Zinc citrate‐coated whey protein nanoparticles alleviate kidney damage and the disturbances in inflammatory gene expression in rats

Abstract

This work was conducted to synthesize whey protein nanoparticles (WPNPs) for the coating of zinc citrate (Zn CITR) at three levels and to study their protective role against CCl₄‐induced kidney damage and inflammatory gene expression disorder in rats. Seventy male Sprague‐Dawley rats were divided into seven groups and treated orally for 4 weeks as follows; the control group, the group treated twice a week with CCl₄ (5 mL/kg b.w), the groups received CCl₄ plus WPNPs (300 mg/kg b.w); the group received 50 mg/kg b.w of Zn CITR or the three formulas of Zn CITR‐WPNPs at low, medium and high doses (LD, MD, and HD). Blood and kidney samples were collected for different assays and histological analyses. The fabricated particles were semispherical, with an average size of 160 ± 2.7, 180 ± 3.1, and 200 ± 2.6 nm and ζ potential of −126, −93, and −84 mV for ZN CITR‐WPNPs (LD), Zn CITR‐WPNPs (MD), and ZN CITR‐WPNPs (HD), respectively. CCl₄ significantly increased (p ≤ 0.05) kidney function indices, oxidative stress markers, messenger RNA expression of transforming growth factor‐β1, interleukin (IL)‐1β, IL‐10, IL‐6, inducible nitric oxide synthase, and tumor necrosis factor‐α and significantly decreased (p ≤ 0.05) renal superoxide dismutase, catalase, and glutathione peroxidase along with the histological changes in the kidney tissues. WPNPs, Zn CITR, and Zn CITR loaded WPNPS showed a protective effect against these complications and Zn CITR‐WPNPs (LD) was more effective. WPNPs can be used effectively for coating Zn CITR at a level of 7 mg/g WPNPs to be used as a supplement for the protection of the kidney against different toxicants to enhance immunity and avoid harm of excess Zn.

1. INTRODUCTION

Chronic kidney disease (CKD) is considered a major public health concern, widespread, costly, and often detected too late to be reversible and cause death in a high percentage.^{[ 1} , ² , ^{3 ]} The kidney is very important for vital biological processes and the activation of Vitamin D3 to the active state^{[ 4} , ^{5 ]} and thus, its functional integrity is critical for the whole body's health.^{[ 6 ]} Exposure to toxic compounds may induce severe disturbances in the kidneys leading to CKD.^{[ 7 ]} Consequently, the kidneys are among the most toxic‐prone organs in comparison to the other body organs.^{[ 7 ]} Additionally, kidney injuries may accompany exposure to other environmental chemicals in the workplace and/or during medicinal risks.^{[ 8 ]} Therefore, the protection of kidneys against different contaminants and environmental chemicals is inevitable.^{[ 6 ]}

Zinc has a vital role in cell proliferation, immune system, signaling transduction, and gene regulation^{[ 9} , ^{10 ]} and plays an important role in protein synthesis, regeneration, redox regulation,^{[ 11} , ^{12 ]} antioxidation,^{[ 13 ]} and endocrine system^{[ 14 ]} due to its preservation of the cell membrane, and metallothionein induction.^{[ 13} , ¹⁵ , ^{16 ]} It is also involved in many catalytic activities of enzymes such as DNA replication, energy metabolism, and growth.^{[ 17} , ^{18 ]} The efficiency of zinc compounds supplementation is affected by several factors including the sensory attributes and the suability. The EU approved the water‐soluble Zn sulfate for food fortification due to its low cost.^{[ 19 ]} However, Zn citrate was used as an alternative Zn compound owing to high Zn content, its acceptable sensory properties, and its being odorless.^{[ 20 ]} Despite this, the data on the human absorption of Zn citrate is limited; few data points showed that this compound is more absorbed than Zn oxide.^{[ 21 ]} Furthermore, Zn citrate has the same bioavailability as Zn acetate, Zn sulfate, Zn oxide, and Zn gluconate.^{[ 22 ]} Generally, fortification of food with ZN faced some challenges including its effect on flavor and gastric pH on the bioavailability of ZN compounds.^{[ 20} , ^{23 ]} Hence, encapsulation of ZN compounds may be an effective tool for increasing their bioavailability and avoiding their sensory defects.

