Skip to main content
Wiley Open Access Collection logoLink to Wiley Open Access Collection
. 2026 Sep 5;40(17):e72270. doi: 10.1096/fj.202603109R

Stressor‐ and Tissue‐Specific Regulation of the Corticotropin‐Releasing Factor System Across Epithelial Tissues in Rainbow Trout

Brett M Culbert 1,, Alexis E Pulford‐Thorpe 1, Carol Best 1, Nicholas J Bernier 1,
PMCID: PMC13545658  PMID: 42698382

ABSTRACT

The corticotropin‐releasing factor (CRF) system is a major neural regulator of stress responses in vertebrates. However, stress‐related roles for the CRF system in other tissues—and whether these roles vary between stressor types—remain unclear. To address this gap, we first characterized the CRF system in the gills and intestine of rainbow trout ( Oncorhynchus mykiss ) and then evaluated how it is transcriptionally regulated following either an immune (vaccination) or osmotic (seawater transfer) stressor. Additionally, since the CRF system is involved in food intake regulation, we also evaluated whether feeding state affects the intestinal CRF system. Vaccination against Vibrio anguillarum caused increases in intestinal CRF binding protein transcripts paired with reductions in ligand (crfa2) and receptor (crfr1b) transcripts but did not affect transcript levels of CRF system components in the gills. In contrast, seawater transfer caused the abundance of most CRF system transcripts to increase in the middle (but not posterior) portion of the intestine, while transcript levels of CRF binding proteins and receptors in the gills declined. Finally, levels of CRF system transcripts in the intestine varied with feeding state in a region‐specific manner. In the middle intestine, transcript levels of most components declined with fasting and increased when feeding was resumed, whereas the opposite pattern occurred in the posterior intestine. Overall, our results implicate the peripheral CRF system as a stressor‐ and epithelial tissue‐specific modulator of immune and osmoregulatory functions in teleosts.

Keywords: fasting, gills, immune response, intestine, osmotic stress


The gill and intestinal corticotropin‐releasing factor (CRF) systems in rainbow trout are differentially regulated by immune, osmotic, and nutritional stressors. Seawater transfer suppressed gill CRF system transcription and induced time‐dependent changes in the middle intestine. An immune challenge (vaccination) altered only intestinal CRF expression. Fasting and refeeding triggered region‐specific intestinal responses. These findings reveal extensive tissue‐ and region‐specific regulation of the CRF system, highlighting its diverse roles in coordinating stress responses beyond the brain. Images created using Google Gemini.

graphic file with name FSB2-40-e72270-g008.webp

1. Introduction

The ability to appropriately respond to environmental stressors is critical for an animal's survival and fitness. To accomplish this, a suite of physiological responses occurs following a stressor [1, 2], including elevated levels of two major classes of hormones: catecholamines (e.g., adrenaline and noradrenaline) and corticosteroids (e.g., cortisol and corticosterone). While catecholamines are critical for rapid physiological changes associated with “fight‐or‐flight” responses (seconds to minutes; [3, 4]), contributions of corticosteroids are generally slower and more prolonged (hours to days), helping animals adjust their physiology—including metabolic, immunologic, osmotic, and neural responses [5, 6]—to better cope with, overcome, and/or recover from a stressor [7]. Given the relative ease with which corticosteroid levels can be measured and manipulated, a major focus of ecological and physiological studies alike has been to understand the regulation of and roles for these hormones during vertebrate stress responses [8, 9, 10]. However, it is becoming increasingly clear that many hormone systems are necessary to overcome stressors and corticosteroids—while important—are but one of several hormones involved in coordinating stress responses [11, 12, 13]. Furthermore, the relative contribution of different hormone systems during stress responses varies depending on the nature, intensity, and duration of a stressor [14, 15, 16, 17]. Yet, most studies continue to solely focus on the regulation of corticosteroids in response to environmental stressors and the relative contribution(s) of other stress‐related hormone systems remain poorly understood.

The corticotropin‐releasing factor (CRF) system—consisting of five ligands [CRFa, CRFb, urotensin 1 (UTS1), urocortin 2 (UCN2), and UCN3], a binding protein (CRFBP), and two receptors (CRFR1 and CRFR2) in teleost fishes [18, 19]—is the major neuroendocrine regulator of stress responses via its effects on the hypothalamic–pituitary–adrenal/interrenal axis and corticosteroid synthesis [5, 20]. However, the CRF system also contributes to the regulation of many physiological processes outside of the brain. For example, activation of the CRF system stimulates proinflammatory responses in mammals [21, 22, 23], counter to the anti‐inflammatory effects that are generally associated with corticosteroids [24]. Similarly, the CRF system is an important regulator of osmoregulatory functions in the mammalian colon where it reduces ion and water absorption [21, 25]. As in mammals, previous work in fish has suggested that the CRF system is involved in coordinating responses to immune challenges [26, 27, 28, 29] and osmotic disturbances [30, 31, 32, 33, 34, 35, 36]. However, most of these studies have focused on only a small subset of CRF system components, and only Mazon et al. [27] evaluated whether responses of the CRF system vary in a stressor‐ and tissue‐specific manner using common carp ( Cyprinus carpio ). Therefore, we set out to compare whether transcriptional regulation of the CRF system varies between immune and osmotic stressors. We specifically focused on the gills and intestine because both tissues are key osmoregulatory organs [37, 38, 39] and are important for the prevention of pathogen entry from the external environment [40, 41].

To accomplish this, we first characterized which components of the CRF system were most abundant in the gills and intestine of rainbow trout ( Oncorhynchus mykiss ). We then evaluated whether transcript levels of the major CRF system components in the gills and intestine were affected by either an immune (6, 24, 72, and 168 h post‐vaccination) or osmotic (24, 72, and 168 h post‐SW transfer) stressor. We predicted that vaccination would initially stimulate CRF system activity in the gill and intestine (e.g., greater transcript abundance of CRF ligands and receptors, paired with reductions in CRFBP), associated with the initial production of proinflammatory cytokines, followed by a suppression of CRF system activity (e.g., reduced transcript abundance of CRF ligands and receptors, paired with increases in CRFBP) after production of anti‐inflammatory cytokines increases. Following SW transfer, we predicted that gill CRF system activity would increase (reflecting the development of an ion‐secretory phenotype) and that intestinal CRF system activity would decrease (reflecting a heightened need for ion and water absorption). Additionally, because the CRF system is a major regulator of food intake in teleosts [42, 43, 44, 45] and salmonids naturally suppress feeding in response to stress—including osmotic and immune stressors [46, 47, 48]—we also assessed whether feeding status influences transcript abundance of the intestinal CRF system. Specifically, we compared transcript abundance of CRF system components in the intestine of fed fish with fish fasted for 0 (fed), 24, 72, or 168 h, as well as 24, 72, or 168 h after resumption of feeding following a 168 h fast. Here, we predicted that activity of the intestinal CRF system would decline during fasting to maximize nutrient absorption capacity (i.e., reduced secretory capacity).

2. Methods

2.1. General Housing

All trout were acquired from the Ontario Aquaculture Research Centre (Alma, ON, Canada) and were housed in the Hagen Aqualab at the University of Guelph (Guelph, ON, Canada). Fish were initially maintained in 1.8 m diameter fiberglass tanks (~2000 L) supplied with flow‐through well water maintained at 12°C and kept on a 12 h light, 12 h dark photoperiod regime. Fish were fed to satiation three times per week with commercial trout food (3 or 5 PT Sinking, Blue Water Fish Food; Guelph, ON, Canada). A stocking density of ~100 fish per tank was maintained during this period, and fish were kept under these conditions for at least a month prior to experiments. All procedures were carried out in accordance with the Canadian Council for Animal Care guidelines for the use of animals in research and teaching and were approved by the University of Guelph's Animal Care Committee (AUPs #4123 and 4996).

2.2. Evaluating the CRF System of the Gills and Intestine

To determine which components of the CRF system were most abundant in the gills, as well as the middle (Mid. Int.) and posterior (Post. Int.) portions of the intestine, we sampled three sexually immature trout (mass = 156 ± 10 g, fork length = 23.3 ± 0.9 cm) and performed qPCR (see Section 2.5) using gene‐specific primers for each component (Table 1). Values for each transcript were corrected for primer efficiency and are expressed relative to the abundance of crfa2 in the gills for visualization purposes, which was the CRF system component with the lowest levels across both tissues that consistently amplified. We measured individual paralogs of all CRF system components, except for UCN3, which shares 99% identity across paralogs.

TABLE 1.

Gene specific primers used for real‐time polymerase chain reaction (qPCR).

Primer sequence (5′ to 3′) Amplicon size (bp) Efficiency (%) Accession number
crfa1 F: CAAAATTCGCTCCAGTCCTC 95 100 XM_021613200
R: TGCGTGAGCTGAAGTTGTAA
crfa2 F: ATTCGCCCCAATCTTCATT 79 102 XM_021589550
R: TGAAGTAAAGCCCTGTTGACC
crfb1 F: CTGAAGGCATGTACCCAGAG 110 102 NM_001124286
R: GACGAACCGGCTGATGTT
crfb2 F: GAAAGTCATGCACCCCAAG 117 102 NM_001124627
R: AAGCCGCTGATGAACCTATT
crfbp1 F: CCAACACGTTGTCTATCTAC 107 100 NM_001124631
R: TTTTATGGCAACCTTCAGGCT
crfbp2 F: CTCCCTATCTATCTCTCCAC 122 100 XM_036977080
R: GTTATGGCGATCCTCAGGAT
crfr1a F: TCCCTCGGAGACAGGAGTGT 121 102 XM_036940770
R: CTTTTACGATGTGCGACTGGT
crfr1b F: CGGCAATTTATAGGCTGTGTT 114 99 XM_021624572
R: CCCACATGAACAACCAACAG
crfr2a F: CACTGTACTGTACTAGTGGT 83 100 XM_021613636
R: TCCTGCTTAAATGATCTCTGC
crfr2b F: TAAATTCAGAACAGATGGGC 82 100 XM_021589160
R: CATTGCCAGTAAGACTCTGAC
c3 F: GAGCAGCACCTGGCTGACA 150 102 XM_021561577
R: GGAGCAAACTCATTGAAGATGCC
ef1α F: CCATTGACATTTCTCTGTGGAAGT 106 96 NM_001124339
R: GAGGTACCAGTGATCATGTTCTTGA
ifnγ F: ACCCTGTTTTCCCCAAGGAC 61 92 NM_001124620
R: ACCACACTCATCAACACCCTC
il1b F: TGAGAACAAGTGCTGGGTCC 148 107 NM_001124347
R: GGCTACAGGTCTGGCTTCAG
il10 F: CCGCCATGAACAACAGAACA 105 93 NM_001245099
R: TCCTGCATTGGACGATCTCT
rpl13a F: GGACAAGCTGCACTGGAGAG 113 100 XM_021574753
R: GTGGGCTTCAGACGGACAAT
tnfα F: CACACTGGGCTCTTCTTCGT 155 98 NM_001124374
R: CAAACTGACCTTACCCCGCT NM_001124357
ucn2a F: CATGCGTATGTGTCTGAGCC 61 101 CDQ61544
R: TCTTCTCCCATCCTTTGGCAC
ucn2b F: ACTCCTAAGTTGTGACATTGGA 68 99 XM_021570508
R: CCAGACACAGGCTTAGATG
ucn3 F: GCACGGAACTTGGACATCAT 91 100 XM_021596023
R: GTCTGAGACAGAGGCTGGAG XM_036945073
uts1a F: GTTGCTGAAGGCTGGTGATA 82 100 NM_001124343
R: CAACCGGGGATTTCTTTG
uts1b F: GGCGACGCAGTTTCCTAC 60 99 XM_021612039
R: GGGATTTCTCTGCAAATAACG

Abbreviations: crf, corticotropin‐releasing factor; crfbp, corticotropin‐releasing factor binding protein; crfr, corticotropin‐releasing factor receptor; c3, complement 3; ef1α, elongation factor 1α; ifnγ, interferon γ; il, interleukin; rpl13a, ribosomal protein L13a; tnfα, tumor necrotic factor α; ucn, urocortin; uts, urotensin.

