Skip to main content
NCBI home page
Biochemistry and Biophysics Reports logoLink to Biochemistry and Biophysics Reports
. 2026 Aug 26;47:102763. doi: 10.1016/j.bbrep.2026.102763

Complex interactions between miR-107 and PTEN gene expression, more specifically in viral and NASH cirrhosis

Sara Motiee a, Heidar Tayebinia a, Nazanin Jalilian b, Zahra Ghorbani b, Sina Mohagheghi a,⁎
PMCID: PMC13544293  PMID: 42699728

Abstract

Background

microRNAs play critical roles in modulating the molecular pathways involved in liver fibrosis. miR-107 has been reported to be elevated in the liver of patients with non-alcoholic fatty liver disease (NAFLD), and it is believed to regulate the PTEN gene, a negative regulator of the PI3K/PTEN/Akt signaling cascade. The PI3K/Akt pathway responds to metabolic stimuli like insulin and growth factors, influencing key functions such as lipid and glucose metabolism. In addition, hypoxia-inducible factors (HIFs), particularly HIF-2α, are also involved in liver metabolism and may contribute to lipid synthesis by activating the same signaling axis. The present study aimed to examine the gene expression patterns of miR-107, PTEN, Akt, and HIF-2α in liver tissue of patients with simple steatosis and cirrhosis.

Methods

This case-control study assessed the gene expression levels using quantitative real-time PCR (qRT-PCR) in liver tissues from individuals with simple steatosis (n = 6), cirrhosis (n = 32), and histologically normal controls (n = 7).

Results

miR-107 expression was significantly increased in cirrhotic tissues compared with controls (p < 0.05). The increase was mostly related to viral cirrhosis. PTEN expression was reduced in both disease groups; however, this decline reached statistical significance only in the NASH cirrhosis (p < 0.01). Also, HIF-2α and Akt gene expression decrease and increase in cirrhosis, respectively. No correlation was detected between miR-107 and PTEN gene expressions in liver tissues.

Conclusion

These findings suggest that there are complex interactions between miR-107 and PTEN gene expression. Apparently, Increased miR-107 expression in viral cirrhosis and reduced PTEN expression in NASH cirrhosis suggest potential associations with specific cirrhosis etiologies.

Keywords: PTEN, Cirrhosis, miR-107, NAFLD

Highlights

  • •

    Increased expression of miR-107 as a regulatory response to chronic liver disease.

  • •

    Major involvement of PTEN in NASH-induced cirrhosis.

  • •

    High complexity of the interaction between miR-107 and PTEN.

1. Introduction

Chronic liver conditions such as cirrhosis, hepatitis viruses, and liver malignancies are responsible for over two million annual deaths, constituting around 4% of global mortality [1]. Among liver diseases, cirrhosis holds particular significance. It is a progressive and irreversible condition characterized by extensive fibrosis and disruption of both liver function and structure [2]. Cirrhosis ranks as the 14th leading cause of death among adults globally, responsible for approximately 1.3 million deaths each year [3]. A range of factors underlie cirrhosis development, including chronic infections like Hepatitis B virus (HBV) and Hepatitis C virus (HCV), prolonged alcohol intake, nonalcoholic fatty liver disease (NAFLD), autoimmune liver disorders, and cholestatic diseases such as primary sclerosing cholangitis (PSC). In certain cases, the cause remains unclear or is classified as cryptogenic [4]. If left untreated, cirrhosis may lead to serious complications, including esophageal varices, ascites, hepatic encephalopathy, and hepatocellular carcinoma [2].

NAFLD, one of the prominent causes of cirrhosis, is defined by fat buildup in over 5% of hepatocytes, in the absence of known causes like alcohol or drug use. It represents a disease continuum starting from simple steatosis, progressing to nonalcoholic steatohepatitis (NASH), and potentially advancing to fibrosis and cirrhosis [5,6]. As obesity and diabetes rates rise globally, NAFLD is anticipated to become a leading driver of liver-related illnesses and transplant needs in the coming years [7].

A recent research has emphasized the influence of microRNAs (miRNAs) in liver fibrosis and cirrhosis [8]. miRNAs are small, non-coding RNA fragments that primarily suppress gene expression at the post-transcriptional level, playing critical roles across biological functions [9]. Dysregulated miRNA expression has been documented in various types of liver fibrosis. These molecules typically impact fibrosis by modulating the activity of hepatic stellate cells (HSCs) and promoting hepatocyte death [8]. miR-107, in particular, shows elevated levels in liver tissues of individuals with NAFLD and NASH [10]. This miRNA has been shown to enhance adipogenesis and regulate lipid metabolism and insulin sensitivity [11]. Several studies have reported that miR-107 regulates the expression of the PTEN gene. For instance, in bladder cancer, miR-107 modulates cell proliferation and PI3K/PTEN/Akt pathway activity by directly targeting PTEN [12]. Similarly, in gastric cancer tissues, PTEN mRNA levels were found to be inversely correlated with miR-107 expression [13]. However, whether a similar relationship exists in human cirrhotic liver tissue remains unclear.

PTEN functions as a phosphatase that deactivates the PI3K/PTEN/Akt pathway by removing phosphate groups from PIP3 molecules [14]. Impaired PTEN signaling contributes to the onset of liver ailments such as fatty liver, steatohepatitis, fibrosis, cirrhosis, and cancer [15]. The PI3K/PTEN/Akt axis plays a central role in managing cell proliferation and metabolism. It is responsive to growth factors, insulin, and cytokines, regulating key processes like glucose utilization, lipid metabolism, and protein synthesis [16]. PI3K generates PIP3, which activates Akt through phosphorylation steps involving PDK1 and mTORC2 [17]. Akt, in turn, phosphorylates numerous target proteins, thereby stimulating various insulin-dependent cellular responses that regulate glucose and triglyceride metabolism in the liver [18]. There is evidence linking Akt activity to lipid buildup in liver tissue [19]. Additionally, Akt supports liver fibrosis by promoting HSC activation and enhancing matrix protein production [20].