Milk proteins are divided into two main groups: casein and whey protein.^{[ 24 ]} Whey protein isolate (WPI) is an important by‐product obtained from cheese manufacture and it is widely used as a carrier material for encapsulation and protection due to its good emulsification and super crystallization properties.^{[ 25} , ^{26 ]} Moreover, WPI is characterized by its high bioavailability, nutritional quality, and its high concentration of essential amino acids.^{[ 26} , ^{27 ]} WPI can also be fabricated into nanoparticles and can be used to encapsulate and various hydrophobic/bioactive compounds, such as flavor compounds, vitamins, and carotenoids^{[ 25 ]} to improve their stability, physical and chemical properties.^{[ 26} , ²⁸ , ^{29 ]} This study was conducted to load zinc citrate (ZN CITR) on WPI nanoparticles (WPNPs) to promote the absorption of ZN and enhance its protection role against renal injury and genotoxicity in CCl₄‐treated rats.

2. MATERIALS AND METHODS

2.1. Materials, chemicals, and kits

ZN CITR was provided by El Nasr Pharmaceutical Chemicals Co. WPI was supplied by Davisco Foods International Inc. RevertAid™ H Minus First Strand cDNA Synthesis Kits were supplied by Sigma Chemical Co. TMDNase and the removal reagent kit were purchased from Promega, Co. Kits for creatinine, urea, and uric acid were obtained from Prodia Co. Catalase (CAT), nitric oxide (NO), superoxide dismutase (SOD), and glutathione peroxidase (GPx) kits were purchased from Eagle diagnostics, and the malondialdehyde (MDA) kit provided by Oxis Research™ Co. TRIZOL reagent was purchased from Invitrogen™. All other chemicals used throughout the experiments were of the highest analytical grade available.

2.2. Preparation of whey protein soluble polymers and WPNPs

Whey protein soluble polymers were prepared as described in our previous work,^{[ 30 ]} however, WPNPs were synthesized by the pH‐cycling method.^{[ 31 ]}

2.3. Coating and characterization of ZN CITR by WPNPs (ZN CITR‐WPNPs)

Three formulas of Zn‐WPNPs were prepared using three concentrations of ZN CITR representing the low dose (7 mg/g WPNPs), the medium dose (14 mg/g WPNPs), and the high dose (28 mg/kg WPNPs) according to Hassan et al.^{[ 30 ]} The particles size and the size distribution of ZN CITR‐WPNPs were determined by a particle size analyzer (Nano‐ZS; Malvern Instruments Ltd.) and ZN CITR‐WPNPs morphology was specified using the Scanning Electron Microscopy (Quanta FEG 250 SEM).

2.4. Experimental animals

Three‐month‐old sexually mature male Sprague‐Dawley rats (120–130 g) were supplied by the National Organization of Drug Control and Research (NODCR). The animals were fed on a standard lab diet provided by Meladco Feed Co. and housed in filter‐top polycarbonate cages under a standard condition of illumination with a 12 h dark/light cycle, 25 ± 1°C, and humidity of 50 ± 5% in a room free from any chemical contamination at the Animal House Lab (NODCR). All animals received humane care in compliance with the guidelines of the Animal Care and Use Committee of the NODCR and the National Institutes of Health (NIH publication 86‐23 revised 1985).

2.5. Experimental design

The rats were distributed into seven equal groups (10 rats/group) and treated daily by gavage for 4 weeks as follows: group 1, the control; group 2, animals that treated by gavage with 3.3% CCl₄ in corn oil (0.5 mL/100 g b.w) twice a week; group 3, animals that treated by gavage with WPNPs (300 mg/kg b.w.) plus CCl₄; group 4, animals that treated by gavage with ZN CITR (50 mg/kg b.w) plus CCl₄ and the groups treated by gavage with ZN CITR‐WPNPs (low dose [LD]), ZN CITR‐WPNPs (medium dose [MD]), or ZN CITR‐WPNPs (high dose [HD]) plus CCl₄.

2.5.1. Sampling and tissue preparation

At the end of the treatment period (i.e., Day 28), all animals have fasted for 12 h, and then samples of blood were collected from the retro‐orbital venous plexus under isoflurane anesthesia. Sera were separated using cooling centrifugation and stored at −20°C until analysis and were used for creatinine, urea, and uric acid determination according to the kit's instructions using a spectrophotometer. All animals were then euthanized and three kidney samples were collected from each animal within different treatment groups. The first sample was dissected, weighed, homogenized in phosphate buffer (pH 7.4), and centrifuged (1700 rpm and 4°C for 10 min). The supernatant was used for MDA, NO, CAT, GPx, and SOD determination^{[ 32 ]} according to the kit's instructions. The second sample from each animal was removed and fixed in 10% formol aldehyde, dehydrated, paraffinized, sectioned (5‐mm thickness), and stained by hematoxylin and eosin stains for histological examination.^{[ 33 ]} However, the third sample of each animal was quickly frozen using liquid nitrogen and kept at −80°C for genetic analysis.