2.3. Experimental Design

2.3.1. Experiment 1: Immune Challenge

Eighty‐four sexually immature trout were used for this experiment (mass = 271 ± 6 g, fork length = 27.8 ± 0.2 cm). Fish were lightly anesthetized using MS‐222 (70 mg L−1, Syndel; Vancouver, BC, Canada), weighed, and haphazardly transferred into one of eight experimental tanks (N = 10–11 fish per tank; N = 1 tank per experimental group). Fish were held in 0.6 m diameter fiberglass tanks (~200 L) containing an air stone. All tanks were supplied with flow‐through well water maintained at 12°C and were kept on a 12 h light, 12 h dark photoperiod regime. Each tank was fed 1% of the average cumulative body weight in each tank daily and were held under these conditions for 2 weeks. Following this acclimation period, fish were anesthetized using MS‐222 (100 mg L−1) and injected intraperitoneally with 250 μL of either an inactivated vaccine solution or filter‐sterilized saline (0.9% NaCl). Food was withheld for 24 h prior to injection. The vaccine (ICTHIOVAC VR, HIPRA; Amer, Girona, Spain) contained formalin‐killed Vibrio anguillarum (serotypes O1, O2α and O2β) and has previously been shown to cause an immune response in rainbow trout [49, 50]. After either 6, 24, 72, or 168 h post‐injection, groups of vaccine‐ and saline‐injected fish were killed via terminal anesthesia using 2‐phenoxyethanol (0.2%, Sigma‐Aldrich; Oakville, ON, Canada) at 1400 h. Fork length and mass were recorded, and blood was collected from the caudal vasculature using a 1 mL ammonium heparinized syringe. A portion of the blood was placed on ice to facilitate the evaluation of blood leukocyte abundance and respiratory burst activity (see Section 2.4.1), and the rest was centrifuged at 9000 g for 5 min. After this, plasma was collected, frozen on dry ice, and stored at −80°C for later determination of cortisol levels (see Section 2.4.2). The intestinal tract was removed from each fish, flushed of its contents, and regionally dissected as previously described [51]. Specifically, we designated the middle intestine as the segment between the final pyloric caeca and the ileorectal sphincter, and the posterior intestine as the segment posterior to the ileorectal sphincter. These intestine regions, as well as the second gill arch on the right side of each fish, were frozen on dry ice and stored at −80°C to be used for later evaluation of immune‐related transcripts and transcripts in the CRF system (see Section 2.5). Food was withheld throughout the experiment to avoid potential confounds associated with the inhibition of appetite due to vaccination [47].

2.3.2. Experiment 2: Osmotic Challenge

Fifty‐eight trout were used for this experiment (mass = 544 ± 14 g, fork length = 35.0 ± 0.3 cm). Groups of 10 fish were haphazardly placed into recirculating tanks containing either freshwater or seawater (35 ppt, Instant Ocean Sea Salt; Blacksburg, VA, USA). All tanks contained ~2000 L of water at 12°C and were on a 12 h light, 12 h dark photoperiod regime. Additionally, all tanks were continuously aerated with an air stone and equipped with both particle and biological filtration, as well as UV sterilization. Each group of fish was sampled 24, 72, or 168 h following transfer (N = 1 tank per experimental group). Two fish were removed from the 168 h FW‐to‐SW transferred group prior to the end of the experiment resulting in N = 8 for this group. Plasma (cortisol and osmolality; see Section 2.4.2), gill, and intestine segments (CRF system transcript abundance; see Section 2.5) were collected as described above. As in Experiment (Exp) 1, food was withheld throughout the experiment because salmonids naturally suppress food intake during seawater acclimation [46, 48, 52, 53].

2.3.3. Experiment 3: Effects of Fasting and Refeeding on the Intestine

Forty‐nine trout were used for this experiment (mass = 750 ± 19 g, fork length = 37.9 ± 0.3 cm; N = 27 females and 22 males) and most (> 80%) were still juvenile. Fish were lightly anesthetized using MS‐222 (70 mg L−1), weighed, and haphazardly transferred into the experimental tanks (N = 7 fish per tank; N = 1 tank per timepoint). Fish were held in 1.2 m diameter fiberglass tanks (~500 L) that were supplied with aerated, flow‐through well water. Tanks were maintained at 12°C and kept on a 12 h light, 12 h dark photoperiod regime. For 2 weeks prior to the start of fasting, fish were fed 1.5% of the average cumulative body weight in each tank at 1100 h every day (a pilot study determined this to be the maximum amount that fish would fully consume daily). Following this acclimation period, all fish in one tank were immediately sacrificed (Control). Fish in the other six tanks were sampled following either 24, 72, or 168 h of fasting, or 24, 72, or 168 h after feeding had resumed following a 168 h fast. All treatment groups were terminally anesthetized at 1200 h (1 h after feeding for non‐fasted groups), and plasma (cortisol; see Section 2.4.2) and intestine (CRF system transcript abundance; see Section 2.5) were collected as described above.

2.4. Physiological Parameters

2.4.1. Immune Indicators

For Exp 1, we evaluated several immune‐related variables to confirm that our vaccination protocol was effective in eliciting an immune response at both whole animal (leukocyte counts and respiratory burst in the blood; see below) and tissue levels (transcript abundance of immune‐related genes in each tissue of interest; see Section 2.5).

The total proportion of circulating leukocytes—as well as separate subpopulations of lymphocytes/thrombocytes (called “lymphocytes”) and neutrophil/monocytes (called “neutrophils”)—was quantified using flow cytometry according to the protocol of Inoue et al. [54]. Briefly, 10 μL of whole blood was diluted into 1986 μL of Hank's balanced salt solution (HBSS; Item #H8264, Sigma‐Aldrich) and 4 μL of ethanol containing 500 μg mL−1 DiOC6 (3,3′‐dihexyloxacarbocyanine iodide; Item #318426, Sigma‐Aldrich). After incubating at room temperature for 10 min in the dark with shaking (100 rpm), samples were filtered with a Falcon cell strainer (35 μm, Corning; Glendale, AZ, USA) and loaded into a FACSMelody cell sorter (RRID:SCR_023209; BD Bioscience; Mississauga, ON, Canada). All samples were agitated at 200 rpm during analysis, and an event rate of ~6000 events s−1 was maintained until 1 million events were recorded. Voltage thresholds were set at 15, 49, and 32 V for forward scatter, side scatter, and fluorescence photomultiplier tubes, respectively. Leukocyte subpopulations (see above) were identified within the FACSChorus software (BD Biosciences) based on differences in forward scatter, side scatter, and fluorescence intensities, as previously described [54].

The respiratory burst activity of leukocytes in the blood was measured as previously described [55]. Briefly, white polystyrene microplates (Corning) were prepared with four wells containing 75 μL of whole blood from each fish (three stimulated and one unstimulated). Stimulated wells received 85 μL of HBSS, 40 μL of luminol in HBSS (10 mM; Item #A8511, Sigma‐Aldrich), and 100 μL of zymosan A in HBSS (20 mg mL−1; Item #Z4250, Sigma‐Aldrich). Unstimulated wells received the same reagents except that 100 μL of HBSS was added in lieu of zymosan solution. The chemiluminescent signal in each well was measured every 3 min over 150 min using an LMax II384 luminometer (Molecular Devices; San Jose, CA, USA). We recorded the integral of the signal over the entire duration and, to account for background signal, the value of the unstimulated well was subtracted from the average value of the three stimulated wells for each fish (intra‐assay variation was 8.8% CV).

2.4.2. Plasma Cortisol and Osmolality

Plasma cortisol levels were measured using a previously validated, commercially available enzyme‐linked immunosorbent assay (ELISA; Item #402710, Neogen; Lexington, KY, USA) for fish from all experiments. Values of intra‐ and inter‐assay variation were 9.3% and 4.5% CV, respectively. Additionally, plasma osmolality values were determined in duplicate using a vapor pressure osmometer (Vapro 5520, Wescor; Logan, UT, USA) for fish from Exp 2, which had an intra‐assay variation of 0.8% CV.

2.5. RNA Isolation and qPCR

Gill and intestine (both middle and posterior regions) samples were ground on dry ice with a mortar and pestle, then homogenized in Ribozol reagent (VWR International; Mississauga, ON, Canada) using a Precellys Evolution tissue homogenizer (Bertin Instruments; Montigny‐le‐Bretonneux, France). Total RNA was extracted following the manufacturer's protocol, after which its quantity and purity were assessed using a NanoDrop 2000 spectrophotometer (Thermo Scientific; Mississauga, ON, Canada). We then treated 1 μg of RNA with DNase (DNase 1; Thermo Scientific) and reverse‐transcribed cDNA using a high‐capacity Applied Biosystems cDNA reverse transcription kit (Thermo Scientific). We performed qPCR using a CFX96 system (RRID:SCR_018064; BioRad; Hercules, CA, USA) with SYBR green (SsoAdvanced Universal; BioRad) and gene‐specific primers (Table 1). All samples were run in duplicate, and negative controls, including no‐template controls (where cDNA was replaced with water) and no reverse transcriptase controls (where RNA reverse transcriptase was replaced with water during cDNA synthesis) were included. Each reaction contained a total of 20 μL, which consisted of 10 μL of SYBR green, 5 μL of combined forward and reverse primers (0.2 μM [final]), and 5 μL of 10× diluted cDNA. Cycling parameters included a 30 s activation step at 95°C, followed by 40 cycles consisting of a 3 s denaturation step at 95°C and a combined 30 s annealing and extension step at 60°C. Melt curve analysis was conducted at the end of each run to confirm the specificity of each reaction. To account for differences in amplification efficiency, standard curves were constructed for each gene using serial dilutions (4×) of pooled cDNA. Input values for each gene were obtained by fitting the average threshold cycle value to the antilog of the gene‐specific standard curve, thereby correcting for differences in primer amplification efficiency. To correct for minor variations in template input and transcriptional efficiency, we measured transcript abundance of elongation factor 1 α (ef1α) and ribosomal protein L13a (rpl13a) as reference genes, which were both stable across groups in all experiments. Data were normalized using the geometric mean of these reference genes and are expressed relative to the mean value of the 6 h saline group in Exp 1, the 24 h FW group in Exp 2, and the fed group in Exp 3.

