Reversing Dysfunction of CCR9⁺ Regulatory T Cells by Targeting the IL-21/IL-17 Axis Improves Type 1 Diabetes

Abstract

Objective

The functional status of regulatory T cells expressing the gut-homing receptor CCR9 (CCR9⁺ Tregs) in type 1 diabetes mellitus (T1DM) remains unclear. This study aims to investigate the functional alterations of CCR9⁺ Tregs in a T1DM model and evaluate the interventional effect of targeting the IL-21/IL-17 axis on their dysfunction.

Methods

The spontaneous T1DM non-obese diabetic (NOD) mouse model was employed. CCR9⁺ and CCR9⁻ Treg subsets were isolated from the spleen by flow cytometry. Their in vitro suppressive capacity on effector T cell (Teff) proliferation was assayed, and cytokine expression was analyzed using flow cytometry and qPCR. In vitro, CCR9⁺ Tregs were treated with different concentrations (50 and 100 ng/mL) of the anti-IL-21 monoclonal antibody (Avizakimab) to assess its effects on IL-21/IL-17A secretion and immunosuppressive function. In vivo, T1DM NOD mice were randomly assigned to a saline control group (n=3) and an Avizakimab treatment group (n=3, 10 mg/kg, tail vein injection, every other day for 2 weeks). Fasting blood glucose levels were monitored, pancreatic insulitis and pathological damage were evaluated by H&E staining, and the proportion of peripheral blood IL-17A⁺ cells was analyzed by flow cytometry.

Results

Compared to CCR9⁻ Tregs, CCR9⁺ Tregs exhibited a significantly reduced ability to suppress Teff proliferation, secreted less of the anti-inflammatory cytokine IL-10, and showed significantly upregulated expression of the pro-inflammatory cytokines IL-17A and IL-21. Avizakimab effectively and dose-dependently inhibited the abnormal secretion of IL-21 and IL-17A by CCR9⁺ Tregs in vitro and restored their suppressive function on Teff proliferation. In vivo, Avizakimab treatment significantly lowered fasting blood glucose levels in T1DM NOD mice, alleviated pancreatic insulitis and pathological damage, and downregulated the proportion of IL-17A⁺ cells in peripheral blood.

Conclusion

In the T1DM milieu, CCR9⁺ Tregs become dysfunctional and shift towards a pro-inflammatory phenotype, thereby exacerbating the autoimmune response. The anti-IL-21 monoclonal antibody Avizakimab can reverse the dysfunction of CCR9⁺ Tregs and ameliorate disease symptoms by inhibiting the IL-21/IL-17 axis, providing a novel potential strategy for the immunotherapy of T1DM and highlighting the translational potential of targeting this axis.

Introduction

Type 1 Diabetes Mellitus (T1DM) is a chronic autoimmune disease mediated by immune system abnormalities. Its core pathological mechanism involves the aberrant activation of the body’s own CD8⁺ T cells and the production of various islet β-cell autoantibodies by B cells. These autoantibodies not only directly contribute to destruction but also cooperate with and amplify T cell attack through processes such as antigen presentation.^1,2 Furthermore, the imbalance in immune regulation between helper T cells (eg, Th1, Th17) and regulatory T cells (Treg) exacerbates the local inflammatory environment in the pancreas, ultimately leading to an absolute deficiency in insulin secretion.^3,4 Among them, the imbalance of Treg differentiation and functional deficiency are considered key factors in the initiation and maintenance of autoimmune processes. Recent studies have revealed that in the peripheral blood of T1DM patients, not only is there a relative reduction in total Treg numbers, but also an aberrant remodeling of Treg subset composition: the frequency of Th1-like Tregs is significantly decreased, and the ratio of Th17-like Tregs to Th17 cells is dysregulated, suggesting that under the inflammatory microenvironment, Tregs lose their original homeostatic regulatory capacity and exhibit a “plasticity defect” with a shift toward a pro-inflammatory phenotype.⁵ Due to unstable Foxp3 expression or the aberrant production of pro-inflammatory cytokines (eg, IFN-γ) by autoreactive T cells, Tregs often show reduced effectiveness. This tendency toward functional instability and phenotypic conversion not only impairs the maintenance of immune tolerance but may also accelerate the evolution of local autoimmune responses in the pancreas toward a pathogenic direction.