2.5.2. Molecular genetics

Real‐time quantitative polymerase chain reaction (PCR)

The pro‐inflammatory cytokines, transforming growth factor‐β1 (TGF‐β1), interleukin (IL)‐6, IL‐10, tumor necrosis factor (TNF)‐α, and inducible nitric oxide synthase (iNOS) were quantified by a real‐time reverse transcription PCR (RT‐PCR) system (Agilent Technologies). Total RNA was isolated from kidney tissue specimens using TRIzol reagent according to the instructions of the manufacturer. The extracted RNA was dissolved in 30 μL nuclease‐free distilled water and stored at −80°C until used. The purity and concentration of RNA were determined by NanoDrop™ 1000 Spectrophotometer (Thermo Fisher Scientific). RNase‐free DNase kit was used for removing DNA contamination. One microgram of RNA was reverse‐transcribed using PreMix cDNA Kit. PCR primer pairs were developed for pro‐inflammatory cytokines based on the published primer sequences (Table 1). Glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) and β‐actin amplification were used as the housekeeping gene in semiquantitative PCR analysis. All samples were amplified in a minimum of triplicates and amplification was performed with a 15‐min denaturation at 95°C, then 40 cycles of 95°C for 12 s, 58–63°C for 15 s, and 72°C for 30 s. To assess amplification specificity, a melting curve analysis was performed. Relative gene expression levels normalized to GAPDH and β‐actin were calculated using the $2^{‐∆∆C_{\mathrm{t}}}$ method according to Livak and Schmittgen.^{[ 40 ]}

Table 1.

Primer sequences for the genes amplified.

cDNA	Forward primer (5′–3′)	Reverse primer (5′–3′)	References
TGF‐β1	CTT CAG CTC CAC AGA GAA GAA CTG C	CAC GAT CAT GTT GGA CAA CTG CTCC	[34]
IL‐1β	TGA TGT TCC CAT TAG ACA GC	GAG GTG CTG ATG TAC CAG TT	[34]
IL‐6	TGA TGG ATG CTT CCA AAC TG	GAG CAT TGG AAG TTG GGG TA	[35]
Il‐10	GTGAAGACTTTCTTTCAAACAAG	CTGCTCCACTGCCTTGCTCTTATT	[36]
TNF‐α	CCACCACGCTCTTCTGTCTAC	ACCACCAGTTGGTTGTCTTTG	[37]
iNOS	GACCAGAAACTGTCTCACCTG	CGAACATCGAACGTCTCACA	[36]
GAPDH	AACTTTGGCATTGTGGAAGG	ACACATTGGGGGTAGGAACA	[38]
β‐actin	CCACCATGTACCCAGGCATT	CGGACTCATCGTACTCCTGC	[39]

Abbreviations: cDNA, complementary DNA; GAPDH, glyceraldehyde‐3‐phosphate dehydrogenase; IL, interleukin; iNOS, inducible nitric oxide synthase; TGF‐β1, transforming growth factor‐β1; TNF, tumor necrosis factor.

2.6. Statistical analysis

The data were checked for normality and the homogeneity of the variance using the Kolmogorov–Smirnov's test and Levene's test, respectively. All data were statistically analyzed by one‐way analysis of variance (ANOVA) using the General Linear Models Procedure of the Statistical Analysis System.^{[ 41 ]} The significance of the differences among treatment groups was determined by Waller–Duncan k ratio.^{[ 42 ]} All statements of significance were based on a probability of p ≤ 0.05.

3. RESULTS

The results of dynamic light scattering (DLS) measurements of the size distribution as expressed in the numbers showed uniform granules of the particles with a size of 100 ± 2.3, 160 ± 2.7, 180 ± 3.1, and 200 ± 2.6 nm for WPNPs (Figure 1A), ZN CITR‐WPNPs (LD) (Figure 1B), ZN CITR‐WPNPs (MD) (Figure 1C) and ZN CITR‐WPNPs (HD), respectively. The transmission electron microscopy images (Figure 1E–H) showed that all the particles have semispherical shapes. Moreover, the Zetasizer results (Figure 1I–L) revealed that all the particles have a negative ζ potential of −96, −126, −93, and −84 mV for WPNPs, ZN CITR‐WPNPs (LD), ZN CITR‐WPNPs (MD), and ZN CITR‐WPNPs (HD), respectively.

Figure 1.

