ASIV Attenuates Cisplatin‐Induced Proximal Tubular Injury by Enhancing Mitochondrial Biogenesis and Mitophagy Through the ADRA1A/AMPK/FOXO3A Pathway

ABSTRACT

Cisplatin causes nephrotoxicity by accumulating in renal tubular epithelial cells (RTECs). Astragaloside IV (ASIV) shows renoprotective potential, but its mechanisms remain poorly understood. Cisplatin induced nephrotoxicity was established in 8‐week‐old male C57BL/6 mice via intraperitoneal administration of cisplatin at 20 mg/kg for 48 h. For in vitro studies, HK‐2 human proximal tubular epithelial cells were exposed to 50 μM cisplatin for 24 h. Multi‐omics approaches were employed to identify novel mechanisms by which ASIV ameliorates cisplatin‐induced proximal tubular injury. ASIV markedly reduced serum creatinine and urea nitrogen levels in mice, and ameliorated cisplatin‐induced proximal tubular injury both in vivo and in vitro. Moreover, ASIV restored mitochondrial damage, upregulated protein expression of PGC‐1α, TOMM20, and PINK1 in RTECs. Mechanistically, RNA‐seq and scRNA‐seq revealed that cisplatin predominantly affected ADRA1A‐mediated mitochondrial biogenesis and mitophagy in proximal tubular cells, accompanied by suppression of the AMPK/FOXO3A pathway. Notably, ASIV upregulated ADRA1A expression, thereby facilitating AMPK and FOXO3A phosphorylation and consequently enhancing mitochondrial biogenesis and mitophagy. Furthermore, dabuzalgron (a selective ADRA1A agonist) recapitulated the protective effects of ASIV. In contrast, the renoprotective action of ASIV against cisplatin‐induced proximal tubular injury was largely abrogated by the ADRA1A antagonist tamsulosin in vivo and by ADRA1A‐specific siRNA in vitro. These findings identify ASIV as a highly promising renoprotective agent that upregulates ADRA1A expression and activates the AMPK/FOXO3A axis to enhance mitochondrial biogenesis and mitophagy, thereby counteracting cisplatin‐induced proximal tubular injury.

Cisplatin exerts nephrotoxic effects largely via mitochondrial dysfunction in renal tubular epithelial cells. ASIV alleviates cisplatin‐induced proximal tubular injury, an effect associated with upregulation of ADRA1A and activation of the AMPK/FOXO3A pathway, leading to enhanced mitochondrial biogenesis and mitophagy. This findings suggest that ASIV may represent a potential renoprotective agent against cisplatin nephrotoxicity.

Abbreviations

AMPK

adenosine 5′‐monophosphate (AMP)‐activated protein kinase

ATP

adenosineTriphosphate

BNIP3

BCL2/adenovirus E1B 19 kDa protein‐interacting protein 3

CDDP

cis‐Diaminodichloroplatinum

FOXO3A

Forkhead box O3

LC3B

MAP1 light chain 3‐like protein 2

LRP2

low‐density lipoprotein receptor‐related protein 2;PINK1

PTEN induced kinase 1

NGAL

neutrophil gelatinase associated lipocalin

PGC1A

peroxisome proliferator‐activated receptor gamma coactivator 1 alpha

RTEC

renal tubular epithelial cells

1. Introduction

Cisplatin, a potent chemotherapeutic agent, is widely used in the treatment of various malignancies, including lung cancer [1, 2]. Upon entering cancer cells, its chloride ligands are replaced by water molecules, forming aquated species that bind DNA with high affinity, ultimately inducing apoptotic cell death [3]. However, its clinical application is significantly limited by dose‐dependent tissue toxicity, particularly nephrotoxicity [4]. Cisplatin‐induced nephrotoxicity requires treatment modification—either dose reduction or discontinuation—in approximately 35% of patients, which compromises its intended tumoricidal effects [5]. This nephrotoxicity is primarily characterized by apoptosis of proximal tubular epithelial cells, mitochondrial dysfunction, inflammation, and oxidative stress [6, 7]. Recent studies have emphasized the antioxidant, anti‐inflammatory, and mitochondrial‐protective properties of various natural product‐derived compounds [8, 9, 10]. Thus, identifying promising natural product‐based agents capable of mitigating cisplatin‐induced nephrotoxicity remains a critical therapeutic goal.

Mitophagy, a specialized form of autophagy, mediates the targeted removal and lysosomal degradation of dysfunctional or surplus mitochondria. Impaired mitophagy is closely linked to the activation of mitochondria‐dependent apoptotic pathways [11]. Concurrently, mitochondrial biogenesis regulates the synthesis and population of these organelles. In cisplatin‐induced proximal tubule injury, the inhibition of both mitophagy and biogenesis disrupts mitochondrial quality control, leading to a reduction in mitochondrial mass [12, 13]. Current evidence suggests that restoring these homeostatic processes reduces tubular cell apoptosis [14]. Therefore, pharmacological strategies targeting the coordination of mitophagy and mitochondrial biogenesis offer a promising approach to alleviate cisplatin‐induced nephrotoxicity.

ADRA1A, a G protein‐coupled receptor, is predominantly expressed on the cell membrane and within intracellular compartments, acting as a key mediator of norepinephrine and epinephrine signaling. In cisplatin‐induced proximal tubular injury, mitochondrial damage leads to cellular energy depletion, which activates AMPK phosphorylation as a compensatory mechanism to boost ATP synthesis [15]. As a key upstream regulator of AMPK, ADRA1A directly enhances AMPK phosphorylation, influencing the activity of downstream signaling effectors. ADRA1A activation increases phosphorylated AMPKα levels, thereby promoting both mitophagy and mitochondrial biogenesis [16, 17]. Additionally, some studies suggest that these processes—specifically PGC1α‐mediated mitochondrial biogenesis and PINK1/Parkin‐mediated mitophagy—are regulated via AMPK and its downstream target FOXO3A [18, 19]. These findings highlight the potential of modulating the ADRA1A/AMPK axis as a therapeutic strategy for alleviating cisplatin‐induced nephrotoxicity.