In recent years, the role of immune cells expressing the gut-homing receptor CCR9 in T1DM has attracted considerable attention.^6,7 Based on functional differences, CCR9⁺ cells can be mainly classified into two groups: one is the protective CCR9⁺ regulatory T cells, and the other is the pathogenic CCR9⁺ effector T cells.^8–10 The latter can co-express the inflammatory cytokine interleukin-21 (IL-21) and, via the CCR9 receptor on their surface, abnormally migrate from the gut to the pancreas. In the pancreas, they secrete large amounts of IL-21, which strongly promotes the activation and proliferation of cytotoxic T cells, directly intensifying the attack on islet β-cells.^11–13 Animal studies have shown that eliminating or inhibiting these pathogenic CCR9⁺ cells can effectively prevent the onset of diabetes in susceptible mice.¹⁴ The dysregulation of the cytokine network plays a critical driving role in this process. Accumulating evidence indicates that IL‑21 is not only essential for the pathogenic function of CCR9⁺ effector T cells but also plays a complex and paradoxical role in maintaining Treg stability. IL‑21 promotes the differentiation of CD4⁺ T cells into Th17 cells,^15,16 and enhanced Th17‑type immune responses have been shown to accelerate the development of diabetes in NOD mice, whereas neutralization of IL‑17 exerts a protective effect.¹⁷ Furthermore, IL‑21 itself can inhibit the induction and functional maintenance of Tregs; in the absence of IL‑21 signaling, a relative enhancement of Treg‑related immune responses has been observed.¹⁶ Currently, immunomodulatory strategies targeting the IL‑21/IL‑17 signaling axis are being actively explored, and anti‑IL‑21 monoclonal antibodies, including Avizakimab, have entered early‑phase clinical trials for various autoimmune diseases. However, whether CCR9⁺ Tregs also undergo a functional conversion toward a Th17‑like pro‑inflammatory phenotype in the pathological context of T1DM, and what specific role the IL‑21/IL‑17 axis plays in this dynamic process, remain poorly understood.

Nevertheless, the functional changes and specific mechanisms of CCR9⁺ regulatory T cells under disease conditions are not yet fully understood. Based on this, we propose the following scientific hypothesis: under the chronic inflammatory microenvironment of T1DM, the immunoregulatory function of CCR9⁺ Tregs may undergo aberrant transformation, with reduced anti‑inflammatory capacity and abnormal co‑secretion of the pro‑inflammatory cytokines IL‑21 and IL‑17, converting an originally protective cell subset into a potentially pathogenic one; targeting the IL‑21/IL‑17 axis may reverse this dysfunction and ameliorate disease progression. To test this hypothesis, we employed the spontaneous T1DM NOD mouse model and systematically investigated the effects of IL‑17 and IL‑21 on the immune function of CCR9⁺ regulatory T cells through both in vivo and in vitro experiments, aiming to provide an in‑depth analysis of the functional heterogeneity of CCR9⁺ cell subsets and to evaluate the regulatory effect of the anti‑IL‑21 monoclonal antibody Avizakimab on this subset. This study seeks to fill the gap in the understanding of the functional heterogeneity of CCR9⁺ Tregs and to provide new experimental evidence for targeting the IL‑21/IL‑17 pathway in the treatment of type 1 diabetes.

Methods

Preparation of Mouse Peripheral Blood and Splenic Mononuclear Cells

This study used the spontaneous T1DM NOD mouse as a preclinical animal model. T1DM NOD mice were euthanized by isoflurane inhalation overdose: animals were placed in a sealed anesthesia chamber and continuously inhaled 5% isoflurane until respiratory arrest, loss of corneal reflex, and absence of nociceptive reflex were observed. This euthanasia procedure conforms to the guidelines of the American Veterinary Medical Association (AVMA). Peripheral blood was collected (via retro-orbital venous plexus) into anticoagulant tubes, and mononuclear cells were isolated using the Ficoll density gradient centrifugation method. The spleen was aseptically removed, placed on a 70 μm cell strainer, and gently ground to obtain a single-cell suspension. After centrifugation and red blood cell lysis, the cells were washed with PBS buffer via centrifugation and finally resuspended in PBS buffer to obtain a splenic single-cell suspension. This study was approved by the Experimental Animal Ethics Committee of the First Hospital of Jiaxing (Approval No.: JXYY2024-031). All experimental protocols were carried out in accordance with the relevant guidelines and regulations. The laboratory animal production license for the donor animals (SCXK (Zhejiang) 2024-0001) and the laboratory animal facility/user license for the experimental institution (SYXK (Zhejiang) 2022-0015) were both obtained for this study. The authors confirm that they have adhered to the ARRIVE guidelines for the reporting of animal experiments, and a completed ARRIVE checklist is available as supplementary material.