2.6. Statistical Analysis

Statistical analyses were performed using R (version 4.4.0, RRID:SCR_001905). All data are presented as means ±1 standard error of the mean (SEM), and a significance level (α) of 0.05 was used for all tests. Statistical outliers (maximum of 2 per group) were excluded based on a 2× interquartile range threshold. When data did not meet the assumptions of normality and/or equal variance, data were transformed to improve model fit. Data from each time course series was analyzed using ANOVAs that included either only time as a factor (Exp 3) or time, treatment, and their interaction term as factors (Exp 1 and 2). All models were fit using the lm function in the “lme4” package (RRID:SCR_015654; [56]) and overall differences were determined using the Anova function in the “car” package (RRID:SCR_022137). When significant differences were detected, Tukey's HSD post hoc analysis was performed using the emmeans function in the “emmeans” package (RRID:SCR_018734; [57]). Sex was not included in our analyses because fish were either sexually immature (Exps 1 and 2) or preliminary analyses revealed no effects of sex (Exp 3). The major findings of our analyses are described in the results section below; however, a detailed description of all nonsignificant statistical results can be found in the electronic Supporting Information (Tables S1–S3).

3. Results

3.1. Tissue Distribution

In general, transcript abundance of binding proteins and receptors was far more abundant in the gills and both regions of the intestine compared to most ligands (Figure 1). While undetectable in either region of the intestine, crfr2a was the most abundant receptor in the gills. Similarly, crfr1a and crfr1b were both ~5× more abundant in the gills than in either the Mid. Int. or Post. Int. Levels of crfr2b were twice as high in the Post. Int. compared to levels in either the gills or Mid. Int. For binding proteins, crfbp1 was the most abundant component expressed in the gills and was ~30× and ~60× more abundant there than in the Mid. Int. and Post. Int., respectively. In contrast, crfbp2 was the most abundant component in the intestine, with ~60× and ~30× greater abundance in the Mid. Int. and Post. Int., respectively, compared to the gills. Lastly, ucn3 was ~4× more abundant in the gills than in the intestine, crfa2 was ~5× more abundant in the intestine than in the gills, and crfa1 levels were low but detectable in all tissues. In contrast, we only detected ucn2b in the intestine, crfb1 and uts1a in the gills, and none of crfb2, uts1b, or ucn2a were detectable in any of the examined tissues.

FIGURE 1.

FIGURE 1

Relative abundance of individual ligands, binding proteins, and receptors of the corticotropin‐releasing factor system in the gills, middle intestine (Mid. Int.), and posterior intestine (Post. Int.) of rainbow trout ( Oncorhynchus mykiss ). Bars represent mean abundance (±SEM) of each component relative to crfa2 in the gills (the component with the lowest detectable levels). Each point (N = 3) represents an individual value from an unstressed fish. Components that were not detected in any of the three tissues are indicated with nd (not detected), and the ∅ symbol indicates instances where components were only undetectable in some tissues. Note that data are plotted on a Log10 scale for visualization purposes. crf, corticotropin‐releasing factor; crfbp, corticotropin‐releasing factor binding protein; crfr, corticotropin‐releasing factor receptor; ucn, urocortin; uts, urotensin.

3.2. Experiment 1: Immune Challenge

Vaccination caused total circulating leukocytes to decrease by 50% at 24 h (Figure 2A; ptreatment = 0.63, ptime < 0.001, pinteraction < 0.001), which was driven by a concurrent 50% reduction in lymphocyte counts at 24 h (Figure 2B; ptreatment = 0.02, ptime < 0.001, pinteraction < 0.001). In contrast, blood neutrophil counts in vaccinated fish were ~2.3 and ~1.5× higher at 72 h and 168 h (Figure 2C; ptreatment < 0.001, ptime < 0.001, pinteraction < 0.001), respectively. Similarly, respiratory burst activity in the blood was ~2.5× and ~1.5× greater in vaccinated fish at 72 h and 168 h (Figure 2D; ptreatment = 0.03, ptime < 0.001, pinteraction = 0.04), respectively. Plasma cortisol levels were ~35% higher in vaccinated fish across all time points and ~3× higher at 6 h compared to all other time points in both groups (Table 2); however, plasma cortisol levels were generally low in all fish (< 10 ng mL−1). Consistent with the observed immunological responses in the blood, transcript abundance of immune‐related genes further confirmed that all examined tissues mounted a robust immune response (Table 3). Peak activation of proinflammatory cytokines (il1b, ifnγ, and tnfα at 6–24 h) was followed by the elevation of a key anti‐inflammatory cytokine (il10 at 24 h), as well as a delayed and prolonged activation of the complement system (c3 at 24–168 h). Transcriptional responses of all immune‐related genes were greater in both regions of the intestine compared to the gills.

FIGURE 2.

FIGURE 2

Time‐dependent effects of saline or vaccine treatment on the percentage of leukocytes (A), lymphocytes (B), and neutrophils (C), as well as respiratory burst (D) in the blood of rainbow trout ( Oncorhynchus mykiss ). Significant differences (p < 0.05; two‐way ANOVA) are depicted using either letters (across time; uppercase = within vaccine group, lowercase = within saline group) or asterisks (between groups within a timepoint). Values are represented as means ± SEM, and individual data points are shown (N = 9–11).

TABLE 2.

Time‐dependent effects of vaccination (Exp 1), seawater transfer (Exp 2), and feeding state (Exp 3) on cortisol (ng mL−1; all Exp) and osmolality (mOsm kg−1; only Exp 2) in the plasma of rainbow trout ( Oncorhynchus mykiss ). Data are presented as means ± SEM (N = 7–11 per group). Significant effects are indicated with bold (p < 0.05). Differences as determined using post hoc analysis are depicted using either letters (time effects within a treatment, overall treatment effects, or overall time effects) or asterisks (treatment effect within a timepoint). Significant differences were not detected during post hoc analysis of plasma cortisol levels for Exp 3. Note that plasma cortisol and osmolality values from Exp 1 and 2 have previously been reported [32, 58].

Variable Exp Treatment Sampling Time F p
Plasma Cortisol 6 h B 24 h A 72 h A 168 h A
1 SalineA 7.4 ± 1.6 3.1 ± 0.9 1.1 ± 0.3 4.6 ± 0.7 Treatment 6.32 0.01
VaccineB 11.3 ± 1.3 4.4 ± 1.0 3.2 ± 0.8 3.3 ± 0.5 Time 19.32 < 0.001
Interaction 2.63 0.06
24 h 72 h 168 h
2 FW‐to‐FW 12.9 ± 3.5a 6.4 ± 3.2b 10.4 ± 2.7a Treatment 39.2 < 0.001
FW‐to‐SW 36.4 ± 7.8AB* 105.9 ± 19.9B* 14.9 ± 4.5A Time 1.9 0.16
Interaction 12.3 < 0.001
Fed 24 h 72 h 168 h
3 Fasted 12.0 ± 2.1 12.7 ± 3.0 9.1 ± 1.0 10.9 ± 0.8 Treatment 3.71 0.005
Fasted & Refed 5.4 ± 1.0 4.7 ± 0.6 7.9 ± 2.2
Plasma Osmolality 24 h 72 h 168 h
2 FW‐to‐FWA 293 ± 1 294 ± 1 295 ± 2 Treatment 177.8 < 0.001
FW‐to‐SWB 359 ± 4 385 ± 7 349 ± 12 Time 2.8 0.07
Interaction 2.3 0.11

TABLE 3.

Time‐dependent effects of saline or vaccine treatment on immune‐related genes in the gills, middle intestine (Mid. Int.), and posterior intestine (Post. Int.) of rainbow trout ( Oncorhynchus mykiss ). Data are presented as means ± SEM (N = 8–11 per group) and are expressed relative to the saline group at 6 h. Significant effects are indicated with bold (p < 0.05). Differences as determined using post hoc analysis are depicted using either letters (time effects within a treatment) or asterisks (treatment effect within a time point).

Tissue Gene Treatment Sampling time F p
6 h 24 h 72 h 168 h
Gills il1b Saline 1.00 ± 0.09 0.93 ± 0.08 0.88 ± 0.05 1.08 ± 0.07 Treatment 678.9 < 0.001
Vaccine 36.53 ± 2.90A* 6.66 ± 0.93B* 1.90 ± 0.11C* 1.19 ± 0.07D Time 148.3 < 0.001
Interaction 155.3 < 0.001
il10 Saline 1.00 ± 0.16a 0.49 ± 0.07b 1.04 ± 0.13a 0.42 ± 0.03b Treatment 11.0 0.001
Vaccine 0.75 ± 0.08A 2.42 ± 0.31B* 1.15 ± 0.16A 0.30 ± 0.03C* Time 38.9 < 0.001
Interaction 30.1 < 0.001
ifny Saline 1.00 ± 0.11 0.84 ± 0.06 1.09 ± 0.10 0.76 ± 0.10 Treatment 30.1 < 0.001
Vaccine 1.01 ± 0.07A 3.35 ± 0.65B* 1.76 ± 0.23C* 0.76 ± 0.07A Time 17.9 < 0.001
Interaction 12.9 < 0.001
tnfα Saline 1.00 ± 0.06ab 0.90 ± 0.02ab 0.81 ± 0.04a 1.02 ± 0.04b Treatment 142.6 < 0.001
Vaccine 4.74 ± 0.34A* 1.47 ± 0.15B* 0.99 ± 0.06C* 0.87 ± 0.04C Time 89.9 < 0.001
Interaction 73.7 < 0.001
c3 Saline 1.00 ± 0.08 1.03 ± 0.10 0.88 ± 0.05 1.00 ± 0.08 Treatment 105.4 < 0.001
Vaccine 1.22 ± 0.09A 2.96 ± 0.48B* 3.08 ± 0.41B* 1.29 ± 0.05A* Time 11.5 < 0.001
Interaction 15.1 < 0.001
Mid. Int. il1b Saline 1.00 ± 0.17ab 1.42 ± 0.27a 0.48 ± 0.04b 0.47 ± 0.04b Treatment 696.7 < 0.001
Vaccine 278.49 ± 39.45A* 101.06 ± 39.02B* 18.68 ± 2.70C* 2.12 ± 0.53D* Time 87.8 < 0.001
Interaction 44.5 < 0.001
il10 Saline 1.00 ± 0.16 1.12 ± 0.20 1.03 ± 0.21 0.77 ± 0.07 Treatment 210.7 < 0.001
Vaccine 11.48 ± 2.69A* 24.62 ± 6.05B* 6.90 ± 1.15A* 1.22 ± 0.14C Time 23.9 < 0.001
Interaction 16.6 < 0.001
ifny Saline 1.00 ± 0.10 1.54 ± 0.14 1.48 ± 0.13 1.56 ± 0.16 Treatment 224.7 < 0.001
Vaccine 5.60 ± 1.56A* 16.57 ± 1.70B* 10.60 ± 1.68B* 3.52 ± 0.59A* Time 15.7 < 0.001
Interaction 10.6 < 0.001
tnfα Saline 1.00 ± 0.11a 1.81 ± 0.17b 1.35 ± 0.12ab 1.42 ± 0.11ab Treatment 234.7 < 0.001
Vaccine 9.71 ± 0.72AB* 17.29 ± 4.14B* 6.91 ± 1.10A* 2.05 ± 0.25C Time 20.1 < 0.001
Interaction 19.6 < 0.001
c3 Saline 1.00 ± 0.16a 1.57 ± 0.32ab 1.90 ± 0.20b 1.72 ± 0.29ab Treatment 618.6 < 0.001
Vaccine 10.20 ± 2.10A* 36.67 ± 8.09B* 139.30 ± 18.64C* 40.73 ± 6.17B* Time 28.6 < 0.001
Interaction 9.8 < 0.001
Post. Int. il1b Saline 1.00 ± 0.14 0.95 ± 0.08 1.43 ± 0.20 0.97 ± 0.10 Treatment 581.0 < 0.001
Vaccine 181.55 ± 25.83A* 78.84 ± 26.38B* 28.57 ± 5.65C* 2.40 ± 0.41D* Time 48.7 < 0.001
Interaction 48.4 < 0.001
il10 Saline 1.00 ± 0.15a 2.89 ± 0.54b 1.88 ± 0.34ab 1.30 ± 0.32a Treatment 84.3 < 0.001
Vaccine 7.14 ± 1.47A* 24.12 ± 4.42B* 5.27 ± 0.94A* 1.02 ± 0.10C Time 36.0 < 0.001
Interaction 14.0 < 0.001
ifny Saline 1.00 ± 0.13a 2.07 ± 0.33b 2.01 ± 0.28b 0.77 ± 0.08a Treatment 126.9 < 0.001
Vaccine 2.96 ± 0.35A* 13.21 ± 2.22B* 5.06 ± 0.70A* 1.41 ± 0.10C* Time 44.0 < 0.001
Interaction 6.5 < 0.001
tnfα Saline 1.00 ± 0.10 1.52 ± 0.12 1.33 ± 0.10 1.25 ± 0.14 Treatment 197.7 < 0.001
Vaccine 9.79 ± 1.23AB* 15.95 ± 3.43B* 6.36 ± 1.16A* 1.69 ± 0.22C Time 20.5 < 0.001
Interaction 17.5 < 0.001
c3 Saline 1.00 ± 0.18a 1.67 ± 0.27ab 2.38 ± 0.35b 1.59 ± 0.21ab Interaction 455.4 < 0.001
Vaccine 8.54 ± 2.12A* 74.33 ± 20.24B* 93.57 ± 12.61B* 46.70 ± 6.79B* Treatment 25.2 < 0.001
Time 7.2 < 0.001