First row: Size distribution measurements by DLS of (A) WPNPs, (B) ZN CITR‐WPNPs (LD), (C) ZN CITR‐WPNPs (MD), and (D) ZN CITR‐WPNPs (HD). Second row: TEM images for (E) WPNPs, (F) ZN CITR‐WPNPs (LD), (G) ZN CITR‐WPNPs (MD), and (H) ZN CITR‐WPNPs (HD). Third row: ZetaSizer chromatogram showing the ζ potential of (I) WPNPs, (J) ZN CITR‐WPNPs (LD), (K) ZN CITR‐WPNPs (MD), and (L) ZN CITR‐WPNPs (HD). DLS, dynamic light scattering; HD, high dose; LD, low dose; MD, medium dose; TEM, transmission electron microscopy; WPNP, whey protein nanoparticles; ZN CITR, zinc citrate.

The present results showed that treatment with CCl₄ elevated the serum creatinine, uric acid, and urea (Table 2). Cotreatment with CCl₄ plus WPNPs or ZN CITR resulted in a remarkable improvement in creatinine, uric acid, and urea compared with the CCl₄‐treated group. On the other hand, the treatment with ZN CITR‐WPNPs at the tested doses plus CCl₄ induced more improvement; although ZN CITR‐WPNPs (LD) was more effective.

Table 2.

Effect of WPNPs, ZN CITR, and ZN CITR‐WPNPs on kidney function parameters in rats treated with CCl₄.

Groups parameter	Control	CCL4	WPNPs + CCL4	ZN CITR + CCL4	ZN CITR‐WPNPs (LD) + CCl4	ZN CITR‐WPNPs (MD) + CCl4	ZN CITR‐WPNPs (HD) + CCl4
Creatinine (mg/dL)	1.94 ± 0.32a	8.67 ± 0.64b	5.09 ± 0.46c	5.99 ± 0.21c	2.27 ± 0.08d	3.10 ± 0.20e	4.32 ± 0.19f
Uric acid (mg/dL)	3.13 ± 0.21a	6.57 ± 0.15b	3.49 ± 0.26c	3.81 ± 0.32d	3.27 ± 0.21a	3.70 ± 0.20d	4.04 ± 0.35e
Urea (mg/dL)	29.0 ± 1.69a	55.46 ± 4.24b	43.17 ± 1.45c	47.38 ± 1.09d	30.12 ± 1.66a	33.39 ± 1.18e	36.11 ± 1.35f

Note: Within each row, means superscripts with different letters are significantly different (p < 0.05).

Abbreviations: HD, high dose; LD, low dose; MD, medium dose; WPNP, whey protein nanoparticles; ZN CITR, zinc citrate.

The data presented in Table (3) showed that CCl₄ induced oxidative damage in the renal tissue as indicated by the elevated renal MDA and NO. WPNPs alone, ZN CITR alone, or ZN CITR‐WPNPs at the tested levels succeeded in counteracting the oxidative damage of CCl₄ in renal tissue. Moreover, ZN CITR alone was more effective than WPNPs alone, and ZN CITR‐WPNPs induced further protection; ZN CITR‐WPNPs (LD) was more effective compared to the other levels. The alteration of antioxidant status in the kidney in different treatments (Table 3) showed that CCl₄ treatment decreased GPx, SOD, and CAT. Treatment with CCl₄ plus WPNPs or ZN CITR showed a remarkable improvement in these antioxidant enzymes. Moreover, treatment with CCl₄ plus ZN CITR‐WPNPs showed pronounced improvement in the renal antioxidant and this improvement was related to the ZN CITR level since ZN CITR‐WPNPs (LD) showed the highest improvement of the antioxidant status.

Table 3.

Effect of WPNPs, ZN CITR, and ZN CITR‐WPNPs on renal NO, MDA, and antioxidant enzymes in rats treated with CCl₄.

Groups parameter	Control	CCL4	WPNPs + CCL4	ZN CITR + CCL4	ZN CITR‐WPNPs (LD) + CCl4	ZN CITR‐WPNPs (MD)+ CCl4	ZN CITR‐WPNPs (HD) + CCl4
NO (mM/mg)	515.0 ± 8.50a	630 ± 6.66b	536.33 ± 4.98c	537.33 ± 7.36c	528.67 ± 4.67d	549.0 ± 6.33e	599.67 ± 2.19 f
MDA (nmol/g)	73.58 ± 1.49a	158.07 ± 5.81b	85.69 ± 3.44c	103.85 ± 2.59d	86.06 ± 2.30c	89.52 ± 1.40c	92.02 ± 2.13e
GPx (U/g)	429.89 ± 54.72a	177.46 ± 8.54b	269.3 ± 3.30c	246.41 ± 6.32d	233.44 ± 7.49e	228.05 ± 6.19f	204.03 ± 2.52g
SOD (U/g)	31.46 ± 2.48a	11.24 ± 1.46b	22.72 ± 3.51c	23.07 ± 3.25c	29.60 ± 1.46a	28.32 ± 0.75d	27.76 ± 1.87e
CAT (mu/g)	4.20 ± 0.10a	1.66 ± 0.08b	2.82 ± 0.11c	2.68 ± 0.05c	3.92 ± 0.31d	3.76 ± 0.18d	3.73 ± 0.28d

Note: Within each row, means superscripts with different letters are significantly different (p < 0.05).