Cell Culture and Grouping

Cells were stained with surface antibodies: CD4 (0.125 µg/test), CD25 (0.06 µg/test), CD127 (5 µL/test), and CCR9 (0.125 µg/test). CD4+CD25-CD127+ effector T cells (Teff) and CD4+CD25+CD127dim regulatory T cells (Tregs) were sorted by flow cytometry. Tregs were further sorted into CCR9+ Tregs and CCR9- Tregs. CCR9- Tregs and CCR9+ Tregs were plated in 6-well plates (1×10⁶ cells per well) according to experimental groups. Avizakimab was added at concentrations of 50 ng/mL and 100 ng/mL per group. Cells were cultured at 37°C with 5% CO₂ for 5 days, after which Tregs were collected. Each group contained three replicates per experiment, and the experiment was independently repeated three times. Experimental groups: CD4+CD25- Teff + CCR9- Tregs; CD4+CD25- Teff + CCR9+ Tregs; CCR9+ Tregs + Avizakimab (50 ng/mL); CCR9+ Tregs + Avizakimab (100 ng/mL).

Flow Cytometric Staining

After 5 days of culture, Tregs from different groups were collected. The cells were washed with 1× Perm/Wash buffer and centrifuged. Each tube received 300 μL of Staining Buffer. Antibodies against IL-17A (Invitrogen, 11-7177-81) and IL-10 (Invitrogen, 11-7101-41) were added at 0.25 µg/test, and all antibodies were titrated in preliminary experiments to determine the optimal working concentrations. Isotype controls were also set. The cells were incubated in the dark for 30 min. After washing twice with 1× Perm/Wash buffer, the cells were resuspended in Staining Buffer and analyzed using a BD FACSVerse flow cytometer. At least 10,000 target cells were collected per sample. Data were analyzed using FlowJo v10 software. The gating strategy was as follows: first, the main cell population was gated using forward scatter (FSC-A) and side scatter (SSC-A); doublets were excluded using FSC-A/FSC-H to obtain a single-cell population; lymphocytes were further gated based on SSC-A/FSC-A; finally, positive cells in the APC and PE channels were analyzed. The positivity threshold was set using isotype controls and fluorescence-minus-one (FMO) controls, with positivity defined as a fluorescence intensity exceeding 99.5% of that of the control channel.

RT-qPCR

Cultured cells were collected or tissue samples were homogenized. Total RNA was extracted using the Trizol method. A total of 2 µg RNA was reverse-transcribed into cDNA. Primers for RT-qPCR were designed using Primer Premier 5.0 software and synthesized by Sangon Biotech (Shanghai). The housekeeping gene Gapdh served as the internal reference. Primer sequences are listed in Table 1. PCR amplification was performed according to the conditions provided by the kit. The real-time fluorescence quantitative PCR instrument automatically analyzed the results. The threshold and baseline were adjusted based on negative controls to determine the Ct value for each sample. The relative expression differences of target genes between control and experimental groups were analyzed using the 2^−ΔΔCT method.

Table 1.

Primer Sequences for Real-Time PCR

Primer	Sequence (5ʹ-3ʹ)	PCR Product Size (bp)
IL-21 (mouse)-RT-F	TTCATCATTGACCTCGTG	121bp
IL-21 (mouse)-RT-R	CTTTGGGTGTCCTTTTCT
IL-17A (mouse)-RT-F	AACACTGAGGCCAAGGAC	113bp
IL-17A (mouse)-RT-R	GTGGAACGGTTGAGGTAG
GAPDH (mouse)-RT-F	GGTGAAGGTCGGTGTGAACG	233bp
GAPDH (mouse)-RT-R	CTCGCTCCTGGAAGATGGTG

