMed] [Google Scholar]

[tox70048-bib-0011] 11. Rachamalla M., Salahinejad A., Khan M., Datusalia A. K., and Niyogi S., “Chronic Dietary Exposure to Arsenic at Environmentally Relevant Concentrations Impairs Cognitive Performance in Adult Zebrafish ( Danio rerio ) via Oxidative Stress and Dopaminergic Dysfunction,” Science of the Total Environment 886 (2023): 163771, 10.1016/j.scitotenv.2023.163771. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0012] 12. Rachamalla M., da Silva Junior F. C., Hecker M., and Niyogi S., “Transgenerational Inheritance of Cognitive Deficits Induced by Ancestral Arsenic Exposure in Zebrafish ( Danio rerio ) via Maternal and Paternal Lineages,” Environmental Science & Technology 59 (2025): 9930–9942, 10.1021/acs.est.5c00409. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0013] 13. Putnala S. K., Rachamalla M., and Niyogi S., “Neurodevelopmental and Behavioural Effects of Arsenic in Zebrafish ( Danio rerio ),” Aquatic Toxicology 289 (2025): 107566, 10.1016/j.aquatox.2025.107566. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0014] 14. Putnala S. K., da Silva F. C., Luo O., Rachamalla M., and Niyogi S., “Reproductive Effects of Chronic Dietary Exposure to Arsenic‐Contaminated Oligochaetes in Zebrafish ( Danio rerio ),” Science of the Total Environment 1005 (2025): 180885, 10.1016/j.scitotenv.2025.180885. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0015] 15. Rachamalla M., da Silva Junior F. C., Putnala S. K., Hecker M., and Niyogi S., “Maternal and Paternal Dietary Arsenic Exposure Impairs Reproduction and Development in Zebrafish Offspring: The Role of HPG Axis Dysregulation and Altered DNA Methylation,” Environmental Pollution 380 (2025): 126528, 10.1016/j.envpol.2025.126528. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0016] 16. Rachamalla M., Salahinejad A., Kodzhahinchev V., and Niyogi S., “Reproductive and Developmental Effects of Sex‐Specific Chronic Exposure to Dietary Arsenic in Zebrafish (Danio rerio),” Toxics 12 (2024): 302, 10.3390/toxics12040302. [DOI] [PMC free article] [PubMed] [Google Scholar]

[tox70048-bib-0017] 17. WHO , “Arsenic,” (2022), https://www.who.int/news‐room/fact‐sheets/detail/arsenic.

[tox70048-bib-0018] 18. Jamwal A. and Niyogi S., “Dose and Chemical Species‐Specific Effects of Selenium Against Arsenite Toxicity in Cultured Hepatocytes of Rainbow Trout ( Oncorhynchus mykiss ),” Metallomics 9, no. 6 (2017): 744–756, 10.1039/C7MT00006E. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0019] 19. Selvaraj V., Yeager‐Armstead M., and Murray E., “Protective and Antioxidant Role of Selenium on Arsenic Trioxide–Induced Oxidative Stress and Genotoxicity in the Fish Hepatoma Cell Line PLHC‐1,” Environmental Toxicology and Chemistry 31, no. 12 (2012): 2861–2869, 10.1002/etc.2022. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0020] 20. Eisler R., “Handbook of Chemical Risk Assessment: Health Hazards to Humans, Plants, and Animals,” in Three Volume Set, 1st ed. (CRC Press, 2000), 10.1201/9780367801397. [DOI] [Google Scholar]

[tox70048-bib-0021] 21. Kang D., Lee J., Wu C., et al., “The Role of Selenium Metabolism and Selenoproteins in Cartilage Homeostasis and Arthropathies,” Experimental & Molecular Medicine 52, no. 8 (2020): 1198–1208, 10.1038/s12276-020-0408-y. [DOI] [PMC free article] [PubMed] [Google Scholar]

[tox70048-bib-0022] 22. Turrubiates‐Hernández F. J., Márquez‐Sandoval Y. F., González‐Estevez G., Reyes‐Castillo Z., and Muñoz‐Valle J. F., “The Relevance of Selenium Status in Rheumatoid Arthritis,” Nutrients 12, no. 10 (2020): 3007, 10.3390/nu12103007. [DOI] [PMC free article] [PubMed] [Google Scholar]