Aside from miRNAs, hypoxia-inducible factors (HIFs) are transcriptional regulators responding to oxygen level changes and are crucial in hepatic metabolism. Persistent activation of HIFs has been associated with fat accumulation, inflammation, and even tumor development in the liver [21]. Recent evidence indicates that HIF-2α activates hepatic stellate cells by enhancing glutamine catabolism and inhibiting YAP protein phosphorylation, thereby promoting liver fibrosis [22]. Qu et al. further demonstrated, using an animal model with liver-specific deletion of the Vhl gene—which activates HIF-2α—that HIF-2α activation results in increased hepatic fat accumulation (steatosis), inflammation, and upregulation of fibrogenic genes [21]. Another study underlined how HIF-2α overexpression under low-oxygen conditions, enhances the PI3K/Akt pathway and lipid production, aggravating hepatocellular carcinoma risk in NAFLD patients. Also Inhibiting HIF-2α reduced triglyceride buildup and tumor progression in animal models, suggesting its potential as a treatment target [23]. Considering the contributions of miR-107, PTEN/Akt signaling, and HIF-2α in regulating liver cell responses and fibrotic processes, studying their roles may clarify cirrhosis pathogenesis and support the development of targeted liver therapies. Therefore, the present study aimed to investigate the expression patterns of miR-107, PTEN, Akt1, and HIF-2α in liver tissues from patients with simple steatosis and cirrhosis of different etiologies. In addition, based on previous findings reported in other tissues and disease models, we explored whether an association exists between miR-107 and PTEN expression in human liver tissue.

2. Materials and methods

2.1. Study design and participants

This research adopted a case-control design, enrolling 32 individuals who were candidates for orthotopic liver transplantation due to cirrhosis. The study was conducted at the Namazi Transplant Center, part of Shiraz University of Medical Sciences, Shiraz, Iran. Eligible participants included individuals with cirrhosis caused by conditions such as NASH, autoimmune hepatitis (AIH), viral hepatitis (HBV/HCV), PSC, or cryptogenic origins. Prior to transplantation, blood samples were collected, and liver tissue samples were retrieved from the explanted organs.

Additionally, 6 samples with simple steatosis and 7 normal liver tissue samples were collected from patients undergoing hepatic resections for metastatic tumors at Shiraz Central Hospital. These control patients had no prior chemotherapy or significant medical intervention. The diagnosis of liver cirrhosis and the histological normality of the control tissues were confirmed by an experienced hepatopathologist.

2.2. RNA extraction and qRT-PCR

Total RNA was isolated from liver tissue using TrizoLEX reagent following the manufacturer's protocol. RNA concentration and purity were assessed using a NanoDrop spectrophotometer by measuring the A260/A280 ratio, while RNA integrity was evaluated by agarose gel electrophoresis. The RNA was then reverse transcribed into complementary DNA (cDNA) using a commercial cDNA synthesis kit from Parstous (Mashhad, Iran). For RNU6 and miR-107, specific cDNA synthesis kits and stem-loop primers were employed (Anacell, Tehran, Iran). All Quantitative real-time PCR (qRT-PCR) reactions were performed in technical duplicate, and the mean Ct value of the two replicates was used for subsequent analyses. Relative mRNA expression levels were normalized to Beta Actin (ACTB), whereas miRNA expression levels were normalized to RNU6. Relative gene expression was calculated using the 2^-ΔΔCt method. PCR amplification efficiency was evaluated using LinRegPCR software prior to data analysis.

qRT-PCR was carried out using gene-specific primers, as listed in Table 1.

Table 1.

List of primers.

PTEN Human Forward CTCAGCCGTTACCTGTGTGT
Human Reverse AGGTTTCCTCTGGTCCTGGT
Akt Human Forward ACACCACCTGACCAAGATGAC
Human Reverse ATCCCTCCAAGCTATCGTCCA
HIF-2α Human Forward ACACAAGCTCCTCTCCTCAGT
Human Reverse GTCACCACGGCAATGAAACC
ACTB Human Forward GAGCCTCGCCTTTGCCGATCC
Human Reverse ACATGCCGGAGCCGTTGTCG
Open in a new tab

2.3. Statistical analysis

Data analyses were performed with SPSS software (version 16.0; SPSS Inc., Chicago, IL, USA). The normality of continuous variables was assessed using the Shapiro–Wilk test. Comparisons between the control group and the overall cirrhosis group were performed using the independent t-test for normally distributed variables or the Mann–Whitney U test for non-normally distributed variables. Comparisons among cirrhosis etiological subgroups were performed using one-way ANOVA for normally distributed variables, followed by Tukey's post-hoc test for pairwise multiple comparisons. For non-normally distributed variables, the Kruskal–Wallis test was used, followed by Dunn's post-hoc test with Bonferroni correction for multiple pairwise comparisons.

Results are presented as mean ± standard error of the mean (SEM). Correlations were assessed using Spearman's rank coefficient, and statistical significance was set at p < 0.05.

3. Results

3.1. Participant demographics and clinical findings

Table 2 summarizes the demographic characteristics of the study population. Liver tissue samples were classified as follows: 32 from cirrhotic patients, 6 from individuals with simple steatosis, and 7 from healthy controls. The cirrhosis group included cases with various etiologies: NASH (n = 7), PSC (n = 5), AIH (n = 6), HBV/HCV (n = 6), and cryptogenic causes (n = 8).

Table 2.

Demographic data of the patients with NASH, PSC, AIH, HBV/HCV-related cirrhosis and cryptogenic cirrhosis and control.