Astragaloside IV (ASIV), a bioactive saponin derived from the roots of Astragalus membranaceus (Fisch.), is known for its antioxidant, anti‐inflammatory, and mitochondrial‐protective effects [20, 21]. Our previous work used post‐translational modification proteomics to explore the mechanisms by which ASIV alleviates oxidative stress and mitochondrial dysfunction in the proximal renal tubules of db/db mice [22]. Moreover, studies have demonstrated that ASIV provides both preventive and therapeutic benefits in various acute kidney injury models, including cisplatin‐induced nephrotoxicity [23, 24]. However, the precise molecular mechanisms by which ASIV protects against cisplatin‐induced nephrotoxicity, particularly its effects on proximal tubular cells, remain incompletely understood.

This study investigated whether ASIV mitigates cisplatin‐induced nephrotoxicity by activating the ADRA1A‐mediated AMPK/FOXO3A pathway to promote mitochondrial biogenesis and activate mitophagy, thereby reducing RTEC apoptosis.

2. Materials and Methods

2.1. Agents

ASIV (purity ≥ 98%) was sourced from Jingzhu Biological Co. Ltd. (Nanjing, China). The Cell Counting Kit‐8 (KTA1020) was obtained from Abbkine Scientific Co. Ltd. (Wuhan, China). Biochemical kits for creatinine (C011‐2‐1) and urea (C013‐2‐1) were acquired from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). The following antibodies were purchased from Proteintech Biological Co. Ltd. (Chicago, USA): TOM20 polyclonal antibody (11802‐1‐AP), PGC1A monoclonal antibody (66369‐1‐lg), NGAL polyclonal antibody (30700‐1‐AP), GAPDH polyclonal antibody (10494‐1‐AP), PINK1 polyclonal antibody (23274‐1‐AP), phospho‐FOXO3A polyclonal antibody (28755‐1‐AP), and β‐actin monoclonal antibody (66009‐1‐lg). The ADRA1A Rab antibody (61917), LC3B polyclonal antibody (61743), BNIP3 polyclonal antibody (64885), and ATG7 polyclonal antibody (61177) were sourced from Genuinbiotech Biological Co. Ltd. (Hefei, China). The LRP2 polyclonal antibody (HA722151), phospho‐AMPKα monoclonal antibody (HA723603), AMPKα1 monoclonal antibody (ET1608‐40), and FOXO3A monoclonal antibody (ET1604‐11) were obtained from HuaBio Biological Co. Ltd. (Hangzhou, China). The HiFiScript gDNA Removal cDNA Synthesis Kit (CW2582M) and SuperStar Universal SYBR Master Mix (CW3360M) were purchased from Cowin Biotech Co. Ltd. (Jiangsu, China). Cisplatin (HY‐17394), Tamsulosin (HY‐B0661), and Dabuzalgron (HY‐117071) were obtained from MedChemExpress LLC (New Jersey, USA).

2.2. Animal Study

All animal procedures were approved by the Animal Ethics Committee of Chongqing Traditional Chinese Medicine Hospital (Approval No. 2025‐DWSY‐GX) and conducted in compliance with ethical guidelines for animal research. Male C57BL/6 mice (8 weeks old, SPF grade) were housed under controlled conditions (24°C ± 2°C, 55% ± 5% humidity) with a 12‐h light/dark cycle. After a 1‐week acclimatization period, the mice were randomly assigned to 6 groups (n = 6 per group): Control, CDDP (20 mg/kg, single dose, i.p.) [25], ASIV low dose group (20 mg/kg, gavage, pre‐treated 5 days), ASIV high dose group (80 mg/kg, gavage, pre‐treated 5 days), Tamsulosin group (50 μg/kg/d, gavage), and Dabuzalgron group (10 μg/kg/d, gavage). All drug groups were administered orally once daily, while the CDDP and Control groups received 0.5% CMC‐Na, with six mice per group. Doses were based on prior literature [22, 26, 27, 28]. At the end of the experiment (48 h after a single dose of CDDP), mice were euthanized, and kidneys were excised. Serum samples were obtained by centrifugation at 3000 g for 15 min, and serum creatinine (CR) and blood urea nitrogen (BUN) levels were measured enzymatically using biochemical kits (Nanjing Jiancheng Bioengineering Research Institute, Nanjing, China), according to the manufacturer's instructions.

2.3. Pathological Analysis

For histological staining, kidney tissue sections were deparaffinized and rehydrated. PAS staining was performed by oxidizing sections in 0.5% periodic acid for 10 min, rinsing, incubating with Schiff's reagent for 15 min, and counterstaining with hematoxylin. H&E staining involved staining with hematoxylin for 5 min, differentiating in 1% acid alcohol, bluing in tap water, and counterstaining with eosin for 2 min. Sections were then dehydrated, cleared, and mounted with resinous medium. Images were captured using a Leica microscope (Germany).

2.4. Immunohistochemical and Immunofluorescence Examination of Kidney Tissues

For paraffin‐embedded kidney tissue sections, dewaxing and rehydration were performed, followed by antigen retrieval using Tris‐EDTA buffer (pH 9.0). After blocking with goat serum, primary antibodies (NGAL, 1:100) were applied and incubated overnight at 4°C. Following primary antibody incubation, sections were washed and incubated with a secondary antibody at room temperature. DAB staining was performed, followed by hematoxylin counterstaining. The sections were then cleared in xylene and mounted. Observations and photography were conducted using a Leica microscope (Germany), and positive expression was analyzed using ImageJ software. For immunofluorescence, 4‐μm paraffin‐embedded kidney tissue sections were deparaffinized, rehydrated, and subjected to heat‐induced antigen retrieval in citrate buffer (0.01 M, pH 6.0). Endogenous peroxidase was blocked using 3% H₂O₂, and protein blocking was done with 1% BSA. Triple labeling was performed using a TSA‐based multiplex fluorescence kit: Sections were incubated overnight at 4°C with rabbit anti‐TOM20 (1:100), followed by HRP‐conjugated anti‐rabbit secondary antibody (1:200) and TYR‐520 tyramide for 10 min at room temperature. After microwave stripping in citrate buffer, sections were incubated with rabbit anti‐LRP2 (1:100), detected with HRP‐conjugated anti‐rabbit secondary antibody and TYR‐570 tyramide, followed by microwave stripping. Sections were then incubated with mouse anti‐PGC1A (1:100), detected with HRP‐conjugated anti‐mouse secondary antibody and TYR‐690 tyramide. For PINK1 staining, separate sections were incubated overnight at 4°C with rabbit anti‐PINK1 (1:100), followed by Alexa Fluor 555‐conjugated anti‐rabbit secondary antibody (1:200) for 1 h at room temperature in the dark. All sections were mounted with an anti‐fade medium containing DAPI. Fluorescence images were captured using an Olympus microscope, and relative fluorescence intensities were quantified using ImageJ.