Abbreviations: CAT, catalase; GPx, glutathione peroxidase; HD, high dose; LD, low dose; MD, medium dose; MDA, malondialdehyde; NO, nitric oxide; SOD, superoxide dismutase; WPNP, whey protein nanoparticles; ZN CITR, zinc citrate.

The effects of different treatments on gene expression for an inflammatory indicator such as TGF‐β1, IL‐1β, IL‐6, IL‐10, TNF‐α, and iNOS in rats intoxicated by CCl₄ were evaluated using qRT‐PCR analysis. The changes in messenger RNA (mRNA) inflammatory‐related gene expression in the kidneys of rats in different treatment groups compared to the control group are represented in Figure 2. No significant difference in the mRNA expression of these genes was seen between the control group and the groups treated with WPNPs and/or ZN CITR‐WPNPs. While animals treated with CCl₄ alone showed a significant increase in the expressions of all tested related gene expressions as compared to the control groups. Cotreatment with CCl₄ plus WPNPs, ZN CITR, or ZN CITR‐WPNPs at the three tested levels succeeded in improving the mRNA expression of all tested related genes toward the control levels. Moreover, cotreatment with CCl₄ plus ZN CITR‐WPNPs (LD) showed the most effective results since it normalized the expression of these inflammatory genes.

Figure 2.

Effect of ZN CITR loaded WPNPs on mRNA expression of (A) TGF‐β1, (B) IL‐1β, (C) IL‐10, (D) IL‐6, (E) TNF‐α, and (F) iNOS inflammatory‐related genes in the kidney of rats treated with CCl₄. Mean ± SE (n = 5). One‐way analysis of variance was used for data analysis, mean values with different superscript letters were significantly different (p ≤ 0.05). IL, interleukin; iNOS, inducible nitric oxide synthase; mRNA, messenger RNA; TGF‐β1, transforming growth factor‐β1; TNF, tumor necrosis factor; WPNP, whey protein nanoparticles; ZN CITR, zinc citrate.

The histological results of the control kidney showed normal proximal and distal convoluted tubules, and the renal corpuscle with a parietal layer of Bowman's capsule, glomeruli, and preserved renal space (Figure 3A). The examination of kidney sections in rats intoxicated with CCl₄ showed pathological alterations represented tubular dilatation with pyknotic nuclei and hyaline casts in their lumen, others showed necrosis, venous congestion, and hemorrhage with lymphocytic proliferation. Some glomerular mesangial proliferation or atrophy were also seen (Figure 3B). WPNPs plus CCl₄ administration showed nearly normal renal tubules with vesiculated epithelial cell nuclei. Few tubules have hyaline casts or hemorrhage in their lumen and glomerular mesangial proliferation or degeneration (Figure 3C). The examination of kidney sections in animals treated with ZN CITR plus CCl₄ showed focal necrosis of the proximal convoluted tubular lining epithelial cells with areas of desquamation of the cells in the tubular lumina. Most renal tubules and glomeruli are largely intact with areas of inflammatory cell invasion (Figure 3D). The kidney sections of animals treated with ZN CITR‐WPNPs (LD) showed proximal tubular dilatation with dark eosinophilic staining, tubular necrosis, epithelial cells with pyknotic nuclei and the renal corpuscles are intact but few are damaged and marked interstitial lymphocytes infiltration with edema spaces (Figure 3E). The kidney sections of animals treated with ZN CITR‐WPNPs (MD) showed an increase in tubular atrophy, the proximal convoluted tubular lining epithelial cells with pyknotic nuclei, and desquamation of the cells in the tubular lumina but some glomeruli are damaged (Figure 3F). The kidney sections in animals treated with ZN CITR‐WPNPs (HD) showed regenerative and degenerative changes in proximal convoluted tubules extensive tubular necrosis, tubular epithelial swelling, deeply stained with the appearance of intra cytoplasmic and intraluminal eosinophilic hyaline droplets (Figure 3G).

Figure 3.