[tox70048-bib-0023] 23. Uddin M. H., Ritu J. R., Putnala S. K., Rachamalla M., Chivers D. P., and Niyogi S., “Selenium Toxicity in Fishes: A Current Perspective,” Chemosphere 364 (2024): 143214, 10.1016/j.chemosphere.2024.143214. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0024] 24. Zhao G., Hu J., Gao M., Zhu Y., and Hong Y., “Excessive Selenium Affects Neural Development and Locomotor Behavior of Zebrafish Embryos,” Ecotoxicology and Environmental Safety 238 (2022): 113611, 10.1016/j.ecoenv.2022.113611. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0025] 25. Janz D. M., DeForest D. K., Brooks M. L., et al., “Selenium Toxicity to Aquatic Organisms,” in Ecological Assessment of Selenium in the Aquatic Environment, ed. Chapman P. M., Adams W. J., Brooks M. L., et al. (Society of Environmental Toxicology and Chemistry (SETAC), 2010), 139–230. [Google Scholar]

[tox70048-bib-0026] 26. Staicu L. C., van Hullebusch E. D., Rittmann B. E., and Lens P. N. L., “Industrial Selenium Pollution: Sources and Biological Treatment Technologies,” in Bioremediation of Selenium Contaminated Wastewater, ed. van Hullebusch E. D. (Springer International Publishing, 2017), 75–101, 10.1007/978-3-319-57831-6_4. [DOI] [Google Scholar]

[tox70048-bib-0027] 27. He Y., Xiang Y., Zhou Y., et al., “Selenium Contamination, Consequences and Remediation Techniques in Water and Soils: A Review,” Environmental Research 164 (2018): 288–301, 10.1016/j.envres.2018.02.037. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0028] 28. Hariharan S., Chauhan S., Marcharla E., Alphonse C. R. W., Rajaretinam R. K., and Ganesan S., “Developmental Toxicity and Neurobehavioral Effects of Sodium Selenite and Selenium Nanoparticles on Zebrafish Embryos,” Aquatic Toxicology 266 (2024): 106791, 10.1016/j.aquatox.2023.106791. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0029] 29. Lin Y., Hu L., Li X., et al., “The Beneficial and Toxic Effects of Selenium on Zebrafish. A Systematic Review of the Literature,” Toxicology Research 13, no. 2 (2024): tfae062, 10.1093/toxres/tfae062. [DOI] [PMC free article] [PubMed] [Google Scholar]