Control NASH PSC AIH HBV/HCV Cryptogenic
No. of subjects 7 7 5 6 6 8
Sex (male) 4 5 0 2 5 3
Age (year) 44.5 ± 6.3 52 ± 9.8 29.8 ± 10.7 32.3 ± 13.7 54.5 ± 6.4 54.7 ± 6
MELD 7.8 ± 1.5 20.4 ± 0.3** 19 ± 5.4 * 23.5 ± 0.2*** 24.1 ± 8.3 *** 21.6 ± 9.3***
Open in a new tab

Nonalcoholic steatohepatitis (NASH); Primary sclerosing cholangitis (PSC); Autoimmune hepatitis (AIH); Hepatitis B virus (HBV); Hepatitis C virus (HCV).

Results are presented as mean ± SD (*P < 0.05; **P < 0.01; and ***P < 0.001).

3.2. Expression levels of miR-107

miR-107 expression was significantly higher in cirrhotic liver tissues than in controls (p < 0.05), with no significant differences among the cirrhosis subtypes (Fig. 1A and B). When comparing the steatosis group, NASH-induced cirrhosis group, and healthy controls, both patient groups exhibited higher miR-107 levels compared to controls, but there was no significant difference between the two disease groups (Fig. 1C).

Fig. 1.

Fig. 1

Open in a new tab

A) Changes in miR-107 expression in liver tissue of patients with cirrhosis (n = 32) and control liver tissues (n = 7). B) changes in miR-107 expression in liver tissue of patients with NASH (n = 7), PSC (n = 5), AIH (n = 6), HBV/HCV-related cirrhosis (n = 6), cryptogenic cirrhosis (n = 8) and control liver tissues (n = 7). C) changes in miR-107 expression in liver tissue of patients with simple steatosis (n = 6), NASH-related cirrhosis (n = 7) and control liver tissues (n = 7). (*p < 0.05).

3.2.1. Evaluation of the PI3K/PTEN/Akt pathway

Although PTEN expression was generally reduced in cirrhotic tissues compared with controls (Fig. 2A), this decrease reached statistical significance only in the NASH-related cirrhosis subgroup (p < 0.01). The other cirrhosis subtypes (PSC, cryptogenic, AIH, and HBV/HCV) did not show significant differences compared with the control group (Fig. 2B).

Fig. 2.

Fig. 2

Open in a new tab

A) Changes in PTEN gene expression in liver tissue of patients with cirrhosis (n = 32) and control liver tissues (n = 7). B) changes in PTEN expression in liver tissue of patients with NASH (n = 7), PSC (n = 5), AIH (n = 6), HBV/HCV-related cirrhosis (n = 6), cryptogenic cirrhosis (n = 8) and control liver tissues (n = 7). C) changes in PTEN expression in liver tissue of patients with simple steatosis (n = 6), NASH-related cirrhosis (n = 7) and control liver tissues (n = 7). (*p < 0.05, **p < 0.01 and ***p < 0.001).

Among the cirrhosis subgroups, PTEN expression was significantly lower in the NASH group compared with the AIH (p < 0.001) and HBV/HCV (p < 0.01) groups. A significant difference was also observed between the AIH and cryptogenic cirrhosis groups (p < 0.05) (Fig. 2B). Furthermore, PTEN expression differed significantly between patients with simple steatosis and those with NASH-related cirrhosis (p < 0.05) (Fig. 2C).

In contrast, Akt gene expression did not differ significantly between cirrhotic tissues and healthy controls. However, a significant difference was observed between the viral hepatitis and cryptogenic cirrhosis groups (p < 0.001) (Fig. 3A and B). Likewise, Akt levels showed no significant change when comparing steatosis and NASH-related cirrhosis group (Fig. 3C).

Fig. 3.

Fig. 3

Open in a new tab

A) Changes in Akt gene expression in liver tissue of patients with cirrhosis (n = 32) and control liver tissues (n = 7). B) changes in Akt expression in liver tissue of patients with NASH (n = 7), PSC (n = 5), AIH (n = 6), HBV/HCV-related cirrhosis (n = 6), cryptogenic cirrhosis (n = 8) and control liver tissues (n = 7). C) changes in Akt expression in liver tissue of patients with simple steatosis (n = 6), NASH-related cirrhosis (n = 7) and control liver tissues (n = 7). (***p < 0.001).

3.3. HIF-2α expression analysis

HIF-2α gene expression appeared reduced in cirrhotic tissues, but this decline was not statistically significant (Fig. 4A). No significant differences in HIF-2α expression were found among the cirrhosis subtypes or when compared with controls (Fig. 4B). Similarly, although slightly higher HIF-2α levels were observed in the steatosis group, this difference was not statistically significant (Fig. 4C).

Fig. 4.

Fig. 4

Open in a new tab

A) Changes in HIF-2α gene expression in liver tissue of patients with cirrhosis (n = 32) and control liver tissues (n = 7). B) changes in HIF-2α expression in liver tissue of patients with NASH (n = 7), PSC (n = 5), AIH (n = 6), HBV/HCV-related cirrhosis (n = 6), cryptogenic cirrhosis (n = 8) and control liver tissues (n = 7). C) changes in HIF-2α expression in liver tissue of patients with simple steatosis (n = 6), NASH-related cirrhosis (n = 7) and control liver tissues (n = 7).

4. Discussion

Cirrhosis of the liver is a common health issue that leads to a significant number of deaths annually. Multiple elements contribute to its onset, with NAFLD being a major underlying cause. NAFLD is notably prevalent among the general public. As obesity and type 2 diabetes continue to rise globally, it is anticipated that the occurrence of NAFLD will also increase in the coming years [6]. As a result, a higher rate of progression to cirrhosis is likely to follow. This study primarily aimed to investigate alterations in the expression of several critical elements associated with the advancement of NAFLD and cirrhosis, including miR-107, PTEN, Akt, and HIF-2α.