2.5. Terminal Deoxynucleotidyl Transferase‐Mediated dUTP Nick‐End Labeling (TUNEL) Staining

For the TUNEL assay, kidney tissue sections were deparaffinized in xylene, rehydrated through graded ethanol, and incubated with 20 μg/mL DNase‐free proteinase K at 20°C–37°C for 15–30 min. After PBS washes, sections were refixed with 4% paraformaldehyde for 15 min and permeabilized with 0.3% Triton X‐100 for 10 min. TUNEL staining was performed using a commercial kit (Beyotime, Shanghai, China) according to the manufacturer's protocol. Fluorescence images were captured using a fluorescence microscope (Leica, Germany).

2.6. RT‐qPCR Analysis

Total RNA was extracted from 10 mg of kidney tissue using the RNApure Fast Tissue&Cell Kit (Cowin Biotech, Jiangsu, China). RNA concentration and purity were assessed by measuring absorbance at 260/280 nm using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA), with an absorbance ratio of 1.8–2.0 considered acceptable. RNA was reverse‐transcribed into cDNA using a cDNA Synthesis Kit. RT‐qPCR was performed using the SYBR Green kit according to the manufacturer's instructions. Primer sequences (Tsingke Biotechnology Co. Ltd., Shanghai, China) are provided in Table 1. ACTB (internal control gene) mRNA levels were used to normalize relative mRNA expression, and results were analyzed using the 2^−ΔΔCt method.

TABLE 1.

The primer sequence of target gene.

Gene	Forward (5′‐3′)	Reverse (5′‐3′)
ADRA1A	TCTTCCATGCCCCAGGGAT	CTAGACTTCCTCCCCGTTTTCACC
Actin	CCTCACTGTCCACCTTCC	GGGTGTAAAACGCAGCTC

2.7. Western Blotting Analysis

Renal tissues were homogenized in ice‐cold RIPA buffer to extract total proteins. Protein concentrations were determined using the BCA assay (Beyotime, Shanghai, China). Denatured lysates were resolved by 10%–15% SDS‐PAGE (Epizyme, Shanghai, China) and transferred to PVDF membranes (Merck Millipore). Membranes were blocked with 5% non‐fat dry milk, incubated overnight at 4°C with primary antibodies, washed with TBST (0.1% Tween‐20), and exposed to HRP‐conjugated secondary antibodies (Boster, Hubei, China) for 1.5 h at room temperature. After additional TBST washes, immunoreactive bands were visualized using chemiluminescence (Bio‐Rad Laboratories Inc., California, USA).

2.8. Bulk RNA‐Seq Analysis

Total RNA was extracted from kidney samples (CON, CDDP, and ASIV groups), and poly(A)‐tailed mRNA was enriched using mRNA Capture Beads, followed by heat fragmentation. First‐strand cDNA synthesis was performed on the fragmented mRNA, with second‐strand synthesis, end repair, and A‐tailing occurring concurrently. Following adapter ligation, fragments were size‐selected using Hieff NGS DNA Selection Beads and PCR‐amplified. Libraries were sequenced on the Illumina Novaseq X Plus platform. Raw reads were filtered with fastp, and rRNA reads were removed using bowtie2. Clean reads were aligned to the reference genome with HISAT2, transcripts were assembled with Stringtie, and gene expression levels were quantified using RSEM. Normalized counts were analyzed using edgeR, with genes exhibiting |log₂FC| > 1 and adjusted p < 0.05 classified as differentially expressed genes (DEGs). Functional enrichment analysis was performed on the Omicsmart platform (www.omicsmart.com).

2.9. Single‐Cell RNA‐Seq Analysis

Single‐cell RNA sequencing data (GSE220675) from seven mouse kidney tissues were processed using the R package Seurat (version 4.1.11). Cells with gene counts < 200 or > 2000, or with > 70% mitochondrial reads, were removed using UMI‐Tools to exclude dead cells, doublets, and low‐quality cells. After quality control, 31 042 cells remained. Count data were normalized and batch effects corrected using Seurat4norm. Dimensionality reduction and unsupervised clustering were performed following standard Seurat workflows, employing PCA, t‐SNE, and UMAP algorithms. Based on known marker genes from the Human Protein Atlas, major cell types were annotated, including proximal tubule (PT) cells, distal convoluted tubule/loop of Henle (DCT/LOH) cells, collecting duct intercalated and principal cells (CD‐IC/CD‐PC), podocytes, endothelial cells, macrophages, neutrophils, T/NK cells, B cells, dendritic cells, and fibroblasts. To resolve PT subcluster, a second round of unsupervised clustering was performed, yielding three clusters: one PT subcluster without significant apoptosis/DNA damage, and two subclusters with significant apoptosis/DNA damage. Cluster‐specific marker genes were identified using the FindAllMarkers function in Seurat (min.pct = 0.1, logfc.threshold = 0.25).

2.10. Transmission Electron Microscope

Fresh kidney tissues were fixed in 2.5% glutaraldehyde at 4°C, rinsed in PBS, post‐fixed with 1% osmium tetroxide, dehydrated in graded ethanol, and infiltrated with acetone‐epoxy resin mixtures. The tissues were embedded in epoxy resin and polymerized at 60°C for 48 h. Ultrathin sections were cut, double‐stained with uranyl acetate and lead citrate, and examined by transmission electron microscopy (TEM; HT7800 120k, Hitachi, Japan).