Immunosuppression Rate Assay

A 10 mM CFSE stock solution was prepared and diluted with serum-free RPMI-1640 to obtain a 1 μM CFSE working solution. CD4+CD25- Teff cells were incubated with the CFSE working solution at room temperature for 30 minutes. Tregs were co-cultured with different groups of Teff cells (CD4+CD25- Teff + CCR9- Tregs; CD4+CD25- Teff + CCR9+ Tregs) at a 1:1 ratio, stimulated with anti-CD3/CD28 antibodies, and cultured for 5 days. The CFSE intensity of Teff cells was then analyzed by flow cytometry, and the immunosuppression rate of Tregs was calculated using the formula: Immunosuppression Rate = [1 − (Proliferation Index of Teff in experimental group/Proliferation Index of Teff in control group)] * 100%.

Animal Grouping

Two-week-old NOD mice were designated as the V-1 group (intravenous injection of normal saline every other day for 2 weeks, n=3). Eighteen-week-old T1DM NOD mice were completely randomized using a computer-generated random number sequence into two groups: the V-2 group (intravenous injection of normal saline every other day for 2 weeks, n=3) and the V-3 group (intravenous injection of Avizakimab (10 mg/kg) every other day for 2 weeks, n=3) (sample sizes were determined based on preliminary experiments and published references; no formal power calculation was performed). The administration procedure was single-blinded (the operator was unaware of group allocation, as Avizakimab and normal saline were identical in appearance). All outcome assessments (blood glucose, flow cytometry, pathological scoring) were performed by researchers blinded to group allocation, and blinding was maintained during data analysis.

HE Staining for Pathological Examination of Pancreatic Tissue in T1DM Mice

Pancreatic tissues from differently treated mice were dehydrated using a graded alcohol series, cleared with xylene, and infiltrated with three changes of paraffin (60°C): Paraffin I (1h) - Paraffin II (1h) - Paraffin III (1h). After embedding in paraffin, tissues were sectioned with a microtome. Sections were deparaffinized, stained with Mayer’s hematoxylin, counterstained with eosin for 5 minutes, and then sequentially placed in 95% alcohol for 30 seconds, followed by absolute ethanol I, absolute ethanol II, xylene I, and xylene II for 5 minutes each. Finally, sections were mounted with neutral balsam and photographed under a microscope to observe the morphology of pancreatic islets.

Statistical Analysis

Graphpad Prism 7.0 software was used for plotting graphs and statistical analysis. FlowJo10 was used to analyze flow cytometry data, and Image J was used for pathological scoring of H&E-stained sections. Quantitative data are presented as mean ± standard deviation (mean ± SD). Prior to parametric testing, data were tested for normality (Shapiro–Wilk test) and homogeneity of variances (Levene’s test). When assumptions were violated, Welch’s correction or non‑parametric tests were applied as appropriate. Comparisons between two groups were performed using Student’s t-test, and comparisons among multiple groups were performed using one-way analysis of variance (ANOVA). A two-sided P value < 0.05 was considered statistically significant.

Results

CCR9+ Tregs Exhibit Significantly Downregulated Immunoregulatory Function

CCR9- Tregs and CCR9+ Tregs were co-cultured with CD4+CD25- Teff cells, respectively. Flow cytometry results indicated that the CCR9+ Treg co-culture group exhibited a lower suppression rate on Teff cells (Figure 1).

Figure 1.

The immunoregulatory function of CCR9+ Tregs is significantly downregulated. Flow cytometry CFSE peak plots (A) and statistical graphs (B) (****P<0.0001 in comparison with the CD4+CD25-Teff+CCR9-Tregs group.). Experimental conditions: CD4⁺CD25⁻ Teff cells were labeled with 1 μM CFSE and co‑cultured with Treg subsets at a 1:1 ratio for 5 days with anti‑CD3/CD28 stimulation, as described in Methods.

IL-17A Expression is Significantly Upregulated, and IL-10 Expression Is Significantly Downregulated in the CCR9+ Tregs Group

After co-culturing CCR9-Tregs and CCR9+ Tregs separately with CD4+CD25-Teff cells, flow cytometry results demonstrated that the CCR9+ Tregs co-culture group exhibited significantly upregulated IL-17A expression (Figure 2A) and significantly downregulated IL-10 expression (Figure 2B).

Figure 2.