4.1. Changes in miR-107 expression in simple steatosis and cirrhosis

In the present study, during the early stages of the disease, such as simple steatosis, a relative increase in miR-107 expression was observed; however, this change was not statistically significant. miR-107 is a microRNA with complex roles in lipid metabolism. It is known to act as an inhibitor of the fatty acid synthase (FAS) enzyme and has been shown to induce endoplasmic reticulum stress, increase malonyl-CoA levels, and promote lipid accumulation in HepG2 cells and primary hepatocytes [24]. Since FASN plays a key role in de novo fatty acid synthesis, the increase in miR-107 expression could be interpreted as a compensatory mechanism in response to lipid accumulation in hepatocytes. However, previous studies have demonstrated that high levels of miR-107 can reduce mitochondrial β-oxidation by inhibiting HADHA (hydroxyacyl-CoA dehydrogenase), resulting in increased lipid accumulation in HepG2 cells [25]. miR-107 has also been implicated in the regulation of fatty acid metabolic pathways and is encoded within exon 1 of the PANK1 gene. The PANK1 gene family is involved in numerous metabolic processes, including the synthesis of coenzyme A (CoA), which is an essential cofactor in fatty acid β-oxidation. It is possible that miR-107 and its host gene (PANK1) act in coordination to maintain normal levels of β-oxidation within the cell. Disruption in the expression of either may impair this balance, leading to decreased expression of enzymes necessary for fatty acid β-oxidation and, consequently, reduced lipid metabolism [26]. Therefore, miR-107 may contribute to the development of hepatic steatosis through this mechanism, as well as via the accumulation of malonyl-CoA and intracellular lipids. However, its expression is not significantly increased during the early stages of the disease.

In a different section of this study, a marked upregulation of miR-107 was detected in liver tissues of cirrhotic patients. This observation stands in contrast to the findings of Liu et al., who reported a notable reduction in miR-107 levels within activated HSCs and liver biopsy samples from individuals with fibrosis and cirrhosis [27]. The discrepancies between these findings may be attributed to differences in disease stage (e.g., compensated vs. decompensated cirrhosis), variations in the cellular composition of tissue samples, or differences in the underlying etiologies of liver disease. They may also reflect the dynamic and stage-dependent regulation of microRNAs in chronic liver diseases. A study by Murakami et al. demonstrated that the expression of certain microRNAs, such as miR-199 and miR-200, changes in a stepwise manner during the progression of liver fibrosis [28]. These findings suggest that miRNA expression is influenced by the severity of tissue injury, pathological stage, and the type of cellular response, such as inflammation, stress, or repair. Accordingly, the increased expression of miR-107 observed in cirrhotic patients in the present study may reflect such a stage-specific regulatory pattern and represent an adaptive response aimed at modulating metabolic damage or suppressing chronic inflammation in the later stages of the disease. In conclusion, this apparent contradiction underscores the complexity of miR-107's role in the pathophysiology of cirrhosis and highlights the need for more detailed functional studies to better understand its dynamic regulation.

4.1.1. PI3K/PTEN/Akt signaling pathway in liver tissue

The PTEN gene encodes a phosphatase with dual specificity, functioning as a key suppressor of the PI3K/PTEN/Akt signaling pathway. Emerging evidence suggests that unsaturated fatty acids promote hepatic steatosis by downregulating PTEN expression. It has also been shown that PTEN depletion—induced by fatty acids or PTEN-targeting siRNAs—in HepG2 hepatoma cells leads to steatosis, whereas increased PTEN expression in these cells exerts a protective effect against fatty acid-induced lipid accumulation [29]. Alongside fatty acids, several inflammatory cytokines—such as TGF-β, TNF, IL-6, and IL-1—and adipokines like leptin, resistin, and adiponectin have been shown to influence PTEN expression or activity across different cell types. Although these molecules are widely recognized for their roles in regulating insulin sensitivity, lipid accumulation, fibrosis, and inflammatory responses, it remains uncertain whether they have a direct regulatory impact on hepatic PTEN levels or activity, and how this may affect liver physiology [15]. Earlier studies have noted decreased PTEN expression in liver samples from individuals with fatty liver disease and non-alcoholic steatohepatitis (NASH) compared to healthy controls [30]. In the current study, a reduction in PTEN levels was observed in liver tissues of patients with simple steatosis, although this change did not reach statistical significance. This may be due to the fact that, in the early stages of NAFLD, factors contributing to the downregulation of PTEN—such as fatty acids, adipokines, and inflammatory cytokines—may not yet be sufficiently elevated to significantly affect PTEN gene expression.

The loss of PTEN function in hepatic tissue contributes to a stepwise progression from steatohepatitis to fibrosis [15]. Research on rat liver has revealed that PTEN expression correlates with both hepatocyte activation and apoptosis, implying its involvement in fibrogenesis and the possibility of reversing fibrosis [31]. Additional studies have shown that PTEN is absent in resting HSCs but becomes expressed upon their activation. Interestingly, early overexpression of PTEN during HSC activation prevents their transition into an active state, instead promoting apoptosis-mediated cell death. Given PTEN's role as a suppressor of the PI3K/PTEN/Akt pathway, this signaling cascade appears to be essential for HSC activation. Specifically, upregulation of PTEN at early activation stages has been shown to initiate apoptosis in these cells [32]. In the current study, a notable reduction in PTEN expression was detected exclusively in liver tissues from patients with cirrhosis due to NASH, compared to other cirrhosis etiologies. This finding, aligned with previous studies, suggests that reduced PTEN levels may reflect its crucial inhibitory function in early-stage fibrosis by attenuating the PI3K/PTEN/Akt axis and facilitating apoptosis in HSCs. As fibrosis advances, however, PTEN expression appears to decline sharply, supporting ongoing HSC activation, fibrotic progression, and eventual cirrhosis. Consequently, PTEN may represent a potential target for further investigation in NASH-related cirrhosis. Moreover, this study found no significant relationship between miR-107 and PTEN expression in liver tissue from individuals with either simple steatosis or cirrhosis. This lack of association suggests that PTEN expression in hepatic tissue may be regulated by multiple mechanisms, and miR-107 expression alone does not appear to explain variations in PTEN levels.