2.11. Cell Culture

Human proximal tubular epithelial cells (HK2) were obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China) and cultured in low‐glucose DMEM medium (Gibco, New York, USA). The medium was supplemented with 10% fetal bovine serum (Bio‐Channel, Nanjing, China) and 1% penicillin–streptomycin (Beyotime, Shanghai, China). Cells were maintained under standard conditions (5% CO₂, 95% humidity, 37°C).

2.12. Cell Viability Assay

Cell viability was assessed using a CCK‐8 assay. HK2 cells were seeded at a density of 5 × 10³ cells in 96‐well plates and incubated for 24 h. After 24 h of treatment, 10 μL of CCK‐8 solution was added to each well. After incubation at 37°C for 2 h, absorbance at 450 nm was measured (BioTek, USA).

2.13. siRNA Transfections

The ADRA1A‐specific small interfering RNA (siRNA) was purchased from Corues Biotechnology (Nanjing, China). Transfection was performed using Lipofectamine 3000 (Cat: L3000001, Thermo Fisher Scientific, USA) according to the manufacturer's instructions. The primer sequences for gene‐specific primers are provided in Table 2.

TABLE 2.

Primer sequences of gene‐specific primers used for siRNA.

Primer name	Sequence (5′‐3′)
ADRA1A‐siRNA1‐F	GGCGUUUGUG AAUGGAAAUUUTT
ADRA1A‐siRNA1‐R	AAAUUUCCA UUCACAAACGCCTT
ADRA1A‐siRNA2‐F	UGGGUCUUU CUUCCCUGAUUUTT
ADRA1A‐siRNA2‐R	AAAUCAGGG AAGAAAGACCCATT
ADRA1A‐siRNA3‐F	AUGGUGUUU CUCUCGGGAAAUTT
ADRA1A‐siRNA3‐R	AUUUCCCGA GAGAAACACCAUTT

2.14. Statistical Analysis

Data are presented as mean ± standard error of the mean (SEM). One‐way ANOVA with Tukey's post hoc test was used for comparisons between multiple groups (post hoc tests were performed only when F‐values were significant, p < 0.05, and variances were homogeneous). For comparisons between two groups, Student's t‐test was applied (GraphPad Prism 8.0, USA). Statistical significance was defined as p < 0.05.

3. Result

3.1. ASIV Improves Renal Function and Pathological Damage In Vivo

Using a well‐established mouse model of cisplatin‐induced acute kidney injury (C57BL/6 mice, single intraperitoneal dose of 20 mg/kg, 48 h), ASIV was administered at doses of 20 and 80 mg/kg. Treatment with 80 mg/kg ASIV significantly alleviated cisplatin‐induced cortical pallor and reduced CR and BUN levels (Figure 1A–C), without adverse effects in normal mice. Additionally, ASIV at 80 mg/kg notably improved histopathological features of tubular injury, including luminal dilation, basement membrane denudation, and brush border loss (Figure 1D). Based on these results, the 80 mg/kg dose was chosen for subsequent experiments.

FIGURE 1.

ASIV improves renal function and pathological damage in vivo. (A) Experimental protocol outlining the evaluation of ASIV's effect on CDDP‐induced nephrotoxicity in mice. (B) Serum creatinine and urea levels were measured in mice (n = 6). (C, D) Representative kidney morphology and histological analysis of renal tissues through H&E staining or PAS staining in different treatment groups (Scale bar: 100 μm). Data are presented as mean ± SEM, ****p < 0.0001, compared to the Con group; ^#### p < 0.0001, compared to the CDDP group.

3.2. ASIV Prevents Proximal Tubular Injury In Vivo and In Vitro

Proximal tubular injury is a hallmark of cisplatin‐induced nephrotoxicity. In this study, cisplatin administration significantly increased the proportion of TUNEL‐positive cells in proximal tubules and enhanced NGAL immunohistochemical staining compared to the control group (Figure 2A). ASIV treatment markedly reduced these cisplatin‐induced changes.

FIGURE 2.

ASIV prevents renal tubular cell injury in vivo and in vitro. (A) Representative images and quantification of NGAL immunohistochemistry (n = 15, Scale bar: 200 μm) and TUNEL staining (n = 8, Scale bar: 100 μm) in renal tissues from different groups of mice. (B, C) CCK‐8 assay to assess cell viability in HK2 cells under different treatment conditions (n = 6). (D) Representative images and quantification of cell morphology and flow cytometry analysis of HK2 cells in different groups. Data are presented as mean ± SEM, ****p < 0.0001 or **p < 0.01 or *p < 0.05, compared to the Con group; ^#### p < 0.0001 or ^# p < 0.05, compared to the CDDP group.

To further investigate the underlying mechanisms, an in vitro model was established using HK2 renal tubular epithelial cells (RTECs). Based on CCK‐8 assay results, exposure to 50 μM cisplatin for 24 h was selected to induce tubular injury (Figure 2B). Given that DMSO may inactivate cisplatin, a pretreatment protocol was implemented to avoid direct interaction. Pre‐incubation with 40 μM ASIV for 6 h significantly attenuated the cisplatin‐induced decrease in cell viability (Figure 2C). Additionally, morphological assessment and flow cytometry analysis revealed that ASIV pretreatment reduced apoptosis in cisplatin‐treated HK2 cells (Figure 2D).

These results demonstrate that ASIV effectively mitigates cisplatin‐induced proximal tubular injury both in vivo and in vitro.

3.3. ASIV Promotes Mitochondrial Biogenesis and Mitophagy In Vivo

To evaluate ASIV's effect on mitochondrial quality in RTECs, TEM was conducted (Figure 3A). Cisplatin treatment caused substantial mitochondrial damage, characterized by reduced mitochondrial number and area, as well as fragmentation and loss of cristae. These ultrastructural alterations were significantly attenuated by ASIV administration.

FIGURE 3.

ASIV promotes mitochondrial biogenesis and mitophagy in vivo. (A) Representative images and quantification of mitochondrial number and area based on transmission electron microscopy (TEM) in renal tubular epithelial cells from different groups of mice (Scale bar: 2 μm). (B) Representative images and quantification of LRP2, PGC1A, or TOMM20 immunofluorescence (n = 10, Scale bar: 100 μm) in renal tissues from different groups of mice (n = 6). (C) Representative images and quantification of PINK1 immunofluorescence in renal tissues from different groups of mice. Data are presented as mean ± SEM, ****p < 0.0001 or **p < 0.01, compared to the Con group; ^#### p < 0.0001, ^### p < 0.001, ^## p < 0.01 or ^# p < 0.05 compared to the CDDP group.