[tox70048-bib-0030] 30. Attaran A., Salahinejad A., Naderi M., Crane A. L., Niyogi S., and Chivers D. P., “Effects of Chronic Exposure to Selenomethionine on Social Learning Outcomes in Zebrafish (Danio rerio): Serotonergic Dysregulation and Oxidative Stress in the Brain,” Chemosphere 247 (2020): 125898, 10.1016/j.chemosphere.2020.125898. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0031] 31. Attaran A., Salahinejad A., Crane A. L., Niyogi S., and Chivers D. P., “Chronic Exposure to Dietary Selenomethionine Dysregulates the Genes Involved in Serotonergic Neurotransmission and Alters Social and Antipredator Behaviours in Zebrafish (Danio rerio),” Environmental Pollution 246 (2019): 837–844, 10.1016/j.envpol.2018.12.090. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0032] 32. Naderi M., Salahinejad A., Jamwal A., Chivers D. P., and Niyogi S., “Chronic Dietary Selenomethionine Exposure Induces Oxidative Stress, Dopaminergic Dysfunction, and Cognitive Impairment in Adult Zebrafish ( Danio rerio ),” Environmental Science & Technology 51, no. 21 (2017): 12879–12888, 10.1021/acs.est.7b03937. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0033] 33. Uddin M. H., Ritu J. R., Chivers D. P., and Niyogi S., “Neurodevelopmental and Behavioural Effects of Waterborne Selenite in Larval Zebrafish (Danio rerio),” Environmental Research 273 (2025): 121240, 10.1016/j.envres.2025.121240. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0034] 34. Uddin M. H., Salvador C., Ritu J. R., Putnala S. K., Chivers D. P., and Niyogi S., “Selenomethionine‐Induced Neurotoxicity and Behavioural Alterations in Larval Zebrafish ( Danio rerio ),” Ecotoxicology and Environmental Safety 303 (2025): 118788, 10.1016/j.ecoenv.2025.118788. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0035] 35. Jamwal A., Saibu Y., MacDonald T. C., George G. N., and Niyogi S., “The Effects of Dietary Selenomethionine on Tissue‐Specific Accumulation and Toxicity of Dietary Arsenite in Rainbow Trout (Oncorhynchus mykiss) During Chronic Exposure,” Metallomics 11, no. 3 (2019): 643–655, 10.1039/c8mt00309b. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0036] 36. Zeng H., Uthus E. O., and G. F. Combs, Jr. , “Mechanistic Aspects of the Interaction Between Selenium and Arsenic,” Journal of Inorganic Biochemistry 99, no. 6 (2005): 1269–1274, 10.1016/j.jinorgbio.2005.03.006. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0037] 37. Zwolak I. and Zaporowska H., “Selenium Interactions and Toxicity: A Review. Selenium Interactions and Toxicity,” Cell Biology and Toxicology 28, no. 1 (2012): 31–46, 10.1007/s10565-011-9203-9. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0038] 38. Davis C. D., Uthus E. O., and Finley J. W., “Dietary Selenium and Arsenic Affect DNA Methylation In Vitro in Caco‐2 Cells and In Vivo in Rat Liver and Colon,” Journal of Nutrition 130, no. 12 (2000): 2903–2909, 10.1093/jn/130.12.2903. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0039] 39. Levander O. A., “Metabolic Interrelationships Between Arsenic and Selenium,” Environmental Health Perspectives 19 (1977): 159–164, 10.1289/ehp.7719159. [DOI] [PMC free article] [PubMed] [Google Scholar]

[tox70048-bib-0040] 40. McIntyre D. O. and Linton T. K., “Arsenic,” in Fish Physiology, vol. 31 (Elsevier, 2011), 297–349, 10.1016/S1546-5098(11)31028-X. [DOI] [Google Scholar]

[tox70048-bib-0041] 41. Adedara I. A., Fabunmi A. T., Ayenitaju F. C., et al., “Neuroprotective Mechanisms of Selenium Against Arsenic‐Induced Behavioral Impairments in Rats,” Neurotoxicology 76 (2020): 99–110, 10.1016/j.neuro.2019.10.009. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0042] 42. Bai A.‐M., Li Q., Li Y., et al., “Investigation Into Environmental Selenium and Arsenic Levels and Arseniasis Prevalence in an Arsenic‐Affected Coal‐Burning Area,” Frontiers in Nutrition 9 (2022): 922481, 10.3389/fnut.2022.922481. [DOI] [PMC free article] [PubMed] [Google Scholar]

[tox70048-bib-0043] 43. Cai Z., Zhang Y., Zhang W., et al., “Arsenic Retention in Erythrocytes and Excessive Erythrophagocytosis Is Related to Low Selenium Status by Impaired Redox Homeostasis,” Redox Biology 52 (2022): 102321, 10.1016/j.redox.2022.102321. [DOI] [PMC free article] [PubMed] [Google Scholar]