Abbreviations: c3, complement 3; ifny, interferon gamma; il1b, interleukin 1 beta; il10, interleukin 10; tnfα, tumor necrosis factor alpha.

In the Mid. Int., levels of crfbp1 (Figure 3A) and crfbp2 (Figure 3B) were both elevated in vaccinated fish compared to saline‐treated controls. Specifically, crfbp1 was ~2.5× and ~2× higher at 24 and 72 h (ptreatment < 0.001, ptime < 0.001, pinteraction < 0.001), respectively, while crfbp2 in vaccinated fish was ~25% higher overall (ptreatment = 0.04, ptime = 0.41, pinteraction = 0.32). In contrast, levels of crfr1b (Figure 3C; ptreatment = 0.03, ptime < 0.001, pinteraction = 0.19) and crfa2 (Figure 3D; ptreatment = 0.002, ptime < 0.001, pinteraction = 0.59) were lower in vaccinated fish compared to saline‐treated fish. This effect was greatest at 24 h for crfr1b—with levels in vaccinated fish being 25% those of saline‐treated fish—but levels of crfa2 were ~20% lower in vaccinated fish across all time points. Additionally, the abundance of crfr1b and crfa2 was 2–3‐fold higher overall at 24, 72, and 168 h compared to 6 h. No vaccine‐related changes were observed for crfr2b or ucn2b (Supp. Table 1).

FIGURE 3.

FIGURE 3

Time‐dependent effects of saline or vaccine treatment on transcript abundance of corticotropin‐releasing factor (CRF) binding protein 1 (crfbp1; A), CRF binding protein 2 (crfbp2; B), CRF receptor 1b (crfr1b; C), and CRFa2 (crfa2; D) in the middle intestine (Mid. Int.) of rainbow trout ( Oncorhynchus mykiss ). Significant differences (p < 0.05; two‐way ANOVA) are depicted using either letters (across time; uppercase = within vaccine group, underlined uppercase = overall time effect), filled oversized squares (between groups across all timepoints) or asterisks (between groups within a timepoint). Data are expressed relative to saline‐injected fish at 6 h. Values are represented as means ± SEM, and individual data points are shown (N = 8–11).

In the Post. Int., changes in crfbp1 (Figure 4A) and crfr1b (Figure 4B) mirrored those observed in the Mid. Int. Specifically, levels of crfbp1 in vaccinated fish were ~2.5× higher than those of saline‐treated fish at both 24 and 72 h (ptreatment < 0.001, ptime < 0.001, pinteraction = 0.006), and levels of crfr1b were ~70% lower than those of saline‐treated fish at 24 h (ptreatment = 0.08, ptime = 0.21, pinteraction = 0.01). While unaffected by vaccination, levels of crfa2 (Figure 4C; ptreatment = 0.62, ptime < 0.001, pinteraction = 0.07) gradually increased across the duration of the experiment with levels at 168 h being twice those at 6 h. No vaccine‐related changes were observed for crfbp2, crfr2b, or ucn2b (Table S1).

FIGURE 4.

FIGURE 4

Time‐dependent effects of saline or vaccine treatment on transcript abundance of corticotropin‐releasing factor (CRF) binding protein 1 (crfbp1; A), CRF receptor 1b (crfr1b; B), and CRFa2 (crfa2; C) in the posterior intestine (Post. Int.) of rainbow trout ( Oncorhynchus mykiss ). Significant differences (p < 0.05; two‐way ANOVA) are depicted using either letters (across time; uppercase = within vaccine group, underlined uppercase = overall time effect) or asterisks (between groups within a timepoint). Data are expressed relative to saline‐injected fish at 6 h. Values are represented as means ± SEM, and individual data points are shown (N = 8–11).

In contrast to the intestine, the only vaccine‐related change observed in the gills was lower crfr2a levels in vaccinated fish compared to saline‐treated fish at 72 h (Table S1). However, this difference was primarily driven by a transient reduction in the saline group at 72 h and not by altered crfr2a levels in vaccinated fish. Similarly, no vaccine‐related changes were observed for crfbp1, crfr1a, crfr1b, crfr2b, or ucn3 (Table S1).

3.3. Experiment 2: Osmotic Challenge

As previously reported [32], plasma cortisol and osmolality values (Table 2) were both elevated in SW versus FW fish. Plasma cortisol levels were ~3× and ~17× higher in SW fish at 24 and 72 h, respectively, whereas osmolality was ~25% higher in SW fish across the duration of the experiment.

In the Mid. Int., time‐dependent increases in all CRF components were observed in SW fish. Levels of crfbp1 (Figure 5A) transiently increased 2.5‐fold in SW fish at 72 h (ptreatment = 0.04, ptime = 0.86, pinteraction < 0.001), whereas levels of crfbp2 (Figure 5B; ptreatment = 0.70, ptime < 0.001, pinteraction = 0.001), crfr1b (Figure 5C; ptreatment = 0.20, ptime < 0.001, pinteraction < 0.001) and crfr2b (Figure 5D; ptreatment = 0.08, ptime < 0.001, pinteraction < 0.001) in SW fish were ~50% those of FW fish at 24 h, but had increased to levels ~2‐fold higher than FW fish by 168 h. Levels of crfa2 (Figure 5E; ptreatment = 0.20, ptime < 0.001, pinteraction < 0.001) and ucn2b (Figure 5F; ptreatment = 0.03, ptime = 0.003, pinteraction = 0.32) were also higher in SW fish compared to FW fish—especially at 72 (~3× higher) and 168 h (~60% higher). Additionally, transcript levels of both peptides increased 2–3‐fold over the course of the experiment.

FIGURE 5.

FIGURE 5

Time‐dependent effects of transfer from freshwater‐to‐freshwater (FW) or freshwater‐to‐seawater (SW) on transcript abundance of corticotropin‐releasing factor (CRF) binding protein 1 (crfbp1; A), CRF binding protein 2 (crfbp2; B), CRF receptors 1b (crfr1b; C) and 2b (crfr2b; D), CRFa2 (crfa2; E), and urocortin 2b (ucn2b; F) in the middle intestine (Mid. Int.) of rainbow trout ( Oncorhynchus mykiss ). Significant differences (p < 0.05; two‐way ANOVA) are depicted using either letters (across time; uppercase = within SW, lowercase = within FW, underlined uppercase = overall time effect), filled oversized squares (between groups across all timepoints) or asterisks (between groups within a timepoint). Data are expressed relative to FW fish at 24 h. Values are represented as means ± SEM, and individual data points are shown (N = 7–10).

In the Post. Int., levels of crfbp1 (Figure 6A) increased ~3‐fold across time in FW fish but not in SW fish (ptreatment = 0.27, ptime = 0.10, pinteraction = 0.046). Similar increases of ~2–3‐fold across the duration of the experiment were observed for crfbp2 (Figure 6B; ptreatment = 0.85, ptime = 0.03, pinteraction = 0.68), crfr1b (Figure 6C; ptreatment = 0.71, ptime = 0.06, pinteraction = 0.99), crfa2 (Figure 6D; ptreatment = 0.48, ptime = 0.04, pinteraction = 0.08), and ucn2b (Figure 6E; ptreatment = 0.97, ptime = 0.03, pinteraction = 0.85); however, these changes were consistent between FW and SW fish. No differences were detected for crfr2b (Table S2).

FIGURE 6.

FIGURE 6

Time‐dependent effects of transfer from freshwater‐to‐freshwater (FW) or freshwater‐to‐seawater (SW) on transcript abundance of corticotropin‐releasing factor (CRF) binding proteins 1 (crfbp1; A) and 2 (crfbp2; B), CRF receptor 1b (crfr1b; C), CRFa2 (crfa2; D), and urocortin 2b (ucn2b; E) in the posterior intestine (Post. Int.) of rainbow trout ( Oncorhynchus mykiss ). Significant differences (p < 0.05; two‐way ANOVA) are depicted using either letters (across time; lowercase = within FW, underlined uppercase = overall time effect) or asterisks (between groups within a timepoint). Data are expressed relative to FW fish at 24 h. Values are represented as means ± SEM and individual data points are shown (N = 7–10).

In the gills, levels of crfbp1 (Figure 7A), crfr1a (Figure 7B), crfr1b (Figure 7C), and crfr2a (Figure 7D) were all lower in SW fish. Time‐dependent reductions of ~30% were detected in SW fish for crfbp1 (ptreatment = 0.44, ptime = 0.02, pinteraction = 0.008) and crfr1b (ptreatment = 0.10, ptime = 0.74, pinteraction = 0.04) at 168 h and 72 h, respectively. Levels of crfr1a (ptreatment = 0.003, ptime = 0.65, pinteraction = 0.77) and crfr2a (ptreatment < 0.001, ptime = 0.46, pinteraction = 0.20) in SW fish were ~30% and ~40% lower, respectively, across all timepoints. No differences in crfr2b or ucn3 were detected (Table S2).

FIGURE 7.