Considering that mitochondrial dysfunction in cisplatin‐induced proximal tubular injury is closely linked to impaired mitochondrial biogenesis and mitophagy, these processes were examined. Immunofluorescence staining was performed using LRP2 to identify proximal tubules, PGC1A as a marker of mitochondrial biogenesis, and TOMM20 to label mitochondria. The results showed that cisplatin treatment significantly downregulated both PGC1A and TOMM20 expression, with ASIV reversing this reduction (Figure 3B). Furthermore, analysis of PINK1, a key regulator of mitophagy, revealed that ASIV restored PINK1 expression, indicating the rescue of the mitophagy process impaired by cisplatin (Figure 3C).

3.4. RNA‐Seq Reveals That ASIV Ameliorates Cisplatin‐Induced Proximal Tubular Injury via the ADRA1A/AMPK/FOXO Pathway

To elucidate the mechanism through which ASIV ameliorates cisplatin‐induced proximal tubular injury, RNA‐seq analysis was performed. Principal component analysis (PCA) revealed significant transcriptional differences among the three groups (Figure 4A). A total of 4301 DEGs were identified in the CON vs. CDDP comparison, and 4261 DEGs in the CDDP vs. CDDP + ASIV comparison, with 3586 DEGs overlapping between the two sets (Figure 4B). KEGG enrichment analysis revealed significant alterations in the AMPK signaling pathway, a central regulator of cellular energy metabolism, along with changes in upstream ADRA1A expression and the downstream FOXO signaling cascade (Figure 4C). Specifically, heatmap analysis demonstrated that cisplatin suppressed the expression of genes involved in tubule injury (Kim1, Pai1, Ngal), apoptosis (Bax, Bcl2), mitochondrial biogenesis (Pgc1a, Tfam), and mitophagy (Pink1, Parkin, Bnip3, Atg3, Atg7), all of which were reversed by ASIV treatment (Figure 4D). These results suggest that modulation of the AMPK pathway, potentially through ADRA1A, is a key mechanism of action for ASIV.

FIGURE 4.

RNA‐seq reveals that ASIV ameliorates cisplatin‐induced acute kidney injury via the ADRA1A/AMPK/FOXO pathway. (A) Principal component analysis (PCA) plots of RNA‐Seq from different sample groups. (B) The number of differentially expressed genes (DEGs) between the CON, CDDP, and CDDP + ASIV groups (fold change > 2.0, p < 0.05). (C) KEGG enrichment analysis of RNA‐Seq for CON versus CDDP and CDDP versus CDDP + ASIV. (D) Heatmap of key DEGs in RNA‐Seq across all samples. (E) Heatmap showing expression of Adra1a and genes related to mitochondrial biogenesis and mitophagy, derived from RNA‐Seq datasets of cisplatin‐induced AKI (GSE246133, GSE147256, GSE240304). (F) Heatmap showing expression of Adra1a and genes related to mitochondrial biogenesis and mitophagy, derived from RNA‐Seq datasets of ischemia–reperfusion AKI (IRI, GSE235903), folic acid (FA)‐induced AKI (GSE273063), and lipopolysaccharide (LPS)‐induced AKI (GSE240304).

To further validate this mechanism, we analyzed RNA‐seq data from GEO datasets on cisplatin‐induced acute kidney injury (AKI). The results showed that cisplatin significantly down‐regulated Adra1a expression and partially down‐regulated genes involved in mitochondrial biogenesis and mitophagy in GSE246133, GSE147256, and GSE240304 (Figure 4E). Notably, Adra1a also tended to be down‐regulated in ischemia–reperfusion (IRI)‐induced AKI (GSE235903), folic acid (FA)‐induced AKI, and lipopolysaccharide (LPS)‐induced AKI (GSE273063), where mitochondrial biogenesis and mitophagy were similarly partially down‐regulated (GSE240304) (Figure 4F).

3.5. scRNA‐Seq Reveals That ADRA1A Is Associated With Cisplatin‐Induced Proximal Tubular Injury

To determine the role of the ADRA1A/AMPK/FOXO pathway in cisplatin‐induced proximal tubular injury, we reanalyzed scRNA‐seq data of cisplatin‐induced AKI from public databases (GSE220675). Uniform manifold approximation and projection (UMAP) grouped cells from renal tissue of control (3 samples) and CDDP (4 samples) groups, and proximal tubular (PT) cell types were identified (Figure 5A–C). The results showed that Adra1a, Pgc1a, Pink1, Parkin, and Bnip3 were significantly down‐regulated in PT cells, while apoptosis factors and tubular injury markers were significantly up‐regulated (Figure 5D). Notably, the expression and distribution of Adra1a in PT cells differed significantly between the control and CDDP groups (Figure 5E).

FIGURE 5.

ScRNA‐seq reveals that ADRA1A is associated with cisplatin‐induced proximal tubular injury. (A) UMAP reveals distinct cell types identified in seven samples from the scRNA‐seq dataset (GSE220675) of control group and CDDP group (20 mg/kg cisplatin, i.p., 3 days). (B) Violin plot of marker genes for each cell type. (C) Proportions of distinct cell types in the Con group and CDDP group. (D) Heatmaps showing expression of Adra1a and genes associated with apoptosis (Bax, Bcl2), proximal tubule injury (Kim1, Pai1, Ngal), mitochondrial biogenesis (Pgc1a, Tfam), and mitophagy (Pink1, Parkin, Bnip3, Atg3, Atg7) in proximal tubule (PT) cells. (E) Distribution of Adra1a expression in PT cells of Con group and CDDP group. (F) UMAP reveals subtypes (PT, PT‐injury1, PT‐injury2) identified in PT cells from seven samples. (G) Violin plot showing expression of key genes associated with proximal tubule function (Sglt2, Slc27a2, Slc22a8, Lrp2), anti‐oxidative gene (Kl), proximal tubule injury (Kim1, Pai1, Ngal), DNA damage (P21), and apoptosis (Phlda3, Bak1, Fas, Bax) in PT cell subtypes. (H) Proportions of PT cell subtypes in seven samples from the Con group and CDDP group. (I) Distribution of Adra1a expression in PT cells subtypes across seven samples from the two groups. (J) Heatmaps showing expression of Adra1a and genes associated with apoptosis (Bax, Bcl2), proximal tubule injury (Kim1, Pai1, Ngal), mitochondrial biogenesis (Pgc1a, Tfam), and mitophagy (Pink1, Parkin, Bnip3, Atg3, Atg7) in PT cell subtypes.