[tox70048-bib-0044] 44. Cheng B.‐J., Sheng J., Wang H.‐L., et al., “Selenium Attenuates the Association of Co‐Exposure to Arsenic, Cadmium, and Lead With Cognitive Function Among Chinese Community‐Dwelling Older Adults,” Environmental Science and Pollution Research 30, no. 13 (2022): 36377–36391, 10.1007/s11356-022-24783-y. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0045] 45. Ren Z., Deng H., Deng Y., et al., “Effects of Selenium on Arsenic‐Induced Liver Lesions in Broilers,” Biological Trace Element Research 199, no. 3 (2021): 1080–1089, 10.1007/s12011-020-02222-8. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0046] 46. Ren Z., Wu Q., Deng H., et al., “Effects of Selenium on the Immunotoxicity of Subacute Arsenic Poisoning in Chickens,” Biological Trace Element Research 199, no. 11 (2021): 4260–4272, 10.1007/s12011-020-02558-1. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0047] 47. Fitzgerald J. A., Könemann S., Krümpelmann L., Županič A., and Vom Berg C., “Approaches to Test the Neurotoxicity of Environmental Contaminants in the Zebrafish Model: From Behavior to Molecular Mechanisms,” Environmental Toxicology and Chemistry 40, no. 4 (2021): 989–1006, 10.1002/etc.4951. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0048] 48. Panula P., Chen Y.‐C., Priyadarshini M., et al., “The Comparative Neuroanatomy and Neurochemistry of Zebrafish CNS Systems of Relevance to Human Neuropsychiatric Diseases,” Neurobiology of Disease 40, no. 1 (2010): 46–57, 10.1016/j.nbd.2010.05.010. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0049] 49. Zhu Y., Yang Q., Gu J., et al., ““Environmental Standard Limit Concentration” Arsenic Exposure Is Associated With Anxiety, Depression, and Autism‐Like Changes in Early‐Life Stage Zebrafish,” Journal of Hazardous Materials 469 (2024): 133953, 10.1016/j.jhazmat.2024.133953. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0050] 50. Arnold M. C., Forte J. E., Osterberg J. S., and Di Giulio R. T., “Antioxidant Rescue of Selenomethionine‐Induced Teratogenesis in Zebrafish Embryos,” Archives of Environmental Contamination and Toxicology 70 (2016): 311–320, 10.1007/s00244-015-0235-7. [DOI] [PMC free article] [PubMed] [Google Scholar]