IL-17A expression is significantly upregulated, and IL-10 expression is significantly downregulated in the CCR9+ Tregs group. Flow cytometry peak plots and statistical graphs show IL-17A expression (A) and IL-10 expression (B) (****P<0.0001 in comparison with the CD4+CD25-Teff+CCR9-Tregs group.). Experimental conditions: Co‑culture was performed as in Figure 1, followed by intracellular staining with IL-17A and IL-10 antibodies (0.25 µg/test) according to Methods.

Avizakimab Significantly Downregulates IL-21 and IL-17A Expression in CCR9+ Tregs

Compared to CCR9- Tregs, both flow cytometry (Figure 3A and B) and PCR (Figure 3C) showed significantly upregulated expression of IL-21 and IL-17A in CCR9+ Tregs. The addition of Avizakimab significantly inhibited the expression of IL-21 and IL-17A. Furthermore, a higher concentration of Avizakimab (100 ng/mL) downregulated IL-21 and IL-17A expression more markedly.

Figure 3.

Avizakimab Significantly Downregulates IL-21 and IL-17A Expression in CCR9+ Tregs. Flow cytometry histogram plots depicting IL-21 expression and the corresponding statistical graph (A); Flow cytometry histogram plots depicting IL-17A expression and the corresponding statistical graph (B); PCR analysis showing the relative expression of IL-21 and IL-17A (C). (***P<0.001, ****P<0.0001 vs CCR9- Tregs+PBS group; ^##P<0.01, ^####P<0.0001 vs CCR9⁺ Tregs+PBS group; ^&&P<0.01, ^&&&P<0.001, ^&&&&P<0.0001 vs CCR9⁺ Tregs+PBS+IgG group; ^$$P<0.01, ^$$$P<0.001 vs CCR9⁺ Tregs+Avizakimab (50 ng/mL) group.). Experimental conditions: CCR9⁺ Tregs were cultured at 1×10⁶ cells/well with Avizakimab (50 or 100 ng/mL) for 5 days. Flow cytometry and qPCR were performed as described in Methods.

Figure 3.

continued.

Avizakimab Reverses the Immunosuppressive Effect of CCR9+ Tregs

After adding Avizakimab to the co-culture system of CD4+CD25- Teffs and CCR9+ Tregs, flow cytometric CFSE results indicated that the CFSE proliferation in the CD4+CD25- Teffs+CCR9+ Tregs+Avizakimab (50 ng/mL) and CD4+CD25- Teffs+CCR9+ Tregs+Avizakimab (100 ng/mL) groups was significantly downregulated. Moreover, the effect of reversing the immunosuppressive function of CCR9+ Tregs was stronger in the group treated with the higher concentration of Avizakimab (100 ng/mL) (Figure 4).

Figure 4.

Avizakimab Reverses the Immunosuppressive Effect of CCR9+ Tregs. Flow cytometric CFSE histogram plots (A) and the corresponding statistical graph (B) (****P<0.0001 vs CD4+CD25- Teffs+CCR9⁺ Tregs+PBS group; ^####P<0.0001 vs CD4+CD25- Teffs+CCR9⁺ Tregs+IgG group; andandandP<0.001 vs CD4+CD25- Teffs+CCR9⁺ Tregs+Avizakimab (50 ng/mL) group.). Experimental conditions: Co‑culture of CFSE‑labeled Teff cells with CCR9⁺ Tregs (1:1) in the presence of Avizakimab (50 or 100 ng/mL) for 5 days with anti‑CD3/CD28 stimulation.

Avizakimab Significantly Improves Blood Glucose Levels in a Type 1 Diabetic Mouse Model by Reversing Pancreatic Tissue Inflammation

Compared with the V-1 group, the fasting blood glucose levels in the V-2 group mice were significantly increased; compared with the V-2 group, the fasting blood glucose levels in the V-3 group mice were significantly decreased (Figure 5A). HE staining results showed that, compared to the V-1 group, the pancreatic structure in the V-2 group was disordered, islet morphology was unclear, the number of islet cells was reduced, and islet area was significantly diminished. Avizakimab intervention markedly reversed pancreatic tissue inflammation (Figure 5B).

Figure 5.