Therefore, a subset analysis of PT cells was further performed. PT cells were divided into three subsets: PT, PT‐injury1, and PT‐injury2 (Figure 5F,H). In the PT‐injury1 and PT‐injury2 subsets, proximal tubule function genes (Sglt2, Slc27a2, Slc22a8, Lrp2) and the anti‐oxidative gene (Kl) were significantly down‐regulated, whereas tubular injury markers (Kim1, Pai1, Ngal), DNA damage marker (P21), and apoptosis‐related genes (Phlda3, Bak1, Fas, Bax) were significantly up‐regulated (Figure 5G). The distribution of Adra1a across seven samples in the two groups showed that Adra1a was predominantly expressed in the PT subset in the control group, but in the PT‐injury1 and PT‐injury2 subsets in the CDDP group (Figure 5I). Additionally, Adra1a, Bcl2, Pgc1a, Tfam, Pink1, Parkin, Atg3, and Atg7 were significantly down‐regulated, while Bax, Ngal, Kim1, and Pai1 were up‐regulated in the CDDP group (Figure 5J). Importantly, Adra1a expression decreased significantly before proximal tubular cells showed substantial damage and apoptosis in the CDDP group, indicating its potential as a target for drug intervention.

3.6. ASIV Upregulates the ADRA1A‐Mediated AMPK/FOXO3A Pathway and Restores Mitochondrial Biogenesis and Mitophagy in Proximal Tubular Cells In Vitro and In Vivo

ADRA1A has been shown to activate phosphorylation of AMPK/FOXO3A (Ewees et al., 2024). To validate these mechanisms, the expression of ADRA1A, phospho‐AMPK/AMPK, phospho‐FOXO3A/FOXO3A, and their downstream effectors was assessed in both in vitro and in vivo models (Figure 6A,B). Western blot results showed that ASIV significantly restored protein expression along the ADRA1A‐mediated p‐AMPK/p‐FOXO3A axis, as well as key downstream factors involved in mitochondrial biogenesis (PGC1A) and mitophagy (LC3B, BNIP3, ATG7). These results suggest that ASIV alleviates cisplatin‐induced proximal tubular injury, potentially through the restoration of mitochondrial biogenesis and mitophagy, which may be associated with the ADRA1A‐mediated AMPK/FOXO3A pathway.

FIGURE 6.

ASIV upregulates the ADRA1A‐mediated AMPK/FOXO3A pathway and restores mitochondrial biogenesis and mitophagy in proximal tubular cells in vitro and in vivo. (A) Western blotting analysis of ADRA1A, p‐AMPK/AMPK, p‐FOXO3A/FOXO3A, PGC1A, LC3B, ATG7, and BNIP3L expression in renal tissues from the CON, CDDP, and CDDP + ASIV groups. (B) Western blotting analysis of ADRA1A, p‐AMPK/AMPK, p‐FOXO3A/FOXO3A, PGC1A, LC3B, ATG7, and BNIP3 expression in HK2 cells treated with CON, CDDP, and CDDP + ASIV. WB gray values were quantitatively analyzed using ImageJ software. Data are presented as mean ± SEM, ****p < 0.0001, ***p < 0.001, **p < 0.01 or *p < 0.05, compared to the Con group or ^# p < 0.05 compared to the CDDP group.

3.7. ASIV Alleviates Proximal Tubular Injury in an ADRA1A‐Dependent Mechanism In Vivo

To assess whether ADRA1A activation‐mediated mitophagy or mitochondrial biogenesis contributes to ASIV's protective effect on proximal tubular injury, the ADRA1A antagonist tamsulosin (TSL) and the agonist dabuzalgron (Dabu) were employed (Figure 7A). In vivo experiments were conducted using a cisplatin‐induced nephrotoxicity mouse model with the following treatment groups: ASIV (80 mg/kg, gavage), ASIV + TSL (50 μg/kg, gavage), and Dabu alone (10 μg/kg, gavage). Both TSL and Dabu were administered orally.

FIGURE 7.

ASIV alleviates proximal tubular injury through an ADRA1A‐dependent mechanism in vivo. (A) Experimental protocol to evaluate the beneficial effect of ASIV on CDDP‐induced nephrotoxicity in mice treated with ADRA1A antagonists and agonists. (B) Detection of creatinine and urea levels in the serum of mice (n = 6). (C) Representative images and quantification of H&E staining or PAS staining (Scale bar: 100 μm), NGAL immunohistochemistry (Scale bar: 200 μm), TUNEL staining (Scale bar: 50 μm), and PINK1 immunofluorescence (Scale bar: 50 μm) in renal tissues from different groups of mice. (D) Western blotting analysis of ADRA1A, p‐AMPK/AMPK, p‐FOXO3A/FOXO3A, PGC1A, LC3B, and BNIP3 expression in renal tissues from the CON, CDDP, CDDP + ASIV, and CDDP + ASIV + TSL groups. WB gray values were quantitatively analyzed using ImageJ software. Data are presented as mean ± SEM, ****p < 0.0001, ***p < 0.001, **p < 0.01 or *p < 0.05, compared to the CDDP group; ^#### p < 0.0001, ^## p < 0.01, or ^# p < 0.05 compared to the CDDP + ASIV group.