FIGURE 7

Time‐dependent effects of transfer from freshwater‐to‐freshwater (FW) or freshwater‐to‐seawater (SW) on transcript abundance of corticotropin‐releasing factor (CRF) binding protein 1 (crfbp1; A), and CRF receptors 1a (crfr1a; B), 1b (crfr1b; C), and 2a (crfr2a; D) in the gills of rainbow trout ( Oncorhynchus mykiss ). Significant differences (p < 0.05; two‐way ANOVA) are depicted using either letters (across time within SW group), filled oversized squares (between groups across all timepoints), or asterisks (between groups within a timepoint). Data are expressed relative to FW fish at 24 h. Values are represented as means ± SEM and individual data points are shown (N = 7–10).

3.4. Experiment 3: Fasting and Re‐Feeding

In the Mid. Int., abundance of CRF system components—specifically, crfbp1 (Figure 8A; p = 0.03), crfbp2 (Figure 8B; p = 0.03), crfr1b (Figure 8C; p = 0.01), and crfr2b (Figure 8D; p < 0.001)—generally decreased (by up to 50%) over the course of the 7d fast. Transcript levels gradually returned to levels consistent with fed animals once feeding resumed. In the Post. Int., levels of crfbp2 (Figure 9A; p < 0.001), crfr1b (Figure 9B; p = 0.009), crfr2b (Figure 9C; p = 0.02), and crfa2 (Figure 9D; p = 0.02) all increased ~2–4‐fold during the 7d fast. Interestingly, while abundance of these genes all returned to levels consistent with fed animals by the end of the 7d re‐feeding period, levels of crfbp2, crfr1b, and crfr2b initially increased ~2–3‐fold prior to this decline. No changes were observed in crfa2 and ucn2b in the Mid. Int. or ucn2b and crfbp1 in the Post. Int. (Table S3).

FIGURE 8.

FIGURE 8

Time‐dependent effects of fasting and re‐feeding on transcript abundance of corticotropin‐releasing factor (CRF) binding proteins 1 (crfbp1; A) and 2 (crfbp2; B), and CRF receptors 1b (crfr1b; C) and 2b (crfr2b; D) in the middle intestine (Mid. Int.) of rainbow trout ( Oncorhynchus mykiss ). Significant differences (p < 0.05; one‐way ANOVA) are depicted using letters; except in Panel A where the p value is reported because no significant post hoc comparisons were detected. Data are expressed relative to control fish that were fed 1 h prior to sampling. Values are represented as means ± SEM and individual data points are shown (N = 6–7).

FIGURE 9.

FIGURE 9

Time‐dependent effects of fasting and re‐feeding on transcript abundance of corticotropin‐releasing factor (CRF) binding protein 2 (crfbp2; A), CRF receptors 1b (crfr1b; B) and 2b (crfr2b; C), and CRFa2 (crfa2; D) in the posterior intestine (Post. Int.) of rainbow trout ( Oncorhynchus mykiss ). Significant differences (p < 0.05; one‐way ANOVA) are depicted using letters. Data are expressed relative to control fish that were fed 1 h prior to sampling. Values are represented as means ± SEM and individual data points are shown (N = 5–7).

While a significant difference in plasma cortisol levels was observed during the fasting‐refeeding experiment (Table 2), no differences were detected during subsequent post hoc analysis, and cortisol levels were generally low across all groups (< 15 ng mL−1).

4. Discussion

While neuroendocrine functions for the CRF system in the brain (e.g., regulation of the HPA/HPI axis) are well established [5, 20], stress‐related roles for the CRF system outside of the brain are less well understood, especially in nonmammalian vertebrates. In the current study, we first established that most components of the CRF system were present in both the gills and intestine of rainbow trout; however, we were unable to detect crfb2, uts1b, or ucn2a in either tissue, and uts1a (gills), crfb1 (gills), and ucn2b (intestine) were only detectable in one of these tissues. These findings are consistent with our previous studies of the peripheral CRF system in salmonids (e.g., spleen, intestine, and gills [33, 34, 58]), which collectively suggest that only a subset of CRF ligands (e.g., CRFa and UCN3) have para/autocrine functions within peripheral tissues. Instead, it seems likely that circulating CRF peptides originating from the caudal neurosecretory system—especially CRFb and UTS1 [32, 59]—also contribute to CRF system regulation in these tissues. This hypothesis is further supported by the high levels of CRFBP measured in the gills and intestine. Since CRFBP has high affinity for CRFb and UTS1 (but not UCN3 [60, 61]), CRFBP may determine the relative responsiveness of these tissues to changes in circulating levels of CRF ligands. Overall, our distribution data support physiological functions for the CRF system in both the gills and intestine of rainbow trout.

To evaluate whether components of the CRF system were regulated in a tissue‐ and stressor‐specific manner, we first characterized time‐dependent responses following an immune challenge (i.e., vaccine administration). Vaccinated fish had higher blood neutrophil counts and respiratory burst activity, indicating that fish mounted a robust immune response. Vaccination was also associated with lower circulating lymphocytes at 24 h, likely reflecting the movement of lymphocytes from the blood to lymphoid organs and the site of vaccination in support of systemic and local immune responses [62, 63, 64]. Consistent with immune responses observed in the blood, we also detected large (~15–300‐fold) increases in immune‐related transcripts across both the middle and posterior portions of the intestine following vaccination. These responses occurred in parallel with transcriptional changes in several CRF system components 24‐72 h post‐vaccination; specifically, an upregulation of CRFBP (especially crfbp1) combined with a downregulation of crfr1b and crfa2. We also found that splenic levels of these same CRF system components displayed similar transcriptional changes [58] suggesting that suppression of CRFR1 signaling in response to vaccination may be widespread across tissues. In mammals, activation of the CRF system—with specific effects mediated by both CRFR1 and CRFR2—causes wide‐ranging proinflammatory effects in the intestine, including increased production of proinflammatory cytokines (e.g., IL6, IL8, and TNFα [21, 22, 23]). While no previous study has evaluated immune contributions of the CRF system in the intestine of fish, Jiang et al. [26] suggested that anti‐inflammatory actions of UTS1 in ayu ( Plecoglossus altivelis ) head kidney leukocytes were caused by UTS1‐mediated inhibition of IL6 signaling pathways. While these findings contrast with mammalian studies, UTS1 treatment also elicited immunosuppressive effects (reduced phagocytotic activity) in cultured spotted snakehead ( Channa punctatus ) spleen monocytes [28]. Our results do not support an anti‐inflammatory role for the intestinal CRF system in trout since the observed reductions in transcript levels of crfr1b and crfa2 coincided with peak production of the anti‐inflammatory cytokine il10, however, it is possible that the observed transcriptional changes in CRF system components facilitate greater phagocytotic activity following vaccination. Indeed, Singh & Rai [28] used receptor‐specific antagonists to show that the anti‐phagocytotic effects associated with UTS1 were mediated by CRFR1 (and not CRFR2), which is consistent with the observed downregulation of intestinal crfr1b at 24 h post‐vaccination. Additionally, van Heijningen et al. [29] reported that mutant zebrafish larvae lacking crfr1 recruited fewer macrophages and more neutrophils following tail fin amputation, offering further evidence that CRFR1 has important immune functions in teleosts. Overall, while our transcriptional results are consistent with CRFR1‐mediated immunoregulatory roles in the intestine of trout, additional work is needed to determine whether these roles vary between species, tissues, cell types, and/or immune components (e.g., innate versus adaptive immune systems).

Unlike in the intestine, we did not detect any transcriptional changes in the gill CRF system following vaccination. As discussed above, since the CRF system generally has proinflammatory effects in mammals, we predicted an acute activation of the CRF system during the initial surge of proinflammatory cytokine production, followed by suppression of CRF system activity as anti‐inflammatory cytokines are activated [22, 65]—the latter of which was observed in the intestine. Indeed, Jiang et al. [26] found that transcript levels of UTS1 acutely increased in the gills of ayu following infection with V. anguillarum (12‐24 h after onset of infection). In contrast, Mazon et al. [27] reported that chronic (3 weeks) infection with the parasite Trypanoplasma borreli caused transcript levels of crfr1 and crfbp in the gills of common carp to decrease by ~60%. These different responses could reflect several factors, including species‐specific regulation of the gill CRF system, the type of immune challenge used (vaccination versus infection with an actual pathogen), and/or whether cortisol levels were concurrently elevated. Similarly, it is possible that the immune challenge used in the current study failed to elicit a strong enough local immune response to affect the gill CRF system, especially since previous in vitro work has shown that the CRF system can influence proinflammatory cytokine systems in Atlantic salmon ( Salmo salar ) gills (e.g., IL23 and IL17 receptors; [34]). While we detected significant transcriptional responses for all immune‐related genes that were measured in the gills, these responses were weaker than those observed in the intestine (current study) or spleen [58], despite similar baseline expression across tissues. However, changes in gill CRF system components were observed by Mazon et al. [27] despite T. borreli infection not being associated with large changes in cytokine expression in carp [66]. Therefore, it is possible that changes in the gill CRF system following parasite infection reflect other actions associated with CRF in the gills (e.g., regulation of angiogenesis and/or endothelial permeability; [34]) and might not have been directly contributing to immunoregulatory functions. Thus, future investigations evaluating how immune challenges of different types and intensities influence the CRF system across tissues and between species will help to determine the extent to which the CRF system serves immune functions in teleosts.

In addition to the immune challenge, we also evaluated how the peripheral CRF system responded to an osmotic stressor. Following SW transfer, fish mounted a cortisol response lasting at least 72 h (but not more than 168 h) and displayed elevated plasma osmolality during the entire 168 h experimental period. Both responses indicate that fish were perturbed by this osmotic stressor [46, 67]; however, the reduction in plasma cortisol levels by 168 h suggests that fish had begun to acclimate by this time. Consistent with the plasma responses observed, we also detected transcriptional changes in several components of the gill CRF system during this period. Most notably, crfr1a and crfr2a were downregulated across all sampling times in SW transferred fish, while levels of crfr1b and crfbp1 were lower in SW transferred fish at 72 and 168 h, respectively. These findings are largely consistent with our previous work in Atlantic salmon, where SW transfer was associated with a general transcriptional downregulation of the CRF system (and vice‐versa when SW‐acclimated salmon were transferred into FW)—especially crfr2a and ucn2a [34]. Indeed, the tissue distribution of CRF system components in rainbow trout (current study) and Atlantic salmon [34] also shares many similarities, especially high expression of crfr2a and crfbp1, suggesting that the role(s) of the CRF system in the gills are likely conserved among salmonids. We have previously suggested that these changes in gill CRF system transcription reflect regulatory contributions of the CRF system toward angiogenesis, endothelial permeability, and/or immune regulation in the gills because in vitro treatment of gill filaments with CRFa affected levels of transcripts related to these physiological processes [34]. However, it is likely that the role of the gill CRF system varies between species since levels of crfr1 and crfb were ~5–15‐fold higher in tilapia ( Oreochromis mossambicus ) 30 days after transfer from FW‐to‐SW [30], contrary to the downregulation of CRFR1 observed here. Our previous work in Atlantic salmon [34] also indicates that the observed downregulation of crfr1a and crfr1b (at least during the first 72 h following SW transfer) could be mediated by elevated cortisol levels. Yet, there also appear to be species‐specific differences in the regulatory effects of corticosteroids on components of the gill CRF system since crfr1 levels were increased when black porgy ( Acanthopagrus schlegelii ) gill filaments were treated in vitro with dexamethasone for 48 h [31]. Regardless, the current data clearly support the hypothesis that the CRF system has osmoregulatory functions in the gills of salmonids.