[tox70048-bib-0051] 51. Han S., Fei F., Sun S., et al., “Increased Anxiety Was Found in serpini1 Knockout Zebrafish Larval,” Biochemical and Biophysical Research Communications 534 (2021): 1013–1019, 10.1016/j.bbrc.2020.10.048. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0052] 52. Merola C., Lucon‐Xiccato T., Bertolucci C., and Perugini M., “Behavioural Effects of Early‐Life Exposure to Parabens in Zebrafish Larvae,” Journal of Applied Toxicology 41, no. 11 (2021): 1852–1862, 10.1002/jat.4171. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0053] 53. Irons T. D., MacPhail R. C., Hunter D. L., and Padilla S., “Acute Neuroactive Drug Exposures Alter Locomotor Activity in Larval Zebrafish,” Neurotoxicology and Teratology 32, no. 1 (2010): 84–90, 10.1016/j.ntt.2009.04.066. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0054] 54. Xu Y., Peng T., Xiang Y., Liao G., Zou F., and Meng X., “Neurotoxicity and Gene Expression Alterations in Zebrafish Larvae in Response to Manganese Exposure,” Science of the Total Environment 825 (2022): 153778, 10.1016/j.scitotenv.2022.153778. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0055] 55. Yang X., Wang X., Gao D., et al., “Developmental Toxicity Caused by Sanguinarine in Zebrafish Embryos via Regulating Oxidative Stress, Apoptosis and wnt Pathways,” Toxicology Letters 350 (2021): 71–80, 10.1016/j.toxlet.2021.07.001. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0056] 56. Casadei R., Pelleri M. C., Vitale L., et al., “Identification of Housekeeping Genes Suitable for Gene Expression Analysis in the Zebrafish,” Gene Expression Patterns 11, no. 3–4 (2011): 271–276, 10.1016/j.gep.2011.01.003. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0057] 57. Livak K. J. and Schmittgen T. D., “Analysis of Relative Gene Expression Data Using Real‐Time Quantitative PCR and the 2^−ΔΔCT Method,” Methods 25, no. 4 (2001): 402–408, 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0058] 58. Babich H., Martin‐Alguacil N., and Borenfreund E., “Arsenic‐Selenium Interactions Determined With Cultured Fish Cells,” Toxicology Letters 45, no. 2–3 (1989): 157–164, 10.1016/0378-4274(89)90005-2. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0059] 59. Attaran A., Salahinejad A., Naderi M., Crane A. L., Chivers D. P., and Niyogi S., “Transgenerational Effects of Selenomethionine on Behaviour, Social Cognition, and the Expression of Genes in the Serotonergic Pathway in Zebrafish,” Environmental Pollution 286 (2021): 117289, 10.1016/j.envpol.2021.117289. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0060] 60. Naderi M., Ferrari M. C. O., Chivers D. P., and Niyogi S., “Maternal Exposure to Dietary Selenium Causes Dopaminergic Hyperfunction and Cognitive Impairment in Zebrafish Offspring,” Environmental Science & Technology 52, no. 22 (2018): 13574–13583, 10.1021/acs.est.8b04768. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0061] 61. Piyushbhai M. K., Binesh A., Shanmugam S. A., and Venkatachalam K., “Exposure to Low‐Dose Arsenic Caused Teratogenicity and Upregulation of Proinflammatory Cytokines in Zebrafish Embryos,” Biological Trace Element Research 201 (2023): 3487–3496, 10.1007/s12011-022-03418-w. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0062] 62. Li D., Lua C., Wang J., et al., “Developmental Mechanisms of Arsenite Toxicity in Zebrafish (Danio rerio) Embryos,” Aquatic Toxicology 91 (2009): 229–237, 10.1016/j.aquatox.2008.11.007. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0063] 63. Kane M. J., Hambrick D. Z., and Conway A. R. A., “Working Memory Capacity and Fluid Intelligence Are Strongly Related Constructs: Comment on Ackerman, Beier, and Boyle (2005),” Psychological Bulletin 131, no. 1 (2005): 66–71, 10.1037/0033-2909.131.1.66. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0064] 64. Tierney K. B., “Behavioural Assessments of Neurotoxic Effects and Neurodegeneration in Zebrafish,” Biochimica et Biophysica Acta (BBA) ‐ Molecular Basis of Disease 1812, no. 3 (2011): 381–389, 10.1016/j.bbadis.2010.10.011. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0065] 65. Chen L., Huang C., Hu C., Yu K., Yang L., and Zhou B., “Acute Exposure to DE‐71: Effects on Locomotor Behavior and Developmental Neurotoxicity in Zebrafish Larvae,” Environmental Toxicology and Chemistry 31, no. 10 (2012): 2338–2344, 10.1002/etc.1958. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0066] 66. Chen L., Yu K., Huang C., et al., “Prenatal Transfer of Polybrominated Diphenyl Ethers (PBDEs) Results in Developmental Neurotoxicity in Zebrafish Larvae,” Environmental Science & Technology 46, no. 17 (2012): 9727–9734, 10.1021/es302119g. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0067] 67. Sloman K. A. and McNeil P. L., “Using Physiology and Behaviour to Understand the Responses of Fish Early Life Stages to Toxicants,” Journal of Fish Biology 81, no. 7 (2012): 2175–2198, 10.1111/j.1095-8649.2012.03435.x. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0068] 68. Wang W., Wang B., Liu Z., and Xia X., “Developmental Toxicity and Alteration of Gene Expression in Zebrafish Embryo Exposed to 6‐Benzylaminopurine,” Chemosphere 233 (2019): 336–346, 10.1016/j.chemosphere.2019.05.261. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0069] 69. Wang Y. H., Wang Y. K., Yu X. G., et al., “Chronic Environmental Inorganic Arsenic Exposure Causes Social Behavioral Changes in Juvenile Zebrafish (Danio rerio),” Science of the Total Environment 867 (2023): 161296, 10.1016/j.scitotenv.2022.161296. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0070] 70. Baldissarelli L. A., Capiotti K. M., Bogo M. R., Ghisleni G., and Bonan C. D., “Arsenic Alters Behavioral Parameters and Brain Ectonucleotidases Activities in Zebrafish ( Danio rerio ),” Comparative Biochemistry and Physiology, Part C 155 (2012): 566–572, 10.1016/j.cbpc.2012.01.006. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0071] 71. Canadian Council of Ministers of the Environment , “Canadian Water Quality Guidelines for the Protection of Aquatic Life: Guidance on the Site‐Specific Application of Water Quality Guideline in Canada: Procedures for Deriving Numerical Water Quality Objectives,” in Canadian Environmental Quality Guidelines, 1999 (Canadian Council of Ministers of the Environment, 2003). [Google Scholar]

[tox70048-bib-0072] 72. US EPA, O , “National Recommended Water Quality Criteria—Aquatic Life Criteria Table [Data and Tools],” (2015), https://www.epa.gov/wqc/national‐recommended‐water‐quality‐criteria‐aquatic‐life‐criteria‐table.