Assessment of renal function revealed that TSL significantly attenuated ASIV's protective effect against cisplatin‐induced kidney injury, as shown by CR and BUN levels (Figure 7B). In contrast, Dabu alone exerted a renoprotective effect in the cisplatin model. Histological evaluation through HE staining, PAS staining, and NGAL immunohistochemistry further demonstrated that TSL negated ASIV's restorative effect on proximal tubular damage, whereas Dabu partially alleviated cisplatin‐induced tubular injury (Figure 7C). TUNEL staining indicated that TSL reversed ASIV's anti‐apoptotic effect in cisplatin‐treated mice (Figure 7C). Western blotting analysis revealed that TSL treatment diminished the restorative effects of ASIV on the expression levels of ADRA1A, p‐AMPK/AMPK, p‐FOXO3A/FOXO3A, PGC1A, LC3B, and BNIP3 (Figure 7D).

In summary, these results demonstrate that ADRA1A antagonism attenuates the renoprotective effects of ASIV, while activation of ADRA1A with an agonist mitigates cisplatin‐induced proximal tubular injury.

3.8. ASIV Alleviates Proximal Tubular Injury in an ADRA1A‐Dependent Mechanism In Vitro

In vitro, ADRA1A‐specific siRNA was used to investigate the underlying mechanisms. siRNA2, selected based on its efficient knockdown validated by RT‐qPCR (Figure 8A), was employed in subsequent experiments. Western blotting was initially employed to demonstrate that knockdown of ADRA1A resulted in downregulation of the ADRA1A/AMPK/FOXO3A axis, as well as the expression of proteins involved in mitochondrial biogenesis and mitophagy (Figure 8B). Flow cytometry analysis demonstrated that ADRA1A knockdown abolished the protective effect of ASIV against cisplatin‐induced apoptosis in HK2 cells (Figure 8C). Western blotting further revealed that silencing ADRA1A reversed ASIV's regulatory effects on the AMPK/FOXO3A signaling pathway in cisplatin‐treated HK2 cells (Figure 8D). These results indicate that ADRA1A is essential for the renoprotective effect of ASIV.

FIGURE 8.

ASIV alleviates proximal tubular injury through an ADRA1A‐dependent mechanism in vitro. (A) The mRNA levels of ADRA1A in HK‐2 cells treated with ADRA1A‐siRNA2. (B) Western blotting analysis of ADRA1A, p‐AMPK/AMPK, p‐FOXO3A/FOXO3A, PGC1A, ATG7, LC3B, and BNIP3 expression in HK2 cells treated with CON, siRNA‐ADRA1A groups. (C) Representative images and quantification of cell morphology and flow cytometry analysis of HK2 cells in different treatment groups. (D) Western blotting analysis of ADRA1A, p‐AMPK/AMPK, p‐FOXO3A/FOXO3A, PGC1A, LC3B, and BNIP3 expression in HK2 cells treated with CON, CDDP, CDDP + ASIV, and siRNA‐ADRA1A groups. WB gray values were quantitatively analyzed using ImageJ software. Data are presented as mean ± SEM, ****p < 0.0001, ***p < 0.001, **p < 0.01 or *p < 0.05, compared to the CDDP group; ^### p < 0.001, ^## p < 0.01, or ^# p < 0.05 compared to the CDDP + ASIV group.

4. Discussion

Cisplatin's clinical application is severely limited by nephrotoxicity, and effective countermeasures remain scarce. This study demonstrates that ASIV ameliorates cisplatin‐induced acute kidney injury in mice by improving renal function and reducing proximal tubular damage. Integrated RNA‐seq and scRNA‐seq revealed dysregulated mitophagy and mitochondrial biogenesis, suggesting the ADRA1A‐mediated AMPK/FOXO3A axis as a potential mediator. ASIV upregulated ADRA1A expression and promoted AMPK/FOXO3A phosphorylation, leading to the restoration of mitochondrial homeostasis in proximal tubular cells. Notably, ADRA1A antagonism or silencing abolished ASIV‐induced AMPK/FOXO3A activation and negated its renoprotective effects. These findings position ADRA1A as a novel regulator of mitochondrial quality control and ASIV as a promising candidate for mitigating cisplatin‐induced nephrotoxicity.

Proximal tubular cells are particularly susceptible to cisplatin‐induced injury, with apoptosis, oxidative stress, and inflammation playing critical roles [29]. ASIV (80 mg/kg) protects against tubular damage in db/db mice, prompting an investigation into its effects in cisplatin‐induced acute kidney injury [22]. ASIV is well‐established for its anti‐apoptotic, antioxidant, and anti‐inflammatory properties. To assess its therapeutic potential, the present study tested doses of 20 and 80 mg/kg, based on prior studies. The lower dose had no significant impact on renal function, whereas 80 mg/kg treatment substantially reduced CR and BUN levels and mitigated tubular apoptosis. This dose‐dependent effect is consistent with previous reports of ASIV's renoprotective properties. Importantly, no histological evidence of toxicity was observed with the 80 mg/kg regimen. These findings support 80 mg/kg ASIV as an effective intervention for cisplatin‐induced renal injury.

ADRA1A, also known as the α1A‐adrenergic receptor (α1A‐AR), is a member of the G protein‐coupled receptor family. The functional significance of Adra1a, an unconventional adrenergic receptor, has been demonstrated in adipocytes [30], hepatocytes [31], and cardiomyocytes [32]. Inhibition of ADRA1A has been shown to exacerbate tubular injury in Xenopus laevis [33]. Furthermore, the expression level of ADRA1A correlates negatively with kidney aging [34]. ADRA1A knockout mice exhibit reduced cardiac mitochondrial respiratory capacity, diminished fatty acid oxidation, and impaired electron transport chain activity—defects that can be rescued by ADRA1A agonists [35]. Activation of ADRA1A and its downstream signaling pathways has also been shown to protect against nonalcoholic fatty liver disease and hypoxic myocardial injury [32, 36]. In the present study, ASIV was found to restore ADRA1A protein levels. Notably, ASIV's protective effect was abolished by co‐treatment with tamsulosin, an ADRA1A antagonist, whereas dabuzalgron, an α1A‐AR agonist, partially alleviated cisplatin‐induced nephrotoxicity. Additionally, dabuzalgron has been shown to mitigate doxorubicin‐induced cardiotoxicity by preventing reductions in mitochondrial function‐related transcripts, upregulating PGC1α, maintaining ATP levels, and reducing oxidative stress in the heart [28]. These findings support the conclusion that ASIV mitigates cisplatin‐associated acute kidney injury, at least in part, through the upregulation of ADRA1A expression.