Photomicrographs of the kidney sections of (A) control rats showing normal parenchyma, intact renal corpuscles with normal glomerular tufts; (B) rats treated with CCl₄ showing tubular dilatation with pyknotic nuclei (blue arrow) and hyaline casts (black arrow) in their lumen others shows necrosis, venous congestion, hemorrhage with lymphocytic proliferation (H); (C) rats treated with WPNPs plus CCl₄ showing nearly normal renal tubules with vesiculated epithelial cells nuclei (black arrow), few tubules have hyaline casts or heamhorrge in their lumen and glomerular mesengial proliferation or degenerated (DG); (D) rats treated with ZN CITR plus CCl₄ showing focal necrosis of the proximal convoluted tubular lining epithelial cells with areas of desquamation of the cells in the tubular lumina (n), most of renal tubules and glomeruli are largely intact with areas of inflammatory cell invasion; (E) rats treated CCl₄ plus ZN CITR‐WPNPs (LD) showing proximal tubular dilatation with dark eosinophillic staining neurotensin, tubular necrosis, epithelial cells with pyknotic nuclei (circle), the renal corpuscles are intact but few are damaged, marked interstitial lymphocytes infiltration with edema spaces; (F) rats treated CCl₄ plus ZN CITR‐WPNPs (MD) showing increased in tubular atrophy, the proximal convoluted tubular lining epithelial cells with pyknotic nuclei and desquamation of the cells in the tubular lumina (arrows), some glomeruli are damaged; (G) rats treated with CCl₄ plus ZN CITR‐WPNPs (HD) showing regenerative (T) and degenerative changes in proximal convoluted tubules (arrows) extensive tubular necrosis (N) and tubular epithelial swelling and deeply stained (b) with appearance of intra cytoplasmic and intra luminal eosinophilic hyaline droplets (Haemotoxylin and Eosin ×400). HD, high dose; LD, low dose; MD, medium dose; WPNP, whey protein nanoparticles; ZN CITR, zinc citrate.

4. DISCUSSION

The current results revealed that the synthesized WPNPs showed a semispherical shape and the incorporation of ZN CITR into WPNPs did not affect the shape of the particles; however, the particle size was increased and negative ζ potential was changed according to the amount of ZN CITR. These results were similar to those reported previously.^{[ 43 ]} These authors indicated that the particle size of the synthesized WPNPs was changed when zinc was incorporated in the range of daily requirements for healthy adults. In the current study, the particle size was a little higher than the size obtained by Gülseren et al.^{[ 43 ]} The desolvation can be used for the synthesis of WPNPs and these particles were stable in the acidic pH (pH 3) as reported by Gülseren et al.^{[ 44 ]} Additionally, metal ions can bind to the functional groups in protein such as amino acids, imidazole, carboxyl, sulfhydryl, and peptides.^{[ 45 ]} Moreover, the results of DLS measurements showed uniform granules for each formula, and the size was increased by increasing the ratio of ZN CITR which was 13.8%, 33.9%, and 46.92% for ZN CITR‐WPNPs (LD), ZN CITR‐WPNPs (MD), and ZN CITR‐WPNPs (HD), respectively. These ratios were selected based on the WHO and UNICEF^{[ 46 ]} recommendations. The current results showed that WPNPs and the three formulas of ZN CITR‐WPNPs have negative ζ potential similar to the results reported previously.^{[ 30} , ^{47 ]} All samples showed negative ζ potential, indicating the stability of these nanoparticles in different systems.^{[ 48 ]} The negative charge on WPNPs is attributed to the negative charge of carboxylate groups in WPI.^{[ 30} , ^{49 ]}

The protective role of WPNPs compared to the three formulas of ZN CITR‐WPNPs against CCl₄‐induced kidney damage was evaluated in the rat model. The doses of CCl₄, WPNPs, and the three ZN CITR‐WPNPs were selected based on our previous studies,^{[ 30} , ⁵⁰ , ^{51 ]} respectively. CCl₄ is a well‐known toxicant model for hepatic‐nephrotoxicity and its mode of action is well documented via the generation of oxidative stress through two phases including the conversion of CCl₄ by Cyt‐P‐450 to CCl⁻³, the free radical form, in the first phase.^{[ 52 ]} Then the second phase includes the reaction of CCl⁻³ with O₂ to produce the high‐reactive CCL₃OO⁻ radical.^{[ 53 ]} These radicals induce lipid peroxidation via binding with microsomal lipids and proteins.^{[ 50} , ^{54 ]} Hence, the outcome of these two phases is the generation of different ROS such as superoxide anion O₂, H₂O₂, and hydroxyl radicals.^{[ 55 ]} The current results showed that administration of CCl₄ increased the kidney function indices (creatinine, uric acid, and urea), increased NO and MDA along with the histological changes in the kidney tissue and the decrease of antioxidant enzymes (GPx, SOD, and CAT) and upregulated the mRNA expression of inflammatory‐related genes (TGF‐β1, IL‐1β, IL‐10, IL‐6, iNOS, and TNF‐α). The increase in kidney function indices and disturbances in oxidative stress markers indicated the nephrotoxicity of CCl₄ and support the earlier findings.^{[ 56} , ⁵⁷ , ^{58 ]} The decrease in antioxidant enzyme activity revealed that the defense capacity against ROS becomes insufficient due to the status of oxidative stress leading to the decrease in the activity of CAT, GPx, and SOD.^{[ 51} , ^{59 ]}