Avizakimab Significantly Improves Blood Glucose Levels in a Type 1 Diabetic Mouse Model by Reversing Pancreatic Tissue Inflammation. Blood glucose levels in mice (A), HE staining of the pancreas and corresponding pathological scoring statistics (B) (****P<0.0001 vs V-1 group; ^####P<0.0001 vs V-2 group.). Experimental conditions: V-1 (healthy control, saline), V-2 (T1DM+ saline), V-3 (T1DM+ Avizakimab 10 mg/kg, i.v. every other day for 2 weeks). Blood glucose was measured, and pancreatic sections were stained with H&E as described in Methods.

Avizakimab Significantly Inhibits IL-17A Expression in CCR9+ Tregs

Flow cytometry (Figure 6A) and PCR (Figure 6B) experiments demonstrated that compared with the V-1 group, IL-17A+ expression was significantly increased in the V-2 group; intervention with Avizakimab in the V-3 group significantly decreased the expression of IL-17A+ in the peripheral blood of mice.

Figure 6.

Avizakimab significantly inhibits IL-17A expression in CCR9⁺ Tregs. Flow cytometry histogram overlays depict IL-17A expression along with statistical analysis (A); PCR shows the relative expression of IL-17A (B) (**Comparison groups and P values: ** **P<0.0001 vs V-1 group; ^####P<0.0001 vs V-2 group.). Experimental conditions: Peripheral blood from mice in each group was collected, and IL-17A expression in lymphocytes was analyzed by flow cytometry and qPCR.

Discussion

This study reveals profound functional dysregulation of gut-homing CCR9⁺ regulatory T cells in a T1DM model: their immunosuppressive function was significantly downregulated, accompanied by upregulation of IL-17A and downregulation of IL-10, leading to a conversion toward a pro-inflammatory phenotype that exacerbates islet autoimmune damage. Notably, the IL-21-targeting monoclonal antibody Avizakimab effectively inhibited the aberrantly elevated expression of IL-21 and IL-17A in CCR9⁺ Tregs, and both in vitro and in vivo restored their immunosuppressive function in a dose-dependent manner, ultimately reversing pancreatic inflammation and improving blood glucose levels. This finding suggests that Avizakimab, through dual inhibition of the IL-21/IL-17 axis, may represent a novel strategy for correcting CCR9⁺ Treg function in the treatment of T1DM.

These results expand the understanding of the complex biological functions of CCR9. CCR9 not only serves as a key receptor mediating lymphocyte homing to the gut, but its signaling also exerts an inhibitory effect on the development of Treg cells,^18,19 as confirmed in knockout models and in vitro studies.¹⁰ In T1DM, CCR9 guides functionally opposing cell subsets (CCR9⁺ Tregs and CCR9⁺ effector T cells) to co-home to the pancreas. Unlike the increase in CCR9⁺ IL-17⁺ Tregs observed previously in necrotizing enterocolitis,²⁰ this study reveals that within the pancreatic microenvironment of T1DM, CCR9⁺ Tregs play a unique pathogenic role, with their dysfunction being directly linked to the aggravation of local inflammation. This contrast highlights the highly context-dependent functionality of CCR9⁺ Tregs.

Mechanistically, this study elucidates a unique pathogenic pathway of CCR9 signaling in T1DM, as illustrated in Figure 7. Unlike its role in inflammatory bowel disease where it drives CD4⁺ T cell migration through complex formation with dopamine receptor DRD5,^21,22 the present research reveals that in T1DM, CCR9⁺ Tregs aberrantly enhance the secretion of IL-21 and IL-17A, which in turn promotes the proliferation of CD4⁺ effector T cells via a paracrine mechanism, thereby directly driving insulitis. The successful blockade of this pathway by Avizakimab provides critical mechanistic support for its clinical translation and underscores the importance of targeting tissue-specific immune microenvironments. However, the in vitro experiments in this study used purified cell co‑culture systems, which do not fully recapitulate the complex cytokine network in vivo. An alternative interpretation is that CCR9⁺ Tregs themselves do not acquire a stable Th17 phenotype but rather exist in a “transitional state” — transiently upregulating IL‑17A under inflammatory conditions, while the true pathogenic effects may be mediated by other helper T cell subsets (eg, Th17.1 cells). In addition, the observed upregulation of IL‑21 might partly result from feedback activation of the IL‑21 receptor on Tregs rather than active secretion. To distinguish among these possibilities, future experiments should include single‑cell RNA sequencing, blockade assays during intracellular cytokine staining (eg, using protein transport inhibitors), and lineage‑tracing studies (eg, Foxp3 fate mapping) to verify Treg stability.