Consistent with previous findings in diabetic kidney disease, this study further establishes that ASIV preserves mitochondrial homeostasis in cisplatin‐induced acute kidney injury [22]. Tubular epithelial cells exhibited significant mitochondrial damage, as evidenced by loss of cristae integrity and a reduced number of organelles. Transcriptomic profiling revealed significant enrichment of AMPK and FOXO signaling pathways, suggesting their role in mitochondrial quality control. Western blotting confirmed that cisplatin suppressed the phosphorylation of AMPK and FOXO3A, indicating inactivation of this pathway. AMPK acts as an upstream kinase that phosphorylates FOXO3A at multiple sites [37]. Inactivation of the AMPK/FOXO3A axis has been implicated as a central mechanism in proximal tubule injury, signifying a disruption in energy metabolism [38, 39]. Remarkably, ASIV treatment restored AMPK/FOXO3A phosphorylation both in vivo and in vitro, and this effect was abolished by ADRA1A antagonism or silencing. These findings identify ADRA1A as an upstream regulator of the AMPK/FOXO3A axis in the renoprotective action of ASIV.

Metformin alleviates cisplatin‐induced ototoxicity through the AMPK/FOXO3A‐mediated autophagy pathway [40]. In contrast, silencing FOXO3A negated the protective effect of AMPK‐associated autophagy enhancement against D‐GalN/LPS‐induced acute liver failure [41]. Our data demonstrated that ASIV enhances the removal of damaged mitochondria via PINK1/LC3B‐mediated mitophagy, while simultaneously stimulating mitochondrial biogenesis through a PGC1α‐dependent pathway. Importantly, these coordinated effects on mitochondrial turnover were dependent on ADRA1A‐mediated activation of the AMPK/FOXO3A axis. Public RNA‐seq analyses consistently showed that ADRA1A and mitochondrial biogenesis/mitophagy genes were markedly down‐regulated in multiple acute kidney injury models (IRI, folic acid, LPS), with scRNA‐seq further localizing their low expression in proximal tubular cells. These findings suggest that ASIV maintains mitochondrial homeostasis through the integrated enhancement of PINK1/LC3B‐mediated mitophagy and PGC1α‐dependent mitochondrial biogenesis, thereby preserving renal tubular cells.

However, single‐cell RNA sequencing analysis in our study revealed that ADRA1A was abundantly expressed in fibroblasts and was markedly downregulated following cisplatin treatment. Fibroblasts have been reported to play a pivotal role in initiating renal fibrosis during the transition from acute kidney injury to chronic kidney disease [42, 43]. Notably, mitochondrial dysfunction in renal interstitial fibroblasts has been shown to drive their functional and phenotypic transformation toward a pro‐fibrotic phenotype, accompanied by the secretion of inflammatory factors and impaired mitophagy [44]. In fact, the role of ADRA1A in renal fibroblasts remains poorly characterized. We speculate that reduced fibroblast ADRA1A expression may contribute to cisplatin nephrotoxicity and that ASIV may exert protection, though these hypotheses await validation in fibroblast‐specific studies.

In conclusion, ASIV functions as a promising and well‐tolerated protective agent against cisplatin‐induced renal injury. This study expands the potential therapeutic repertoire by highlighting ASIV as a candidate up‐regulator of ADRA1A expression for the treatment of cisplatin‐associated acute kidney injury. Further mechanistic investigations revealed that ASIV enhances the phosphorylation of AMPK/FOXO3A, stimulates mitophagy, promotes mitochondrial biogenesis, and suppresses apoptosis in RTECs.

Author Contributions

Meng Wang: data curation, formal analysis, investigation, methodology, visualization, writing – original draft, writing – review and editing. Wang Peng: data curation, investigation, methodology, validation, visualization, writing – original draft, writing – review and editing. Yani Wei: conceptualization, project administration, supervision, writing – review and editing. Hangxing Yu: project administration, supervision, validation, writing – review and editing. Yan Luo: project administration, supervision, writing‐review and editing. Qin Zhang: methodology, visualization, funding acquisition, writing – review and editing. Xu Guan: data curation, funding acquisition, writing – review and editing. Ying Li: data curation, writing – review and editing. Jianwei Wang and Qiurui Li: conceptualization, formal analysis, methodology, project administration, writing – review and editing. Weijian Xiong: conceptualization, funding acquisition, project administration, supervision, writing – review and editing.

Funding

This work was supported by Chongqing Natural Science Foundation (Grant CSTB2024NSCQ‐MSX1256, CSTB2024NSCQ‐MSX0610), 2025 World Special Project of Traditional Chinese Medicine “Niaoduqing Granules, Yishen Huashi Granules” related research (Grant WFCMS2025011).

Consent

The authors have nothing to report.

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Figure S1: The original picture of Figure 6A (western blot). Protein bands were visually detected using the BIO‐RAD Imaging System (ChemiDocTM Imaging System), the Merge images (Chemiluminescent images + Colorimetric images) was displayed.

Figure S2: The original picture of Figure 6B (western blot). Protein bands were visually detected using the BIO‐RAD Imaging System (ChemiDocTM Imaging System), the Merge images (Chemiluminescent images + Colorimetric images) was displayed.

Figure S3: The original picture of Figure 7D (western blot). Protein bands were visually detected using the BIO‐RAD Imaging System (ChemiDocTM Imaging System), the Merge images (Chemiluminescent images + Colorimetric images) was displayed.

Figure S4: The original picture of Figure 8B (western blot). Protein bands were visually detected using the BIO‐RAD Imaging System (ChemiDocTM Imaging System), the Merge images (Chemiluminescent images + Colorimetric images) was displayed.

Figure S5: The original picture of Figure 8D (western blot). Protein bands were visually detected using the BIO‐RAD Imaging System (ChemiDocTM Imaging System), the Merge images (Chemiluminescent images + Colorimetric images) was displayed.

Data Availability Statement

Raw data is available upon reasonable request to the corresponding author.