The effect of CCl₄ on mRNA expression of inflammatory genes indicated that this solvent‐induced upregulation of these genes. TGF‐β1 is a pro‐fibrotic mediator and the chemoattractant factor for inflammatory cells in chronic diseases. It acts via various signaling pathways and the most important one is Smad3.^{[ 60 ]} Our results showed that TGF‐β1 mRNA expression was increased in animals that received CCl₄ which was probably due to the excessive generation of ROS and Nuclear factor kappa‐light‐chain‐enhancer of activated B cells (NF‐κB) activation resulting in more inflammation and oxidative stress leading to the damage of the kidney.^{[ 61} , ^{62 ]} On the other hand, TNF‐α, IL‐1β, IL‐10, and IL‐6 are cytokines produced by macrophages, neutrophils, the activated Th2 cells, CD8+ T and B cells, and lymphocytes. These cytokines are involved in the upregulation of inflammation.^{[ 63 ]} The inflammatory cytokines and oxidative stress are tightly correlated and have a vital role in the chemical‐ and drug‐induced acute damage of the kidney. Moreover, TGF‐α suppresses cytokine production by inhibiting macrophage and Th1 cell activity; counteracts IL‐1, IL‐2, IL‐6, and TNF; and induces IL‐1ra 6. The increase in oxidative damage leads to the increase of inflammatory cytokines production and vice versa as reported in several studies.^{[ 64 ]} The increased generation of free radicals after CCl4 exposure may be responsible for the increased mRNA expression and the production of excess cytokines by renal tubular cells and leukocytes and are associated with inducing inflammation and acute damage of the kidney. The processes of inflammatory are primarily stimulated by NF‐κB, which is responsible for the modulation of cytokine production and consequently enhances inflammatory cytokines production.^{[ 63 ]} Additionally, caspase 1 activates the cytokine IL‐1β which is the precursor protein involved in the damage of the kidney.^{[ 65 ]} On the other hand, IL‐10 has an anti‐inflammatory action which coups the leukocytes activation and the release of chemokines and pro‐inflammatory cytokines.^{[ 66 ]} It was reported that treatment with exogenous IL‐10 blocks the upregulation of intercellular adhesion molecule‐1 and TNF‐α expression and suppresses neutrophil influx in the kidney.^{[ 67} , ^{68 ]}

The current findings showed that animals treated with ZN CITR, WPNPs, and ZN CITR‐WPNPs were comparable to the control group although these agents induced some improvement in the antioxidant and oxidative stress parameters. Moreover, the coadministration of these agents and CCl₄ overcome the kidney damage induced by CCl₄. Improvements in different biochemical, oxidants/antioxidant, gene expression, and histological pictures in the kidney suggested that these agents have antioxidant properties and could counteract the oxidative damage of CCl₄. ZN is the most important element following iron and plays a vital role in biological processes as a component of several proteins and enzymes.^{[ 69} , ^{70 ]} ZN is an important element in the synthesis of Cu‐ZN‐SOD which has a vital role in the suppression of ROS production and improves antioxidant activity.^{[ 71} , ^{72 ]} Despite its importance as an antioxidant,^{[ 73 ]} excess ZN may induce toxic symptoms including the depletion of GSH and increased hepatic ALT and AST.^{[ 74 ]} The nephroprotective role of ZN in the current study was in accordance with those reported in the literature which indicated that ZN regulates the synthesis of proteins, intracellular Ca, modulate the peroxidation of lipids, and the formation of free radicals.^{[ 75} , ^{76 ]}

ZN is an important element in the synthesis of Cu‐ZN‐SOD which has a vital role in the suppression of ROS production, induction of metallothioneins, which is a powerful free radical scavenger,^{[ 77 ]} improves the antioxidant activity,^{[ 71} , ^{72 ]} and decrease the level of lipid peroxidation.^{[ 78 ]} Moreover, zinc oxide nanoparticles (ZnO‐NPs) were reported to pass easily via the cell membrane, interact with the cellular macromolecules and induce several therapeutic effects so it was approved as anticancer therapy by Food and Drug Administration.^{[ 79 ]} In this study, ZN CITR‐WPNPs at the three doses induced suppression of the upregulation of mRNA expression for different inflammatory gens suggesting the anti‐inflammatory effects. Several reports also indicated the anti‐inflammatory properties of zinc nanoparticles since these particles suppress the mRNA expression for several inflammatory genes including iNOS, IL‐1β, IL‐6, COX‐2, and TNF‐α.^{[ 80 ]}