In contrast to the gills, while transcript levels of several CRF system components in the Mid. Int. were initially downregulated following SW transfer (crfbp2, crfr1b, and crfr2b), the abundance of most CRF system components was elevated by 168 h post‐transfer to SW. These contrasting responses between tissues likely reflect the different osmoregulatory role(s) of the gills versus the intestine in SW. Whereas the gills are responsible for exporting ions out of the body, ions are taken up across the intestine to maintain a favorable gradient facilitating water absorption [37, 38, 39]. However, it is not clear why greater transcription of CRF system components in the intestine of SW‐acclimated fish would be beneficial from an osmoregulatory standpoint since the CRF system generally promotes ion and/or water excretion (or reduces absorption) across taxa and epithelium types [25, 36, 68]. Indeed, activation of CRFR2 in the intestine of FW‐acclimated Atlantic salmon reduced absorption of water, Na+, and Cl [33]. Similarly, Mainoya & Bern [35] reported that UTS1 treatment had inhibitory effects on water, Na+, and Cl uptake in the intestine of FW‐acclimated (but not SW‐acclimated) Mozambique tilapia, suggesting a greater role for the intestinal CRF system in FW. Therefore, it is possible that the observed changes in the CRF system during SW acclimation may indirectly assist with water and/or solute transport by affecting processes related to angiogenesis and/or endothelial permeability in the Mid. Int. [34]. Unlike the Mid. Int., few changes in CRF system transcript levels were observed in the Post. Int. following SW transfer. Instead, transcript levels of several genes (crfbp1, crfbp2, crfr1b, crfa2, and ucn2b) increased across time in both the FW‐ and SW‐transferred groups. Indeed, time‐dependent increases in crfa2 transcript levels were also observed in the Post. Int. during the vaccination experiment. Since fish were fasted during both experiments—replicating natural responses of salmonids following immune and osmotic stressors [46, 47, 48, 52, 53]—we decided to evaluate whether changes in feeding state might explain these responses.

The hypothalamic CRF system is a potent regulator of food intake in fish and other vertebrates [42, 44, 69], but the relationship between food intake and CRF system components located outside of the brain is less clear. Several previous studies have reported the presence of various CRF system components in the teleost intestine [70, 71], but we believe that our data are the first to show that transcript abundance of CRF system components in the intestine can vary with feeding state. Interestingly, responses in the middle versus posterior regions of the intestine exhibited opposing patterns, wherein levels declined in the Mid. Int. and increased in the Post. Int. As previously mentioned, activation of the CRF system reduces absorption of water and ions across the intestine in fish and the colon in mammals [33, 35, 72]. While these effects are mediated by CRFR1 in mammals [25], activation of CRFR2 was primarily responsible for these effects in Atlantic salmon [33]. Interestingly, peripheral treatment with CRF peptides can also delay clearance rates in the stomach and small intestine via a CRFR2‐dependent mechanism in mammals [25]. Thus, transcriptional changes in the CRF system observed in both the middle (reduced abundance, suggesting faster clearance rates) and posterior (increased abundance, suggesting reduced absorption rates) regions of the intestine are consistent with CRF contributing to reductions in intestine functionality and investment during extended fasts. While the functional importance of such CRF‐mediated changes is unclear, they may contribute to fasting‐related changes in nutrient/water absorption, immune regulation, and/or alterations in the microbiome [73, 74, 75]. However, since fasting‐related transcriptional responses in both regions of the intestine were generally different than those following either SW transfer or vaccination, the role of the intestinal CRF system is clearly complex and warrants additional study.

In conclusion, we found that the gill and intestine CRF systems are differentially regulated by osmotic and immune stressors. While transcription of CRF system components in the gills decreased following SW transfer, we observed no transcriptional response in the gill CRF system during an immune stressor. In contrast, transcript levels of most intestine CRF system components decreased in response to an immune challenge but increased in the middle intestine following SW transfer. Lastly, fasting caused region‐specific transcriptional changes in the CRF system within the middle (reduction) and posterior (activation) regions of the intestine. Overall, our findings highlight the breadth and functional diversity of stress‐related roles that the CRF system serves outside of the brain.

Author Contributions

Brett M. Culbert: conceptualization, data curation, formal analysis, investigation, methodology, supervision, validation, visualization, writing – original draft, writing – review and editing. Alexis E. Pulford‐Thorpe: investigation, writing – review and editing. Carol Best: investigation, methodology, validation, writing – review and editing. Nicholas J. Bernier: conceptualization, funding acquisition, investigation, methodology, resources, supervision, writing – review and editing.

Funding

This work was supported by a Natural Sciences and Engineering Research Council of Canada (NSERC) Discovery grant provided to NB (RGPIN‐2022‐03151). BMC was supported by a NSERC Doctoral Canadian Graduate Scholarship (CGS‐D) and an Ontario Graduate Scholarship (OGS). CB was supported by a NSERC postdoctoral scholarship.

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Table S1: Time‐dependent effects of saline or vaccine treatment on transcript abundance of CRF system components in the gills, and middle (Mid. Int.) and posterior (Post. Int.) segments of the intestine in rainbow trout ( Oncorhynchus mykiss ). Data are presented as means ± SEM (N = 8 = 11 per group). Significant effects are indicated with bold (p < 0.05) and differences based on post hoc analysis are indicated using letters (across time within a group), asterisks (between groups within a timepoint) or symbols (overall time effects).

Table S2: Time‐dependent effects of transfer from freshwater‐to‐freshwater (FW) or freshwater‐to‐seawater (SW) on transcript abundance of CRF system components in the gills and posterior intestine (Post. Int.) in rainbow trout ( Oncorhynchus mykiss ). Data are presented as means ± SEM (N = 6 = 10 per group).

Table S3: Time‐dependent effects of fasting and refeeding on transcript abundance of CRF system components in the middle (Mid. Int.) and posterior (Post. Int.) segments of the intestine in rainbow trout ( Oncorhynchus mykiss ). Data are presented as means ± SEM (N = 6–7 per group). Significant effects are indicated with bold (p < 0.05) and differences between groups based on post hoc analysis are indicated using letters. Note that significant differences were not detected during post hoc analysis of crfbp1 in the Mid. Int.

FSB2-40-e72270-s001.pdf (302.9KB, pdf)

Acknowledgments

We thank Matt Cornish, Carolyn Trombley, and Mike Davies for their assistance with fish care and advice regarding experimental setups, as well as Dr. Marcia Chiasson and the staff at the Ontario Aquaculture Research Centre for providing us with the rainbow trout. We also thank Emma Mossington and Shayla Larson for their help during dissections, Sarah Alderman for allowing use of the flow cytometer, and Brian Dixon and Tania Rodríguez‐Ramos for assistance with the respiratory burst assay.

Contributor Information

Brett M. Culbert, Email: brett.m.culbert@gmail.com.

Nicholas J. Bernier, Email: nbernier@uoguelph.ca.

Data Availability Statement

Data are deposited on Mendeley Data (doi: http://doi.org/10.17632/bnr9zp28fp.1).