The roles of Akt in lipid homeostasis have been explored in several studies. Although in vitro findings have shown that Akt activation contributes to lipid accumulation by stimulating the expression of SREBP-1c, in vivo studies suggest that Akt may exert protective effects against fatty liver disease [33]. The Akt signaling pathway is critically involved in both the onset and progression of liver fibrosis. Evidence from Western blot analysis has shown marked elevations in the phosphorylated forms of PI3K (p-PI3K), Akt (p-Akt), and mTOR (p-mTOR) in mouse liver tissue six weeks after intraperitoneal exposure to CCl4, in comparison to control subjects. These results support the activation of the PI3K/PTEN/Akt signaling axis in experimental models of hepatic fibrosis [34]. Additionally, research by Huang et al. involving patients with chronic hepatitis C demonstrated that increased Akt expression correlates with more severe stages of liver fibrosis [35].

The Akt kinase family consists of three isoforms—Akt1, Akt2, and Akt3—of which Akt1 and Akt2 are predominantly expressed in the liver. Each isoform is encoded by a separate gene and activated via similar PI3K-dependent pathways. While these isoforms are generally thought to share overlapping functions and can partially compensate for one another in hepatic cells, studies using mice with specific isoform knockouts suggest that distinct roles may exist. For example, mice lacking Akt1 display enhanced apoptosis and impaired growth, whereas diminished Akt2 expression results in insulin resistance and a diabetic-like condition. Interestingly, Akt1 and Akt2 have been reported to exert opposing effects on cell migration and invasion in breast cancer, while in prostate cancer cells, both act to suppress these processes [17]. In this study, the expression of Akt1 was analyzed in liver tissue samples from patients with simple steatosis and cirrhosis of varying origins. The findings revealed no significant differences in Akt1 levels between these groups and healthy controls—neither in steatotic nor cirrhotic tissues. However, since only Akt1 mRNA expression was assessed in the present study, changes in Akt pathway activation cannot be determined based on these findings alone.

Given the distinct biological functions of Akt isoforms reported in previous studies, the lack of significant changes in Akt1 expression does not exclude the possible involvement of other Akt isoforms in liver steatosis and cirrhosis. The lack of significant alteration in the mRNA expression of Akt1 may also be explained by compensatory regulation by other isoforms. This is in line with previous findings suggesting functional and regulatory differences among Akt isoforms. Thus, further investigation of each isoform individually is warranted in future studies.

4.2. HIF-2α: No significant change in mRNA expression

Hypoxia has been closely associated with lipid regulation, as both cellular and animal studies have shown that ischemic and low-oxygen conditions can promote intracellular lipid accumulation. Under hypoxic stress, the expression of genes involved in lipogenesis, lipid uptake, and the formation of lipid droplets is significantly upregulated [36]. Research by Rankin et al. highlighted the pivotal role of HIF-2α in liver lipid metabolism, showing that it suppresses fatty acid β-oxidation while enhancing lipid storage [37]. Although a majority of studies support the lipogenic function of HIF-2α, contradictory findings have also been reported. For example, complete genetic deletion of HIF-2α has led to severe hepatic steatosis in some models, possibly due to impaired β-oxidation stemming from mitochondrial dysfunction and elevated reactive oxygen species (ROS) levels [36]. Therefore, while substantial evidence supports the role of HIF-2α in promoting fat accumulation, its exact function in lipid metabolism remains a subject of ongoing debate.

Beyond their involvement in fatty liver disease, hypoxia-inducible factors are also key contributors to liver fibrosis [36]. One investigation demonstrated that HIF-2α promotes fibrogenesis—an early step toward cirrhosis—by activating hepatic stellate cells (as shown in the LX-2 human cell line). This effect is mediated through enhanced glutamine metabolism and suppression of YAP phosphorylation, ultimately leading to increased myofibroblast activity and extracellular matrix accumulation [22]. Additionally, elevated HIF-2α protein levels have been detected in liver tissues of patients with NASH when compared to healthy individuals [38]. In contrast, a study conducted by Cao et al. using the HepG2 cell line reported that while HIF-2α protein expression rose under hypoxic conditions over time, there was no accompanying change at the mRNA level [39]. At present, limited data from human studies exist regarding alterations in hepatic HIF-2α gene expression across the spectrum from simple steatosis to cirrhosis. In the current study, no statistically significant differences in HIF-2α mRNA expression were found in liver tissues from patients with either condition. This finding suggests that the stability and activity of HIF-2α are regulated not only at the transcriptional level but also through post-translational mechanisms. These mechanisms may increase protein abundance without a corresponding increase in mRNA expression. Under normoxic conditions, prolyl hydroxylase enzymes (PHDs) play a central role in regulating HIF-2α degradation by hydroxylating two critical proline residues—Pro405 and Pro531. This hydroxylation marks HIF-2α for recognition by the von Hippel–Lindau (VHL) complex, which subsequently facilitates its ubiquitination and degradation via the proteasome. In contrast, under hypoxic conditions, the enzymatic activity of PHDs is suppressed, thereby preventing HIF-2α degradation and allowing it to accumulate within the cell and maintain its transcriptional activity [40].