Figure 7.

Schematic diagram of the unique pathogenic pathway and therapeutic target of CCR9 signaling in T1DM.

Notes: CCR9⁺ Tregs reduce their inhibitory effect on Teff proliferation by decreasing the anti-inflammatory factor IL-10 and upregulating the pro-inflammatory factors IL-17A and IL-21, thereby inducing the onset of T1DM. Avizakimab provides a novel target for the immunotherapy of T1DM by effectively inhibiting the abnormal secretion of IL-21 and IL-17A by CCR9⁺ Tregs and restoring their inhibitory effect on Teff proliferation.

Avizakimab is a humanized anti‑IL‑21 monoclonal antibody that has shown favorable safety and preliminary efficacy in early‑phase clinical trials for several autoimmune diseases (eg, systemic lupus erythematosus, rheumatoid arthritis, Crohn’s disease).²³ In the field of T1DM, a Phase II clinical trial in newly diagnosed T1DM patients²⁴ evaluated another IL‑21 blocking agent in combination with liraglutide and found that the regimen delayed the decline of β‑cell function; however, the efficacy of IL‑21 blockade alone remains to be validated. The preclinical evidence from our study suggests that Avizakimab may exert a more specific therapeutic effect by restoring the function of CCR9⁺ Tregs. Nevertheless, it should be noted that the IL‑21 monoclonal antibody in the above clinical trials did not completely halt disease progression, indicating that IL‑21 inhibition alone may not be sufficient to cure T1DM, and that combination immunomodulatory strategies might be preferable. Therefore, the translational implication of our findings should be interpreted as “providing a new target for combination therapy” rather than as an independent monotherapy.

Conclusion

This study preliminarily demonstrates that in the pathological microenvironment of T1DM, CCR9⁺ regulatory T cells exhibit reduced immunosuppressive function and a shift toward a pro-inflammatory phenotype characterized by elevated IL-21 and IL-17A expression. Furthermore, targeting the IL-21/IL-17 axis with the anti-IL-21 monoclonal antibody Avizakimab reverses the functional defects of CCR9⁺ Tregs in vitro and improves blood glucose levels and pancreatic inflammation in NOD mice in vivo. These findings provide new experimental evidence for understanding the functional heterogeneity of CCR9⁺ Tregs and their role in immune imbalance in T1DM, and offer preliminary preclinical evidence supporting immunotherapeutic strategies targeting the IL-21/IL-17 signaling pathway.

It should be acknowledged that this study has certain limitations, including a small sample size, lack of long-term efficacy and safety evaluation of Avizakimab, and unresolved molecular mechanisms underlying the phenotypic conversion of CCR9⁺ Tregs (eg, Foxp3 stability and changes in surface markers such as CD127). Therefore, the current conclusions should be regarded as preliminary findings rather than definitive proof of therapeutic efficacy. Future studies with larger animal cohorts, long-term efficacy assessments, and mechanistic investigations are necessary to validate these results and establish a more solid foundation for precision immunotherapy in T1DM.

Funding Statement

This research has received funding by the Medical and Health Science Program of Zhejiang Province (NO.: 2025KY350).

Data Sharing Statement

The data used to support the findings of this study are included within the article.

Ethics Statement

This study was approved by the Experimental Animal Ethics Committee of the First Hospital of Jiaxing (Approval No.: JXYY2024-031). All experimental protocols were carried out in accordance with the relevant guidelines and regulations. The laboratory animal production license for the donor animals (SCXK (Zhejiang) 2024-0001) and the laboratory animal facility/user license for the experimental institution (SYXK (Zhejiang) 2022-0015) were both obtained for this study.

Author Contributions

Yulian Xia: Data curation, Formal analysis, Writing – original draft, Writing – review and editing. Qing He: Formal analysis, Writing – review and editing. Yuhui Yao: Writing – original draft, Data curation. Lei Yang: Writing–original draft, Data curation. Shanshan Zhan: Writing–original draft, Data curation. Shunfeng Mao: Writing–original draft, Data curation.

All authors gave final approval for the version to be published; have agreed on the journal to which the article has been submitted; and agreed to be accountable for all aspects of the work.

Disclosure

The authors have no conflicts of interest to declare.