References

  • 1. Carr J. A., “Stress and Reproduction in Amphibians,” in Hormones and Reproduction of Vertebrates, vol. 2, ed. Norris D. O. and Lopez K. H. (Academic Press, 2024), 121–150, 10.1016/b978-0-443-16020-2.00002-4. [DOI] [Google Scholar]
  • 2. Wingfield J. C., “Ecological Processes and the Ecology of Stress: The Impacts of Abiotic Environmental Factors,” Functional Ecology 27 (2013): 37–44, 10.1111/1365-2435.12039. [DOI] [Google Scholar]
  • 3. Goldstein D. S., “Peripheral Catecholamine Systems: An Evolutionary Perspective,” American Journal of Physiology. Regulatory, Integrative and Comparative Physiology 329 (2025): R1032–R1052, 10.1152/ajpregu.00169.2025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Reid S. G., Bernier N. J., and Perry S. F., “The Adrenergic Stress Response in Fish: Control of Catecholamine Storage and Release,” Comparative Biochemistry and Physiology Part C: Pharmacology, Toxicology and Endocrinology 120 (1998): 1–27, 10.1016/s0742-8413(98)00037-1. [DOI] [PubMed] [Google Scholar]
  • 5. Best C., Culbert B. M., and Bernier N. J., “The Hypothalamic–Pituitary–Interrenal Axis and Corticosteroids,” in Encyclopedia of Fish Physiology (Second Edition), ed. Alderman S. L. and Gillis T. E. (Academic Press, 2024), 217–232, 10.1016/b978-0-323-90801-6.00145-2. [DOI] [Google Scholar]
  • 6. McEwen B. S., “Central Effects of Stress Hormones in Health and Disease: Understanding the Protective and Damaging Effects of Stress and Stress Mediators,” European Journal of Pharmacology 583 (2008): 174–185, 10.1016/j.ejphar.2007.11.071. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. McEwen B. S. and Seeman T., “Protective and Damaging Effects of Mediators of Stress: Elaborating and Testing the Concepts of Allostasis and Allostatic Load,” Annals of the New York Academy of Sciences 896 (1999): 30–47, 10.1111/j.1749-6632.1999.tb08103.x. [DOI] [PubMed] [Google Scholar]
  • 8. Bouyoucos I. A., Schoen A. N., Wahl R. C., and Anderson W. G., “Ancient Fishes and the Functional Evolution of the Corticosteroid Stress Response in Vertebrates,” Comparative Biochemistry and Physiology. Part A, Molecular & Integrative Physiology 260 (2021): 111024, 10.1016/j.cbpa.2021.111024. [DOI] [PubMed] [Google Scholar]
  • 9. Creel S., Dantzer B., Goymann W., and Rubenstein D. R., “The Ecology of Stress: Effects of the Social Environment,” Functional Ecology 27 (2013): 66–80, 10.1111/j.1365-2435.2012.02029.x. [DOI] [Google Scholar]
  • 10. Dantzer B. and Newman A. E. M. “Expanding the Frame Around Social Dynamics and Glucocorticoids: From Hierarchies Within the Nest to Competitive Interactions Among Species,” Hormones and Behavior 144 (2022): 105204, 10.1016/j.yhbeh.2022.105204. [DOI] [PubMed] [Google Scholar]
  • 11. Chatzitomaris A., Hoermann R., Midgley J. E., et al., “Thyroid Allostasis–Adaptive Responses of Thyrotropic Feedback Control to Conditions of Strain, Stress, and Developmental Programming,” Frontiers in Endocrinology 8 (2017): 163, 10.3389/fendo.2017.00163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Deck C. A., Honeycutt J. L., Cheung E., Reynolds H. M., and Borski R. J., “Assessing the Functional Role of Leptin in Energy Homeostasis and the Stress Response in Vertebrates,” Frontiers in Endocrinology 8 (2017): 63, 10.3389/fendo.2017.00063. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Puglisi‐Allegra S. and Andolina D., “Serotonin and Stress Coping,” Behavioural Brain Research 277 (2015): 58–67, 10.1016/j.bbr.2014.07.052. [DOI] [PubMed] [Google Scholar]
  • 14. Bernier N. J., Alderman S. L., and Bristow E. N., “Heads or Tails? Stressor‐Specific Expression of Corticotropin‐Releasing Factor and Urotensin I in the Preoptic Area and Caudal Neurosecretory System of Rainbow Trout,” Journal of Endocrinology 196 (2008): 637–648, 10.1677/joe-07-0568. [DOI] [PubMed] [Google Scholar]
  • 15. Bernier N. J., Gorissen M., and Flik G., “Differential Effects of Chronic Hypoxia and Feed Restriction on the Expression of Leptin and Its Receptor, Food Intake Regulation and the Endocrine Stress Response in Common Carp,” Journal of Experimental Biology 215 (2012): 2273–2282, 10.1242/jeb.066183. [DOI] [PubMed] [Google Scholar]
  • 16. Bowers S. L., Bilbo S. D., Dhabhar F. S., and Nelson R. J., “Stressor‐Specific Alterations in Corticosterone and Immune Responses in Mice,” Brain, Behavior, and Immunity 22 (2008): 105–113, 10.1016/j.bbi.2007.07.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Pacák K. and Palkovits M., “Stressor Specificity of Central Neuroendocrine Responses: Implications for Stress‐Related Disorders,” Endocrine Reviews 22 (2001): 502–548, 10.1210/edrv.22.4.0436. [DOI] [PubMed] [Google Scholar]
  • 18. Culbert B. M. and Bernier N. J., “What's in a Name? Nomenclature Inconsistencies in the Corticotropin‐Releasing Factor/Hormone System Across Time and Taxa,” General and Comparative Endocrinology 380 (2026): 114931, 10.1016/j.ygcen.2026.114931. [DOI] [PubMed] [Google Scholar]
  • 19. Maugars G., Mauvois X., Martin P., Aroua S., Rousseau K., and Dufour S., “New Insights Into the Evolution of Corticotropin‐Releasing Hormone Family With a Special Focus on Teleosts,” Frontiers in Endocrinology 13 (2022): 937218, 10.3389/fendo.2022.937218. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Aguilera G., “Corticotropin Releasing Hormone, Receptor Regulation and the Stress Response,” Trends in Endocrinology and Metabolism 9 (1998): 329–336, 10.1016/s1043-2760(98)00079-4. [DOI] [PubMed] [Google Scholar]
  • 21. Chatoo M., Li Y., Ma Z., Coote J., Du J., and Chen X., “Involvement of Corticotropin‐Releasing Factor and Receptors in Immune Cells in Irritable Bowel Syndrome,” Frontiers in Endocrinology 9 (2018): 21, 10.3389/fendo.2018.00021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Dermitzaki E., Venihaki M., Tsatsanis C., et al., “The Multi‐Faceted Profile of Corticotropin‐Releasing Factor (CRF) Family of Neuropeptides and of Their Receptors on the Paracrine/Local Regulation of the Inflammatory Response,” Current Molecular Pharmacology 11 (2018): 39–50, 10.2174/1874467210666170109164430. [DOI] [PubMed] [Google Scholar]
  • 23. Kiank C., Taché Y., and Larauche M., “Stress‐Related Modulation of Inflammation in Experimental Models of Bowel Disease and Post‐Infectious Irritable Bowel Syndrome: Role of Corticotropin‐Releasing Factor Receptors,” Brain, Behavior, and Immunity 24 (2010): 41–48, 10.1016/j.bbi.2009.08.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Cain D. W. and Cidlowski J. A., “Immune Regulation by Glucocorticoids,” Nature Reviews. Immunology 17 (2017): 233–247, 10.1038/nri.2017.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Stengel A. and Taché Y., “Neuroendocrine Control of the Gut During Stress: Corticotropin‐Releasing Factor Signaling Pathways in the Spotlight,” Annual Review of Physiology 71 (2009): 219–239, 10.1146/annurev.physiol.010908.163221. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Jiang R., Lu X.‐J., Lu J.‐F., and Chen J., “Characterization of Ayu ( Plecoglossus altivelis ) Urocortin: The Function of an Endocrine Factor in Monocyte/Macrophage Regulation,” Developmental and Comparative Immunology 117 (2021): 103978, 10.1016/j.dci.2020.103978. [DOI] [PubMed] [Google Scholar]
  • 27. Mazon A. F., Kemenade B. M. L. V., Flik G., and Huising M. O., “Corticotropin‐Releasing Hormone‐Receptor 1 (CRH‐R1) and CRH‐Binding Protein (CRH‐BP) Are Expressed in the Gills and Skin of Common Carp Cyprinus carpio L. and Respond to Acute Stress and Infection,” Journal of Experimental Biology 209 (2006): 510–517, 10.1242/jeb.01973. [DOI] [PubMed] [Google Scholar]
  • 28. Singh R. and Rai U., “Immunomodulatory Role of Urotensins in Teleost Channa punctatus ,” General and Comparative Endocrinology 170 (2011): 613–621, 10.1016/j.ygcen.2010.11.021. [DOI] [PubMed] [Google Scholar]
  • 29. van Heijningen J., van der Pluijm L. H. M., Schaaf M. J. M., and Faught E., “Corticotropin‐Releasing Hormone Enhances the Responsivity of Macrophages to Inflammation in Zebrafish,” General and Comparative Endocrinology 373 (2025): 114815, 10.1016/j.ygcen.2025.114815. [DOI] [PubMed] [Google Scholar]
  • 30. Aruna A., Nagarajan G., and Chang C.‐F., “Involvement of Corticotrophin‐Releasing Hormone and Corticosteroid Receptors in the Brain–Pituitary–Gill of Tilapia During the Course of Seawater Acclimation,” Journal of Neuroendocrinology 24 (2012): 818–830, 10.1111/j.1365-2826.2012.02282.x. [DOI] [PubMed] [Google Scholar]
  • 31. Aruna A., Wang T.‐P., Cao J.‐C., Lan D.‐S., Nagarajan G., and Chang C.‐F., “Differential Expression of Hypothalamic and Gill‐Crh System With Osmotic Stress in the Euryhaline Black Porgy, Acanthopagrus schlegelii ,” Frontiers in Physiology 12 (2021): 768122, 10.3389/fphys.2021.768122. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Culbert B. M., McCormick S. D., and Bernier N. J., “Effects of Environmental Salinity on Global and Endocrine‐Specific Transcriptomic Profiles in the Caudal Neurosecretory System of Salmonid Fishes,” FASEB Journal 39 (2025): e70477, 10.1096/fj.202403241r. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Culbert B. M., McCormick S. D., and Bernier N. J., “Osmoregulatory Contributions of the Corticotropin‐Releasing Factor System in the Intestine of Atlantic Salmon,” Journal of Experimental Biology 228 (2025): jeb250052, 10.1242/jeb.250052. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Culbert B. M., Mossington E., McCormick S. D., and Bernier N. J., “Regulation and Function of the Gill Corticotropin‐Releasing Factor System During Osmoregulatory Disturbances in Atlantic Salmon,” Journal of Experimental Biology 228 (2025): jeb248168, 10.1242/jeb.248168. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Mainoya J. R. and Bern H. A., “Effects of Teleost Urotensins on Intestinal Absorption of Water and NaCl in Tilapia, Sarotherodon mossambicus , Adapted to Fresh Water or Seawater,” General and Comparative Endocrinology 47 (1982): 54–58, 10.1016/0016-6480(82)90083-1. [DOI] [PubMed] [Google Scholar]
  • 36. Marshall W. S. and Bern H. A., “Active Chloride Transport by the Skin of a Marine Teleost Is Stimulated by Urotensin I and Inhibited by Urotensin II,” General and Comparative Endocrinology 43 (1981): 484–491, 10.1016/0016-6480(81)90233-1. [DOI] [PubMed] [Google Scholar]
  • 37. Evans D. H., Piermarini P. M., and Choe K. P., “The Multifunctional Fish Gill: Dominant Site of Gas Exchange, Osmoregulation, Acid‐Base Regulation, and Excretion of Nitrogenous Waste,” Physiological Reviews 85 (2005): 97–177, 10.1152/physrev.00050.2003. [DOI] [PubMed] [Google Scholar]
  • 38. Grosell M., “The Role of the Gastrointestinal Tract in Salt and Water Balance,” in The Multifunctional Gut of Fish, ed. Grosell M., Farrell A. P., and Brauner C. J. (Academic Press, 2010), 135–164, 10.1016/s1546-5098(10)03004-9. [DOI] [Google Scholar]
  • 39. Larsen E. H., Deaton L. E., Onken H., et al., “Osmoregulation and Excretion,” Comprehensive Physiology 4 (2014): 405–573, 10.1002/j.2040-4603.2014.tb00553.x. [DOI] [PubMed] [Google Scholar]
  • 40. Koppang E. O., Kvellestad A., and Fischer U., “Fish Mucosal Immunity: Gill,” in Mucosal Health in Aquaculture, ed. Beck B. H. and Peatman E. (Academic Press, 2015), 93–133, 10.1016/b978-0-12-417186-2.00005-4. [DOI] [Google Scholar]
  • 41. Salinas I. and Parra D., “Fish Mucosal Immunity: Intestine,” in Mucosal Health in Aquaculture, ed. Beck B. H. and Peatman E. (Academic Press, 2015), 135–170, 10.1016/b978-0-12-417186-2.00006-6. [DOI] [Google Scholar]