In addition to this oxygen-sensing pathway, the deacetylase enzyme SIRT1 has also been shown to enhance HIF-2α stability. SIRT1 increases both the stability and transcriptional activity of HIF-2α by deacetylating specific lysine residues on the protein [41]. Recent studies have also identified the Pin1 protein as a key regulator of HIF-2α post-translational stability. Pin1 directly binds to HIF-2α, decreasing its ubiquitination and proteasomal degradation, even without any changes in mRNA levels. One critical residue for this interaction is Ser790 within the nuclear export signal (NES) region. Upon phosphorylation of this residue, Pin1 can bind to HIF-2α. Deletion or inhibition of Pin1 results in reduced HIF-2α protein levels, suggesting its essential role in stabilizing HIF-2α [42]. Moreover, the MAPK/ERK signaling pathway contributes to HIF-2α stability by promoting its nuclear accumulation. This occurs through phosphorylation at Ser672, which prevents nuclear export and thereby shields HIF-2α from cytoplasmic proteasomal degradation [43]. Collectively, the absence of significant changes in HIF-2α mRNA expression in liver tissues from patients with simple steatosis and cirrhosis points to the potential role of post-translational regulation in elevating HIF-2α protein levels, despite stable mRNA expression. As such, a lack of transcriptional alterations does not necessarily exclude HIF-2α from contributing to the disease process. Assessing protein expression and functional activity of HIF-2α would provide a more comprehensive understanding of its role in the progression of NAFLD and cirrhosis.

5. Limitations

Several limitations should be considered in interpreting the findings of this study. First, the relatively small sample size, particularly within individual cirrhosis subgroups, may have limited the statistical power to detect differences between specific etiologies. Therefore, the findings related to subgroup comparisons should be interpreted with caution and require validation in larger cohorts. Second, the expression levels of PTEN, Akt1, and HIF-2α were evaluated at the mRNA level, whereas the functional activity of these molecules is largely regulated at the protein and post-translational levels. Future studies incorporating protein-level analyses, such as Western blotting, immunohistochemistry, and assessment of pathway activation markers, including phosphorylated Akt, are warranted to further validate these findings.

Although the use of histologically normal liver tissues from patients undergoing resection for metastatic tumors is a common approach in human liver studies, potential systemic effects associated with malignancy cannot be completely excluded and should be considered as a limitation.

Differences in age, sex and MELD score among study groups may have influenced gene expression patterns. Due to the relatively small sample size within each subgroup, adjusted analyses were not performed, and therefore potential confounding effects cannot be completely excluded. Larger studies with adequate statistical power are needed to validate these findings.

6. Conclusion

The investigations conducted in this study indicate that molecular pathways including miR-107, PTEN, Akt, and HIF-2α play complex roles in the progression of NAFLD to liver cirrhosis. Increased expression of miR-107 in advanced stages may be part of the body's regulatory response to chronic injury and inflammation. Reduced PTEN expression, particularly in NASH-induced cirrhosis, may be associated with disease progression and is consistent with previous studies suggesting a role for PTEN in hepatic fibrogenesis. However, no direct link was observed between miR-107 and PTEN, which could be due to the high complexity of molecular pathways and the influence of various factors in the regulation of these genes. In contrast, no significant changes were observed in the mRNA expression of Akt1 or HIF-2α. These findings do not necessarily reflect the activity of the Akt or HIF-2α pathways, as additional Akt isoforms and post-translational regulation may contribute to their biological functions. These results indicate that more complete investigations at the protein and functional levels of these pathways are necessary to better understand the molecular mechanisms involved in disease progression and design targeted therapies.

Ethics declaration

Written informed consent to take part in the study and to publish the article has been obtained from all participants or their legal representatives. The privacy rights of participants have been observed.

This study included organ or tissue donors. This study includes human biological material and consent was obtained by donors, or their next of kin or legal representatives, for use in this study and for publication of the article. The samples used in this research were not sourced from executed prisoners or prisoners of conscience.

This study was performed in compliance with relevant laws, regulatory frameworks and guidelines where the research took place. This study was approved by the The Research Ethics Committee of the Hamadan University of Medical Sciences. (Approval No. IR. UMSHA.REC.1404.479)

Ethics approval and patient consent statements

All procedures performed in the study were in accordance with the 1964 Helsinki declaration and the ethical standards of the national research committee. The study design was explained for all study participant, and then informed consent was obtained from all subjects. The Research Ethics Committee of the Hamadan University of Medical Sciences approved the present study (IR.UMSHA.REC.1404.479).

Declaration of competing interests

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgements

This work was supported by the Hamadan University of Medical Sciences (grant number: 140406185094).

Data availability

No data was used for the research described in the article.