Moreover, the antioxidant, the anticancer, and the immuno‐enhancing properties of WPI were reported due to its rich content of sulfhydryl compounds.^{[ 81} , ^{82 ]} The protective effect of WPI reported in the current study is similar to that reported in the literature on other organs.^{[ 50 ]} This protection was reported to be due to the repair and regeneration of the damage induced by several toxicants.^{[ 83} , ^{84 ]} The proposed mechanisms for the protection of WPI are the reduction of ROS generation, the activation of regeneration, the ability to bind and cleat metals, and the antioxidants of several amino acids such as histidine‐containing peptides, alpha‐lactalbumin, and beta‐lactoglobulin.^{[ 85} , ⁸⁶ , ^{87 ]} Additionally, WPI showed anti‐inflammatory effects since it was reported to decrease the level of C‐reactive protein.^{[ 86 ]} Taken together, the current results indicated that the incorporation of ZN CITR with WPNPs enhanced its protection role against CCl₄‐induced kidney damage and genotoxicity.

Interestingly, this protection was varied according to the level of ZN CITR in the formula. The low level was more effective than the other two levels. These results were in accordance with the results in weanling pigs, broilers, and mice.^{[ 72} , ⁸⁸ , ^{89 ]} Several reports showed that zinc nanoparticles at a high dose (<50 mg/kg b.w) induced a toxic effect in mice^{[ 90} , ^{91 ]} and rats.^{[ 92} , ^{93 ]} Moreover, the potential protective role for the low level of ZN CITR‐loaded WPNPs may be explained by the higher amount of amino acids in this formula compared to the medium or high‐level formulas. In our previous work, we found that the amino acids histidine (HIS), threonine (THR), arginine (ARG), methionine (METH), and valine (VAL) were absent in the medium level of ZN CITR‐WPNPs and the amino acids serine, glycine, HIS, THR, ARG, METH, and VAL were absent in the high level of ZN CITR‐WPNPs.^{[ 30 ]} The absence of certain amino acids may affect the antioxidant properties of the formula and also affect the intestinal mechanism and neuropeptide gene expression.^{[ 94} , ^{95 ]}

5. CONCLUSION

WPNPs with an average size of 100 ± 2.3 nm and ζ potential of −96 mV were synthesized and were used for loading ZN CITR at three levels. The ZN CITR loaded to WPNPs was semispherical, with an average size of 160 ± 2.7, 180 ± 3.1, and 200 ± 2.6 nm and ζ potential of −126, −93, and −84 mV for ZN CITR‐WPNPs (LD), ZN CITR‐WPNPs (MD), and ZN CITR‐WPNPs (HD), respectively. The particle size and ζ potential were varied according to the ZN CITR level. Treatment with CCl₄ induced renal damage as demonstrated by the elevation of kidney function indices, oxidative markers, the depletion of antioxidant enzymes, the upregulation mRNA of inflammatory cytokines, and the histological changes in the kidney tissue. WPNPs, ZN CITR, and ZN CITR loaded WPNPs at the three levels showed potent protection against CCl₄‐induced renal damage. Moreover, ZN CITR‐loaded WPNPs were more effective than WPNPs or ZN CITR individually and ZN CITR‐WPNPs (LD) were the most effective. Therefore, WPNPs used for coating ZN CITR at a level of 7 mg/g WPNPs can be used effectively in the preparation of supplements for the protection of the kidney against different toxicants to enhance immunity and eliminate the detrimental effects of ZN overdose.

AUTHOR CONTRIBUTIONS

This work was carried out in collaboration between all authors. Mona A. Hassan, Aziza A. El‐Nekeety, Sekena H. Abdel‐Azeim, and Nabila S. Hassan carried out the experimental work, managed the literature searches, and shared in writing the first draft of the manuscript. Mosaad A. Abdel‐Wahhab wrote the protocol, managed the project, managed the analyses of the study, and wrote the final draft of the manuscript. All authors read and approved the final manuscript.

CONFLICT OF INTEREST STATEMENT

The authors declare no conflict of interest.

ETHICS STATEMENT

The murine experiments in this study were reviewed and approved by the Ethics Committee, which conformed to the animal ethics and welfare regulations. The entire process was in compliance with ethical norms.

DATA AVAILABILITY STATEMENT

The data that support the findings of this study are available from the corresponding author upon reasonable request.