  • 42. Bernier N. J., “The Corticotropin‐Releasing Factor System as a Mediator of the Appetite‐Suppressing Effects of Stress in Fish,” General and Comparative Endocrinology 146 (2006): 45–55, 10.1016/j.ygcen.2005.11.016. [DOI] [PubMed] [Google Scholar]
  • 43. Bernier N. J. and Peter R. E., “Appetite‐Suppressing Effects of Urotensin I and Corticotropin‐Releasing Hormone in Goldfish ( Carassius auratus ),” Neuroendocrinology 73 (2001): 248–260, 10.1159/000054642. [DOI] [PubMed] [Google Scholar]
  • 44. Conde‐Sieira M., Chivite M., Míguez J. M., and Soengas J. L., “Stress Effects on the Mechanisms Regulating Appetite in Teleost Fish,” Frontiers in Endocrinology 9 (2018): 631, 10.3389/fendo.2018.00631. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Ortega V. A., Lovejoy D. A., and Bernier N. J., “Appetite‐Suppressing Effects and Interactions of Centrally Administered Corticotropin‐Releasing Factor, Urotensin I and Serotonin in Rainbow Trout ( Oncorhynchus mykiss ),” Frontiers in Neuroscience 7 (2013): 196, 10.3389/fnins.2013.00196. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Craig P. M., Al‐Timimi H., and Bernier N. J., “Differential Increase in Forebrain and Caudal Neurosecretory System Corticotropin‐Releasing Factor and Urotensin I Gene Expression Associated With Seawater Transfer in Rainbow Trout,” Endocrinology 146 (2005): 3851–3860, 10.1210/en.2005-0004. [DOI] [PubMed] [Google Scholar]
  • 47. Sørum U. and Damsgård B., “Effects of Anaesthetisation and Vaccination on Feed Intake and Growth in Atlantic Salmon ( Salmo salar L.),” Aquaculture 232 (2004): 333–341, 10.1016/s0044-8486(03)00529-5. [DOI] [Google Scholar]
  • 48. Usher M. L., Talbot C., and Eddy F. B., “Effects of Transfer to Seawater on Growth and Feeding in Atlantic Salmon Smolts ( Salmo salar L.),” Aquaculture 94 (1991): 309–326, 10.1016/0044-8486(91)90176-8. [DOI] [Google Scholar]
  • 49. Khansari A. R., Balasch J. C., Vallejos‐Vidal E., Parra D., Reyes‐López F. E., and Tort L., “Comparative Immune‐ and Stress‐Related Transcript Response Induced by Air Exposure and Vibrio anguillarum Bacterin in Rainbow Trout ( Oncorhynchus mykiss ) and Gilthead Seabream ( Sparus aurata ) Mucosal Surfaces,” Frontiers in Immunology 9 (2018): 856, 10.3389/fimmu.2018.00856. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Khansari A. R., Balasch J. C., Vallejos‐Vidal E., et al., “Comparative Study of Stress and Immune‐Related Transcript Outcomes Triggered by Vibrio anguillarum Bacterin and Air Exposure Stress in Liver and Spleen of Gilthead Seabream ( Sparus aurata ), Zebrafish ( Danio rerio ) and Rainbow Trout ( Oncorhynchus mykiss ),” Fish & Shellfish Immunology 86 (2019): 436–448, 10.1016/j.fsi.2018.11.063. [DOI] [PubMed] [Google Scholar]
  • 51. Sundh H., Nilsen T. O., Lindström J., et al., “Development of Intestinal Ion‐Transporting Mechanisms During Smoltification and Seawater Acclimation in Atlantic Salmon Salmo salar ,” Journal of Fish Biology 85 (2014): 1227–1252, 10.1111/jfb.12531. [DOI] [PubMed] [Google Scholar]
  • 52. Arnesen A. M., Jørgensen E. H., and Jobling M., “Feed Intake, Growth and Osmoregulation in Arctic Charr, Salvelinus alpinus (L.), Following Abrupt Transfer From Freshwater to More Saline Water,” Aquaculture 114 (1993): 327–338, 10.1016/0044-8486(93)90307-k. [DOI] [PubMed] [Google Scholar]
  • 53. Damsgård B. and Arnesen A. M., “Feeding, Growth and Social Interactions During Smolting and Seawater Acclimation in Atlantic Salmon, Salmo salar L,” Aquaculture 168 (1998): 7–16, 10.1016/s0044-8486(98)00335-4. [DOI] [Google Scholar]
  • 54. Inoue T., Moritomo T., Tamura Y., Mamiya S., Fujino H., and Nakanishi T., “A New Method for Fish Leucocyte Counting and Partial Differentiation by Flow Cytometry,” Fish & Shellfish Immunology 13 (2002): 379–390, 10.1006/fsim.2002.0413. [DOI] [PubMed] [Google Scholar]
  • 55. Semple S. L., Kellendonk C. J., Al‐Hussinee L., MacInnes J. I., Lumsden J. S., and Dixon B., “Serum IgM, MH Class IIβ Genotype and Respiratory Burst Activity Do Not Differ Between Rainbow Trout Families Displaying Resistance or Susceptibility to the Coldwater Pathogen, Flavobacterium psychrophilum ,” Aquaculture 483 (2018): 131–140, 10.1016/j.aquaculture.2017.10.020. [DOI] [Google Scholar]
  • 56. Bates D., Mächler M., Bolker B., and Walker S., “Fitting Linear Mixed‐Effects Models Using lme4,” Journal of Statistical Software 67 (2015): 1–48, 10.18637/jss.v067.i01. [DOI] [Google Scholar]
  • 57. Lenth R. V., “Least‐Squares Means: The R Package Lsmeans,” Journal of Statistical Software 69 (2016): 1–33, 10.18637/jss.v069.i01. [DOI] [Google Scholar]
  • 58. Culbert B. M., Grosman L., Rodríguez‐Ramos T., Dixon B., and Bernier N. J., “Regulation of the Rainbow Trout Spleen Corticotropin‐Releasing Factor System in Response to Inflammatory Challenges: Roles of NF‐κB and Cortisol,” Molecular and Cellular Endocrinology 622 (2026): 112892, 10.1016/j.mce.2026.112892. [DOI] [PubMed] [Google Scholar]
  • 59. Rousseau K., Girardot F., Parmentier C., and Tostivint H., “The Caudal Neurosecretory System: A Still Enigmatic Second Neuroendocrine Complex in Fish,” Neuroendocrinology 115 (2025): 154–194, 10.1159/000536270. [DOI] [PubMed] [Google Scholar]
  • 60. Lewis K., Li C., Perrin M. H., et al., “Identification of Urocortin III, an Additional Member of the Corticotropin‐Releasing Factor (CRF) Family With High Affinity for the CRF2 Receptor,” Proceedings of the National Academy of Sciences of the United States of America 98 (2001): 7570–7575, 10.1073/pnas.121165198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61. Manuel R., Metz J. R., Flik G., Vale W. W., and Huising M. O., “Corticotropin‐Releasing Factor‐Binding Protein (CRF‐BP) Inhibits CRF‐ and Urotensin‐I‐Mediated Activation of CRF Receptor‐1 and ‐2 in Common Carp,” General and Comparative Endocrinology 202 (2014): 69–75, 10.1016/j.ygcen.2014.04.010. [DOI] [PubMed] [Google Scholar]
  • 62. von Andrian U. H. and Mempel T. R., “Homing and Cellular Traffic in Lymph Nodes,” Nature Reviews. Immunology 3 (2003): 867–878, 10.1038/nri1222. [DOI] [PubMed] [Google Scholar]
  • 63. Ballesteros N. A., Castro R., Abos B., Saint‐Jean S. S. R., Pérez‐Prieto S. I., and Tafalla C., “The Pyloric Caeca Area Is a Major Site for IgM+ and IgT+ B Cell Recruitment in Response to Oral Vaccination in Rainbow Trout,” PLoS One 8 (2013): e66118, 10.1371/journal.pone.0066118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64. Scapigliati G., Miccoli A., Buonocore F., Fausto A. M., and Picchietti S., “Lymphocytes of Teleosts,” in Principles of Fish Immunology: From Cells and Molecules to Host Protection, ed. Buchmann K. and Secombes C. J. (Springer, 2022), 177–201, 10.1007/978-3-030-85420-1_5. [DOI] [Google Scholar]
  • 65. Webster E. L., Torpy D. J., Elenkov I. J., and Chrousos G. P., “Corticotropin‐Releasing Hormone and Inflammation,” Annals of the New York Academy of Sciences 840 (1998): 21–32, 10.1111/j.1749-6632.1998.tb09545.x. [DOI] [PubMed] [Google Scholar]
  • 66. Saeij J. P. J., de Vries B. J., and Wiegertjes G. F., “The Immune Response of Carp to Trypanoplasma borreli: Kinetics of Immune Gene Expression and Polyclonal Lymphocyte Activation,” Developmental & Comparative Immunology 27 (2003): 859–874, 10.1016/s0145-305x(03)00083-1. [DOI] [PubMed] [Google Scholar]
  • 67. Culbert B. M., Regish A. M., Hall D. J., McCormick S. D., and Bernier N. J., “Neuroendocrine Regulation of Plasma Cortisol Levels During Smoltification and Seawater Acclimation of Atlantic Salmon,” Frontiers in Endocrinology 13 (2022): 859817, 10.3389/fendo.2022.859817. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68. Cannell E., Dornan A. J., Halberg K. A., Terhzaz S., Dow J. A. T., and Davies S.‐A., “The Corticotropin‐Releasing Factor‐Like Diuretic Hormone 44 (DH44) and Kinin Neuropeptides Modulate Desiccation and Starvation Tolerance in Drosophila melanogaster ,” Peptides 80 (2016): 96–107, 10.1016/j.peptides.2016.02.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69. Stengel A. and Taché Y., “CRF and Urocortin Peptides as Modulators of Energy Balance and Feeding Behavior During Stress,” Frontiers in Neuroscience 8 (2014): 52, 10.3389/fnins.2014.00052. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70. Arai M., Assil I. Q., and Abou‐Samra A. B., “Characterization of Three Corticotropin‐Releasing Factor Receptors in Catfish: A Novel Third Receptor Is Predominantly Expressed in Pituitary and Urophysis,” Endocrinology 142 (2001): 446–454, 10.1210/en.142.1.446. [DOI] [PubMed] [Google Scholar]
  • 71. Chen C.‐C. and Fernald R. D., “Sequences, Expression Patterns and Regulation of the Corticotropin‐Releasing Factor System in a Teleost,” General and Comparative Endocrinology 157 (2008): 148–155, 10.1016/j.ygcen.2008.04.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72. Santos J., Saunders P. R., Hanssen N. P. M., et al., “Corticotropin‐Releasing Hormone Mimics Stress‐Induced Colonic Epithelial Pathophysiology in the Rat,” American Journal of Physiology ‐ Gastrointestinal and Liver Physiology 277 (1999): G391–G399, 10.1152/ajpgi.1999.277.2.g391. [DOI] [PubMed] [Google Scholar]
  • 73. Li S., Li J., Zhao Y., Zhang Q., and Wang Q., “Nutrient Sensing Signaling Integrates Nutrient Metabolism and Intestinal Immunity in Grass Carp, Ctenopharyngodon idellus After Prolonged Starvation,” Fish & Shellfish Immunology 71 (2017): 50–57, 10.1016/j.fsi.2017.09.050. [DOI] [PubMed] [Google Scholar]
  • 74. Wood C. M. and Bucking C., “The Role of Feeding in Salt and Water Balance,” in The Multifunctional Gut of Fish, ed. Grosell M., Farrell A. P., and Brauner C. J. (Academic Press, 2010), 165–212, 10.1016/s1546-5098(10)03005-0. [DOI] [Google Scholar]
  • 75. Xia J. H., Lin G., Fu G. H., et al., “The Intestinal Microbiome of Fish Under Starvation,” BMC Genomics 15 (2014): 266, 10.1186/1471-2164-15-266. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Table S1: Time‐dependent effects of saline or vaccine treatment on transcript abundance of CRF system components in the gills, and middle (Mid. Int.) and posterior (Post. Int.) segments of the intestine in rainbow trout ( Oncorhynchus mykiss ). Data are presented as means ± SEM (N = 8 = 11 per group). Significant effects are indicated with bold (p < 0.05) and differences based on post hoc analysis are indicated using letters (across time within a group), asterisks (between groups within a timepoint) or symbols (overall time effects).

Table S2: Time‐dependent effects of transfer from freshwater‐to‐freshwater (FW) or freshwater‐to‐seawater (SW) on transcript abundance of CRF system components in the gills and posterior intestine (Post. Int.) in rainbow trout ( Oncorhynchus mykiss ). Data are presented as means ± SEM (N = 6 = 10 per group).

Table S3: Time‐dependent effects of fasting and refeeding on transcript abundance of CRF system components in the middle (Mid. Int.) and posterior (Post. Int.) segments of the intestine in rainbow trout ( Oncorhynchus mykiss ). Data are presented as means ± SEM (N = 6–7 per group). Significant effects are indicated with bold (p < 0.05) and differences between groups based on post hoc analysis are indicated using letters. Note that significant differences were not detected during post hoc analysis of crfbp1 in the Mid. Int.

FSB2-40-e72270-s001.pdf (302.9KB, pdf)

Data Availability Statement

Data are deposited on Mendeley Data (doi: http://doi.org/10.17632/bnr9zp28fp.1).


Articles from The FASEB Journal are provided here courtesy of Wiley

RESOURCES