References

  • 1.Devarbhavi H., Asrani S.K., Arab J.P., Nartey Y.A., Pose E., Kamath P.S. Global burden of liver disease: 2023 update. J. Hepatol. 2023;79(2):516–537. doi: 10.1016/j.jhep.2023.03.017. [DOI] [PubMed] [Google Scholar]
  • 2.Somnay K., Wadgaonkar P., Sridhar N., Roshni P., Rao N., Wadgaonkar R. Liver fibrosis leading to cirrhosis: basic mechanisms and clinical perspectives. Biomedicines. 2024;12(10):2229. doi: 10.3390/biomedicines12102229. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Geong G.Y., Kang S.H., Chang M.L. An updated review on the epidemiology, pathophysiology, etiology and diagnosis of liver cirrhosis. Preprints. 2019 [Google Scholar]
  • 4.Zhou W.-C., Zhang Q.-B., Qiao L. Pathogenesis of liver cirrhosis. World J. Gastroenterol.: WJG. 2014;20(23):7312. doi: 10.3748/wjg.v20.i23.7312. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Maurice J., Manousou P. Non-alcoholic fatty liver disease. Clin. Med. 2018;18(3):245–250. doi: 10.7861/clinmedicine.18-3-245. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Kumar R., Priyadarshi R.N., Anand U. Non-alcoholic fatty liver disease: growing burden, adverse outcomes and associations. J. Clin. Transl. Hepatol. 2019;8(1):76. doi: 10.14218/JCTH.2019.00051. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Calzadilla Bertot L., Adams L.A. The natural course of non-alcoholic fatty liver disease. Int. J. Mol. Sci. 2016;17(5):774. doi: 10.3390/ijms17050774. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Chen W., Zhao W., Yang A., Xu A., Wang H., Cong M., et al. Integrated analysis of microRNA and gene expression profiles reveals a functional regulatory module associated with liver fibrosis. Gene. 2017;636:87–95. doi: 10.1016/j.gene.2017.09.027. [DOI] [PubMed] [Google Scholar]
  • 9.Yu W., Wang S., Wang Y., Chen H., Nie H., Liu L., et al. MicroRNA: role in macrophage polarization and the pathogenesis of the liver fibrosis. Front. Immunol. 2023;14 doi: 10.3389/fimmu.2023.1147710. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Trajkovski M., Hausser J., Soutschek J., Bhat B., Akin A., Zavolan M., et al. MicroRNAs 103 and 107 regulate insulin sensitivity. Nature. 2011;474(7353):649–653. doi: 10.1038/nature10112. [DOI] [PubMed] [Google Scholar]
  • 11.Zhang Z., Wu S., Muhammad S., Ren Q., Sun C. miR-103/107 promote ER stress-mediated apoptosis via targeting the Wnt3a/β-catenin/ATF6 pathway in preadipocytes. J. Lipid Res. 2018;59(5):843–853. doi: 10.1194/jlr.M082602. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Yu Q.-F., Liu P., Li Z.-Y., Zhang C.-F., Chen S.-Q., Li Z.-H., et al. MiR-103/107 induces tumorigenicity in bladder cancer cell by suppressing PTEN. Eur. Rev. Med. Pharmacol. Sci. 2018;22(24) doi: 10.26355/eurrev_201812_16625. [DOI] [PubMed] [Google Scholar]
  • 13.Chen P., Zhao X., Wang H., Zheng M., Wang Q., Chang W. The down-regulation of lncRNA PCAT18 promotes the progression of gastric cancer via MiR-107/PTEN/PI3K/AKT signaling pathway. OncoTargets Ther. 2019:11017–11031. doi: 10.2147/OTT.S225235. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Tian M., Wang J., Liu S., Li X., Li J., Yang J., et al. Hepatic HuR protects against the pathogenesis of non-alcoholic fatty liver disease by targeting PTEN. Cell Death Dis. 2021;12(3):236. doi: 10.1038/s41419-021-03514-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Peyrou M., Bourgoin L., Foti M. PTEN in liver diseases and cancer. World J. Gastroenterol.: WJG. 2010;16(37):4627. doi: 10.3748/wjg.v16.i37.4627. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Ye Q., Liu Y., Zhang G., Deng H., Wang X., Tuo L., et al. Deficiency of gluconeogenic enzyme PCK1 promotes metabolic-associated fatty liver disease through PI3K/AKT/PDGF axis activation in male mice. Nat. Commun. 2023;14(1):1402. doi: 10.1038/s41467-023-37142-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Reyes-Gordillo K., Shah R., Arellanes-Robledo J., Cheng Y., Ibrahim J., Tuma P.L. Akt1 and Akt2 isoforms play distinct roles in regulating the development of inflammation and fibrosis associated with alcoholic liver disease. Cells. 2019;8(11):1337. doi: 10.3390/cells8111337. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Braccini L., Ciraolo E., Campa C.C., Perino A., Longo D.L., Tibolla G., et al. PI3K-C2γ is a Rab5 effector selectively controlling endosomal Akt2 activation downstream of insulin signalling. Nat. Commun. 2015;6(1):7400. doi: 10.1038/ncomms8400. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Yecies J.L., Zhang H.H., Menon S., Liu S., Yecies D., Lipovsky A.I., et al. Akt stimulates hepatic SREBP1c and lipogenesis through parallel mTORC1-dependent and independent pathways. Cell Metab. 2011;14(1):21–32. doi: 10.1016/j.cmet.2011.06.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Kim J.K., Han N.R., Park S.M., Jegal K.H., Jung J.Y., Jung E.H., et al. Hemistepsin A alleviates liver fibrosis by inducing apoptosis of activated hepatic stellate cells via inhibition of nuclear factor-κB and Akt. Food Chem. Toxicol. 2020;135 doi: 10.1016/j.fct.2019.111044. [DOI] [PubMed] [Google Scholar]
  • 21.Qu A., Taylor M., Xue X., Matsubara T., Metzger D., Chambon P., et al. Hypoxia‐inducible transcription factor 2α promotes steatohepatitis through augmenting lipid accumulation, inflammation, and fibrosis. Hepatology. 2011;54(2):472–483. doi: 10.1002/hep.24400. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Yan R., Cai H., Zhou X., Bao G., Bai Z., Ge R-l. Hypoxia-inducible factor-2α promotes fibrosis in non-alcoholic fatty liver disease by enhancing glutamine catabolism and inhibiting yes-associated protein phosphorylation in hepatic stellate cells. Front. Endocrinol. 2024;15 doi: 10.3389/fendo.2024.1344971. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Chen J., Chen J., Huang J., Li Z., Gong Y., Zou B., et al. HIF-2α upregulation mediated by hypoxia promotes NAFLD-HCC progression by activating lipid synthesis via the PI3K-AKT-mTOR pathway. Aging (Albany NY) 2019;11(23) doi: 10.18632/aging.102488. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Bhatia H., Verma G., Datta M. miR-107 orchestrates ER stress induction and lipid accumulation by post-transcriptional regulation of fatty acid synthase in hepatocytes. Biochim. Biophys. Acta, Gene Regul. Mech. 2014;1839(4):334–343. doi: 10.1016/j.bbagrm.2014.02.009. [DOI] [PubMed] [Google Scholar]
  • 25.Bhatia H., Pattnaik B., Datta M. Inhibition of mitochondrial β-oxidation by miR-107 promotes hepatic lipid accumulation and impairs glucose tolerance in vivo. Int. J. Obes. 2016;40(5):861–869. doi: 10.1038/ijo.2015.225. [DOI] [PubMed] [Google Scholar]
  • 26.Foley N.H., OˈNeill L.A. miR-107: a toll-like receptor-regulated miRNA dysregulated in obesity and type II diabetes. J. Leukoc. Biol. 2012;92(3):521–527. doi: 10.1189/jlb.0312160. [DOI] [PubMed] [Google Scholar]
  • 27.Liu X., Ma H., Wu R., Wang H., Xu H., Li S., et al. Identification of liver fibrosis-related MicroRNAs in human primary hepatic stellate cells using high-throughput sequencing. Genes. 2022;13(12):2201. doi: 10.3390/genes13122201. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Murakami Y., Toyoda H., Tanaka M., Kuroda M., Harada Y., Matsuda F., et al. The progression of liver fibrosis is related with overexpression of the miR-199 and 200 families. PLoS One. 2011;6(1) doi: 10.1371/journal.pone.0016081. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Vinciguerra M., Foti M. PTEN at the crossroad of metabolic diseases and cancer in the liver. Ann. Hepatol. 2008;7(3):192–199. [PubMed] [Google Scholar]
  • 30.Ikeda Y., Murakami M., Nakagawa Y., Tsuji A., Kitagishi Y., Matsuda S. Diet induces hepatocyte protection in fatty liver disease via modulation of PTEN signaling. Biomed. Reports. 2020;12(6):295–302. doi: 10.3892/br.2020.1299. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Zheng L., Chen X., Guo J., Sun H., Liu L., Shih D.Q., et al. Differential expression of PTEN in hepatic tissue and hepatic stellate cells during rat liver fibrosis and its reversal. Int. J. Mol. Med. 2012;30(6):1424–1430. doi: 10.3892/ijmm.2012.1151. [DOI] [PubMed] [Google Scholar]
  • 32.Takashima M., Parsons C.J., Ikejima K., Watanabe S., White E.S., Rippe R.A. The tumor suppressor protein PTEN inhibits rat hepatic stellate cell activation. J. Gastroenterol. 2009;44:847–855. doi: 10.1007/s00535-009-0073-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Zeng T., Zhang C.-L., Zhao N., Guan M.-J., Xiao M., Yang R., et al. Impairment of Akt activity by CYP2E1 mediated oxidative stress is involved in chronic ethanol-induced fatty liver. Redox Biol. 2018;14:295–304. doi: 10.1016/j.redox.2017.09.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Zhang Y., Ren L., Tian Y., Guo X., Wei F., Zhang Y. Signaling pathways that activate hepatic stellate cells during liver fibrosis. Front. Med. 2024;11 doi: 10.3389/fmed.2024.1454980. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Huang J.F., Chuang Y.H., Dai C.Y., Yu M.L., Huang C.F., Hsiao P.J., et al. Hepatic Akt expression correlates with advanced fibrosis in patients with chronic hepatitis C infection. Hepatol. Res. 2011;41(5):430–436. doi: 10.1111/j.1872-034X.2011.00786.x. [DOI] [PubMed] [Google Scholar]
  • 36.Suzuki T., Shinjo S., Arai T., Kanai M., Goda N. Hypoxia and fatty liver. World J. Gastroenterol.: WJG. 2014;20(41) doi: 10.3748/wjg.v20.i41.15087. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Rankin E.B., Rha J., Selak M.A., Unger T.L., Keith B., Liu Q., et al. Hypoxia-inducible factor 2 regulates hepatic lipid metabolism. Mol. Cell Biol. 2009;29(16):4527–4538. doi: 10.1128/MCB.00200-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Cai H., Bai Z., Ge R.-L. Hypoxia-inducible factor-2 promotes liver fibrosis in non-alcoholic steatohepatitis liver disease via the NF-κB signalling pathway. Biochem. Biophys. Res. Commun. 2021;540:67–74. doi: 10.1016/j.bbrc.2021.01.002. [DOI] [PubMed] [Google Scholar]
  • 39.Cao R., Zhao X., Li S., Zhou H., Chen W., Ren L., et al. Hypoxia induces dysregulation of lipid metabolism in HepG2 cells via activation of HIF-2α. Cell. Physiol. Biochem. 2014;34(5):1427–1441. doi: 10.1159/000366348. [DOI] [PubMed] [Google Scholar]
  • 40.Camagni G.F., Minervini G., Tosatto S.C. Structural characterization of hypoxia inducible factor α—Prolyl hydroxylase domain 2 interaction through MD simulations. Int. J. Mol. Sci. 2023;24(5):4710. doi: 10.3390/ijms24054710. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Dioum E.M., Chen R., Alexander M.S., Zhang Q., Hogg R.T., Gerard R.D., et al. Regulation of hypoxia-inducible factor 2α signaling by the stress-responsive deacetylase sirtuin 1. Science. 2009;324(5932):1289–1293. doi: 10.1126/science.1169956. [DOI] [PubMed] [Google Scholar]
  • 42.Guillen-Quispe Y.N., Kim S.-J., Saeidi S., Zhou T., Zheng J., Kim S.H., et al. Oxygen-independent stabilization of HIF-2α in breast cancer through direct interaction with peptidyl-prolyl cis-trans isomerase NIMA-interacting 1. Free Radic. Biol. Med. 2023;207:296–307. doi: 10.1016/j.freeradbiomed.2023.07.020. [DOI] [PubMed] [Google Scholar]
  • 43.Gkotinakou I.-M., Befani C., Simos G., Liakos P. ERK1/2 phosphorylates HIF-2α and regulates its activity by controlling its CRM1-dependent nuclear shuttling. J. Cell Sci. 2019;132(7) doi: 10.1242/jcs.225698. jcs225698. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

No data was used for the research described in the article.

Articles from Biochemistry and Biophysics Reports are provided here courtesy of Elsevier

RESOURCES