[tox70048-bib-0073] 73. Sayre L. M., Perry G., and Smith M. A., “Oxidative Stress and Neurotoxicity,” Chemical Research in Toxicology 21, no. 1 (2008): 172–188, 10.1021/tx700210j. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0074] 74. Félix L. M., Vidal A. M., Serafim C., et al., “Ketamine‐Induced Oxidative Stress at Different Developmental Stages of Zebrafish (Danio rerio) Embryos,” RSC Advances 6, no. 66 (2016): 61254–61266, 10.1039/C6RA08298J. [DOI] [Google Scholar]

[tox70048-bib-0075] 75. Sun H. J., Zhang J. Y., Wang Q., et al., “Environmentally Relevant Concentrations of Arsenite Induces Developmental Toxicity and Oxidative Responses in the Early Life Stage of Zebrafish,” Environmental Pollution 254 (2019), 10.1016/j.envpol.2019.113022. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0076] 76. Gailer J., George G. N., Pickering I. J., et al., “A Metabolic Link Between Arsenite and Selenite: The Seleno‐Bis(S‐ Glutathionyl) Arsinium Ion,” Journal of the American Chemical Society 122 (2000): 4637–4639. [Google Scholar]

[tox70048-bib-0077] 77. Karam C., Scelsa S. N., and MacGowan D. J. L., “The Clinical Course of Progressive Bulbar Palsy,” Amyotrophic Lateral Sclerosis 11, no. 4 (2010): 364–368, 10.3109/17482960903513159. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0078] 78. Rowland L. P. and Shneider N. A., “Amyotrophic Lateral Sclerosis,” New England Journal of Medicine 344, no. 22 (2001): 1688–1700, 10.1056/NEJM200105313442207. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0079] 79. Singer M. A., Statland J. M., Wolfe G. I., and Barohn R. J., “Primary Lateral Sclerosis,” Muscle & Nerve 35, no. 3 (2007): 291–302, 10.1002/mus.20728. [DOI] [PubMed] [Google Scholar]

[tox70048-bib-0080] 80. Sahu A., Gopalakrishnan L., Gaur N., et al., “The 5‐Hydroxytryptamine Signaling Map: An Overview of Serotonin‐Serotonin Receptor Mediated Signaling Network,” Journal of Cell Communication and Signaling 12, no. 4 (2018): 731–735, 10.1007/s12079-018-0482-2. [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Exploring Interactive Effects of Arsenic and Selenium Exposure on Larval Zebrafish (Danio rerio)

Owen Luo

Jinnath Rehana Ritu

Md Helal Uddin

Sravan Kumar Putnala

Mahesh Rachamalla

Som Niyogi

Douglas P Chivers

ABSTRACT

1. Introduction

2. Materials and Methods

2.1. Chemicals and Reagents

2.2. Fish Husbandry and Egg Collection

2.3. Experimental Design

FIGURE 1.

2.4. Measurement of Arsenic and Selenium Concentrations

2.5. Behavioral Analysis

2.6. Determination of ROS Levels

2.7. RNA Extraction, cDNA Synthesis and Quantitative Real‐Time qPCR Analysis

TABLE 1.

2.8. Statistical Analysis

3. Results

3.1. Apical Parameters Assessment of Larval Zebrafish

3.2. Effects on ROS Production

FIGURE 2.

3.3. Thigmotaxis Behavioral Assay

FIGURE 3.

3.4. Light–Dark Reflexive Movement

FIGURE 4.

3.5. Gene Expression at 5 dpf

3.5.1. Modulation of Antioxidant Gene Expression Following Arsenic and Selenium Co‐Exposure

FIGURE 5.

3.5.2. Expression of Neurodevelopmental Genes

3.5.3. Expression of Neuronal Signaling Pathway Genes

4. Discussion

5. Conclusion

Author Contributions

Funding

Conflicts of Interest

Supporting information

Acknowledgments

Data Availability Statement

References

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases